www.elsevier.com/locate/ymcne

Mol. Cell. Neurosci. 28 (2005) 703–714

Experimental Charcot–Marie–Tooth type 1A: A cDNA

microarrays analysis

Tiziana Vigo,a,b,1 Lucilla Nobbio,a,b,1 Paul Van Hummelen,c Michele Abbruzzese,a,d

GianLuigi Mancardi,a,b Nathalie Verpoorten,e Kristien Verhoeven,e Michael W. Sereda,f

Klaus-Armin Nave,f Vincent Timmerman,e and Angelo Schenonea,b,*

aDepartment of Neurosciences, Ophthalmology and Genetics, University of Genova, Italy, via De Toni 5, 16132 Genova, ItalybCenter of Excellence for Biomedical Research, University of Genova, Italy, viale Benedetto XV, 16132 Genova, ItalycMicroArray Facility, Flanders Interuniversity Institute for Biotechnology, B-3000 Leuven, BelgiumdBioimaging and Molecular Physiology Institute, CNR, Genova, ItalyeDepartment of Molecular Genetics, Flanders Interuniversity Institute for Biotechnology, University of Antwerp, Antwerpen, B-2610, BelgiumfDepartment of Neurogenetics, Max-Planck Institute of Experimental Medicine, Hermann-Rein-Str. 3, D-37075 Gottingen, Germany

Received 11 June 2004; revised 25 November 2004; accepted 30 November 2004

To reveal the spectrum of genes that are modulated in Charcot–

Marie–Tooth neuropathy type 1A (CMT1A), which is due to

overexpression of the gene coding for the peripheral myelin protein

22 (pmp22), we performed a cDNA microarray experiment with

cDNA from sciatic nerves of a rat model of the disease. In

homozygous pmp22 overexpressing animals, we found a significant

down-regulation of 86 genes, while only 23 known genes were up-

regulated, suggesting that the increased dosage of pmp22 induces a

general down-regulation of gene expression in peripheral nerve

tissue. Classification of the modulated genes into functional categories

leads to the identification of some pathways altered by overexpression

of pmp22. In particular, a selective down-regulation of the ciliary

neurotrophic factor transcript and of genes coding for proteins

involved in cell cycle regulation, for cytoskeletal components and for

proteins of the extracellular matrix, was observed. Cntf expression

was further studied by real-time PCR and ELISA technique in

pmp22 transgenic sciatic nerves, human CMT1A sural nerve biopsies,

and primary cultures of transgenic Schwann cells. According to the

results of cDNA microarray analysis, a down-regulation of cntf, both

at the mRNA and protein level, was found in all the conditions

tested.

These results are relevant to reveal the molecular function of PMP22

and the pathogenic mechanism of CMT1A. In particular, finding a

specific reduction of cntf expression in CMT1A Schwann cells suggests

that overexpression of pmp22 significantly affects the ability of

Schwann cells to offer a trophic support to the axon, which could be

1044-7431/$ - see front matter D 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.mcn.2004.11.016

* Corresponding author. Department of Neurosciences, Ophthalmology

and Genetics, University of Genova, Italy, via De Toni 5, 16132 Genova,

Italy. Fax: +39 010 3538639.

E-mail address: aschenone@neurologia.unige.it (A. Schenone).1 The first two authors equally contributed to this project.

Available online on ScienceDirect (www.sciencedirect.com).

a factor, among other, responsible for the development of axonal

atrophy in human and experimental CMT1A.

D 2004 Elsevier Inc. All rights reserved.

Introduction

Charcot–Marie–Tooth (CMT) disease, with a prevalence of 1 in

2500, is the most common inherited peripheral neuropathy. CMT is

clinically and genetically heterogeneous, with autosomal dominant

(AD), recessive and X-linked transmission subtypes (Dyck et al.,

1993). Up to date more than 33 disease causing genes are known

for CMT and related peripheral neuropathies (http://www.molgen.

ia.ac.be/CMTMutations/).

Based on clinical, neuropathological, and genetic data, CMT

has been divided in different types. CMT type 1A (CMT1A) is an

AD demyelinating neuropathy normally due to a duplication of a

1.4 Mb region in chromosome 17p11.2–12, containing the gene

coding for the peripheral myelin protein 22 (PMP22) (Inoue et al.,

2001). Point mutations in the PMP22 gene may also cause

CMT1A (Roa et al., 1993; Valentijn et al., 1992).

PMP22, a member of an extended family of tetraspan membrane

proteins (Bolin et al., 1997; Magyar et al., 1997; Taylor et al., 1995),

is highly expressed in myelinating Schwann cells and in compact

myelin, where it represents 2–5% of total myelin proteins (Snipes et

al., 1999; Suter and Snipes, 1995). Pmp22 expression has also been

detected, during mouse development and in adulthood, in different

neural and non-neural tissues (Baechner et al., 1995). Even if

function and processing of PMP22 have been extensively studied,

the molecular mechanisms underlying CMT1A are still unclear

(Hanemann and Muller, 1998; Suter and Scherer, 2003).

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714704

Animal models of CMT1A have been developed (Huxley et al.,

1996; Magyar et al., 1996; Perea et al., 2001; Sereda et al., 1996).

Genetic characterization of pmp22 overexpressing nerves, in

CMT1A rats (Sereda et al., 1996), shows that Schwann cells

present abundant expression of genes encoding major structural

myelin proteins and aberrant co-expression of early Schwann cell

markers (Niemann et al., 2001).

As cDNA microarrays technology allows large-scale, compa-

rative gene expression profiling (Xiang et al., 2003) and has been

recently used to study gene expression in Schwann cells and sciatic

nerves of several animal models and in human nerves (Cameron et

al., 2003; Costigan et al., 2002; Kubo et al., 2002; Nagarajan et al.,

2001; Verheijen et al., 2003; Xiao et al., 2002), we performed a

cDNA microarrays experiment on sciatic nerves from a rat model

of CMT1A (Sereda et al., 1996) to reveal the complete spectrum of

genes that are modulated in the disease.

We found an altered expression level for 213 cDNA sequences,

among which several genes involved in specific pathways that may

be impaired in CMT1A. In particular, a selective down-regulation

of the ciliary neurotrophic factor (cntf) transcript was observed. As

cntf, which is produced by Schwann cells, specifically supports the

survival of motor and sensory neurons as well as the myelination

process (Sleeman et al., 2000; Stankoff et al., 2002), we further

studied its expression in human and experimental CMT1A and in

primary Schwann cells cultures from the CMT1A rat. We observed

a general down-regulation of cntf in CMT1A nerves and Schwann

cells. This result strongly suggests that pmp22 transgenic Schwann

cells are unable to offer an adequate trophic support to the axon,

leading to the late axonal atrophy observed in CMT1A nerves.

Results

Microarrays analysis and expression study on selected genes

In spite of the high sequence homology between mouse and rat

genomes, preliminary hybridization was conducted to test the

Fig. 1. (a) Scatter plot representing all the microarrays data. The duplicate spots we

The more red, the lower the P value. (b) Clones that were significant at the 5%

mouse cDNA array MouseV (VIB) with the rat RNA (data not

shown). Since these experiments showed that up to 80% of the

spotted sequences could be hybridized by rat probes, we proceeded

with testing gene expression in the pathological condition. We

performed two biological repeats, and every hybridization was

repeated in a dye swap. We considered up- or down-regulated

cDNA sequences in transgenic sciatic nerves when changes in

expression were greater than twofold compared to normal ones

(Fig. 1).

We found 213 cDNA sequences showing an altered expression

in transgenic nerves. Of these 213 cDNA sequences, 145 correlated

with 109 known genes and 68 with ESTs. The number of up-

regulated sequences was 55, referring to 23 known genes and 20

ESTs. Eighty-six known genes and 48 ESTs represented the group

of 158 down-regulated cDNA. In the array, more than a single

cDNA could represent a unique gene or an EST, so there was no

correspondence between the number of regulated cDNAs and the

genes. Considering the group of known genes, we observed that

only 22.5% were up-regulated, while most of the genes (77.5%)

were down-expressed. Furthermore, we classified the regulated

genes into functional categories on the basis of literature and using

Onto-Express database (Draghici et al., 2003) (Tables 1 and 2).

Among the up-regulated ones (Fig. 2a), we found a predominance

of genes coding for proteins involved in cell proliferation (16.7%),

transcription factors (12.5%), translation factors (8.3%), and signal

transducers (8.3%). The most representative categories in the

down-regulated group (Fig. 2b) were the proteins involved in

metabolic pathways (19.8%), integral membrane proteins (5.8%),

muscle (9.3%) and extracellular matrix components (10.4%), and

the cytoskeletal proteins (8.14%). Interestingly, we observed that

genes related to a specific functional category tended to cluster

among the up- or down-regulated ones (Fig. 3).

Several genes, known to be down- or up-regulated in CMT1A,

showed the expected pattern of expression. As previously observed

(Niemann et al., 2001), we found an up-regulation of the

transcription factor scip and of the mRNA coding for the low

affinity nerve growth factor receptor (p75ngfr), which is normally

re averaged. The color code in the picture is based on the significance level.

level.

Table 1

List of the down-regulated known genes

Accession no. Short name Description Ratio P value

Apoptosis BG069901 Bok Bcl-2-related ovarian killer protein 0.483 0.013

Cell proliferation AA240923 Gpc3 glypican 3 0.489 0.01

W65025 Jmj jumonji 0.395 0.004

Cytoskeleton AA231358 Cryab crystallin, alpha-B 0.361 0.0002

BG064035 Pea15 phosphoprotein enriched in astrocytes 15 0.264 0.015

BG073278 Tpm1 tropomyosin 1, alpha 0.478 0.028

BG062944 Tpm2 tropomyosin 2, beta 0.280 0.002

Mtap1b microtubule-associated protein 1 B 0.435 0.006

M13444/M13446 tubulin alpha-4 0.409 0.01

BG064838 Tuba2 tubulin, alpha-2 0.303 0.003

Extracellular matrix BG073196 Col1a1 procollagen, type I, alpha-1 0.310 0.005

BG073735 Col1a2 procollagen, type I, alpha-2 0.343 0.0005

BG065049 Col2a1 procollagen, type II, alpha-1 0.257 0.004

W89883 Col3a1 procollagen, type III, alpha-1 0.355 0.01

BG072558 Col4a1 procollagen, type IV, alpha-1 0.375 0.003

BG074851 Pcolce procollagen C-proteinase enhancer protein 0.446 0.002

BG073227 Fbln2 fibulin 2 0.360 0.0004

AA037995 Mfap5-pending microfibrillar associated protein 5 0.494 0.001

BG073988 Spon2 spondin 2, extracellular matrix protein 0.367 0.0008

Growth factors

and receptor

BG073613 Igf2 insulin-like growth factor 2 0.224 0.0007

BG065213 Grb10 growth factor receptor bound protein 10 0.447 0.0002

Integral membrane

proteins

BG074882 Cd151 CD151 antigen 0.493 0.008

W98963 Cd9 CD9 antigen 0.358 0.01

BG065404 Esdn-pending endothelial and smooth muscle cell-derived neuropilin-like 0.419 0.003

AA220458 Gpsn2 glycoprotein, synaptic 2 0.424 0.04

BG074344 Msln mesothelin 0.482 0.004

Ion transport W12937 Clic4 chloride intracellular channel 4 (mitochondrial) 0.409 9.75E-05

BG073152 Atp8a1 ATPase class I, type 8A, member 1 0.484 0.04

BG067078 Slc21a11 solute carrier family 21 member 11 0.284 0.012

Kinases AA277366 Snrk SNF-related kinase 0.428 4.44E-05

Metabolism BG073844 Aacs acetoacetyl-CoA synthetase 0.245 2.90E-05

AA537637 Acas2 acetyl-coenzyme A synthetase 2 (ADP forming) 0.348 0.0004

BG073378 Acat2 acetyl-coenzyme A acetyltransferase 2 0.226 0.002

BG073739 Akr1b3 aldo-keto reductase family 1, member B3 0.122 6.75E-06

BG065457 Aldo1 aldolase 1, A isoform 0.415 0.002

BG067158 Aldo3 aldolase 3, C isoform 0.364 0.002

W18057 Ckmt2 creatine kinase, mitochondrial 2 0.330 0.008

BG064089 Elovl6 ELOVL family member 6, elongation of long chain fatty acids 0.261 0.02

W11965 Eno3 enolase 3, beta muscle 0.121 1.64E-06

BG063838 Fasn fatty acid synthase 0.455 0.01

AA122891 Gapd glyceraldehyde-3-phosphate dehydrogenase 0.376 0.04

W17582 Mgll monoglyceride lipase 0.284 0.004

BG064680 Mod1 malic enzyme, supernatant 0.235 0.002

W16286 Pygm muscle glycogen phosphorylase 0.366 0.03

BG069211 Fdft1 farnesyl diphosphate farnesyl transferase 1 0.179 0.01

BG063416 Lpl lipoprotein lipase 0.363 0.02

BG064900 Scd2 stearoyl-coenzyme A desaturase 2 0.433 0.03

Mitocondria BG076219 Cabc1 chaperone, ABC1 activity of bc1 complex like (S. pombe) 0.339 0.0005

BG065259 Cyb5 cytochrome b-5 0.374 5.26E-05

BG073138 Cyb561 cytochrome b-561 0.384 0.01

BG065358 Maoa monoamine oxidase A 0.378 0.0007

Muscle proteins BG075715 Actn2 actinin alpha 2 0.071 0.002

AA032362 Mylpf myosin light chain, phosphorylatable, fast skeletal muscle 0.096 1.84E-05

BG076112 Myo1b myosin IB 0.315 0.0004

BG064461 Dysf dysferlin 0.341 0.004

BG073597 Tnnt1 troponin T1, skeletal, slow 0.076 0.0003

AA047966 Fhl1 four and a half LIM domains 1 0.167 0.0001

AA002733 Myoz1 myozenin 1 0.392 0.019

AA510391 Ttid titin immunoglobulin domain protein (myotilin) 0.337 0.04

Myelin AA097191 Mpz myelin protein zero 0.225 0.037

BG072867 Prx periaxin 0.435 0.003

rat PMP22 (peripheral myelin protein 22) 0.272 0.006

(continued on next page)

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714 705

Accession no. Short name Description Ratio P value

Neurotrophic factor AA543497 Cntf ciliary neurotrophic factor 0.075 6.15E-05

Transcription factors AA518455 Tcf4 transcription factor 4 0.440 0.001

W71604 Deaf1 deformed epidermal autoregulatory factor 1 (Drosophila) 0.256 0.01

Signal transduction AA217217 Itpkb inositol 1,4,5-trisphosphate 3-kinase B 0.498

AA020462 Rab2 RAB2, member RAS oncogene family 0.437 0.0006

BG063588 Rhoip3-pending rho interacting protein 3 0.412 0.002

BG076141 Chn1 chimerin 1 0.486

Others BG075128 Cetn2 centrin 2 0.441 0.016

BG063515 Fth ferritin heavy chain 0.258 0.019

AA049981 Gatm glycine amidinotransferase 0.383 0.008

AA474937 Epb4.1l2 erythrocyte protein band 4.1-like 2 0.474 0.004

BG063261 H19 H19 fetal liver mRNA 0.435 0.002

BG069748 Lims2 LIM and senescent cell antigen like domains 2 0.134 0.001

BG073671 Mfge8 milk fat globule-EGF factor 8 protein 0.434 0.0008

BG073463 Odf2 outer dense fiber of sperm tails 2 0.406 0.02

BG073096 Olfm1 olfactomedin 1 0.487 0.007

BG073341 Rsdr1-pending retinal short-chain dehydrogenase/reductase 1 0.496 0.003

AA461746 Ssg1-pending steroid-sensitive gene 1 0.458 0.001

AA030949 Necl1-pending nectin-lke 1 0.284 0.001

BG067852 Pros1 protein S (alpha) 0.211 0.02

BG075594 Pxp-pending peroxisomal protein 0.375 0.039

BG066411 Serpine2 serine (or cysteine) proteinase inhibitor, clade E, member 2 0.406 0.006

BG074009 Uchl1 ubiquitin carboxy-terminal hydrolase L1 0.461 0.0004

BG076040 Zdhhc2 zinc finger, DHHC domain containing 2 0.497 0.017

AA015155 S100a3 S100 calcium binding protein A3 0.322 0.0002

Several genes were represented in the array by more than one sequence; however, only one sequence is listed for each gene.

Table 1 (continued)

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714706

expressed by non-myelinating Schwann cells and immature

Schwann cells precursors. Some genes known to carry point

mutations responsible for other types of CMT, like the periaxin

(prx) and the laminin A (lmna) (De Sandre-Giovannoli et al., 2002;

Guilbot et al., 2001), were also differentially expressed. Moreover,

Table 2

List of the up-regulated known genes

Accession no. Short name Descrip

Basal lamina AA066180 Lmna lamin A

Cell proliferation BG070163 Ccnd1 cyclin D

BG066310 Ccnd3 cyclin D

AA272260 Csrp2 cysteine

B-cell t

BG072743 Btg1 anti-pro

Cytoskeleton BG074004 Vil2 villin 2

Extracellular matrix BG067727 Tnfrsf12a tumor n

Growth factors and receptor AA048449 Ngfr nerve g

Integral membrane protein W12889 Cdh3 cadherin

Myelin BG075879 Plp Proteoli

Poliamine catabolism BG072707 Sat spermid

Signal trasduction BG072288 Adcy9 adenyla

AA013851 Rap1ga1 Rap1, G

Transcription factors BG071421 Idb2 inhibito

BG065255 Scip POU do

W14398 Sox4 SRY-bo

Translation factors AA068436 Bzw2 basic le

BG069032 Gc20-pending translati

Others AA063753 Abca1 ATP-bin

BG069237 Abhd3 abhydro

BG072800 BC038058 transcri

W36002 Oraov1 oral can

BG066068 Zfp216 zinc fin

BG075959 Pcbp4 poly(rC

Several genes were represented in the array by more than one sequence, howeve

we identified a modulation of a few genes lying in chromosomal

regions associated with different forms of dominant and recessive

CMT (Table 3) (Berciano and Combarros, 2003). These genes may

be studied, in the future, as positional candidate in mutational

analysis.

tion Ratio P value

2.652 0.04

1 3.809 0.02

3 2.771 0.01

-rich protein 2 9.189 1.21E-05

ranslocation gene 1, 0.0005

liferative 2.842

2.371 0.002

ecrosis factor receptor superfamily, member 12a 5.256 0.005

rowth factor receptor 3.160 0.005

3 2.476 0.04

pid protein (myelin) 2.198 0.022

ine/spermine N1-acetyl transferase 3.837 0.001

te cyclase 9 2.027 0.045

TPase-activating protein 1 2.402 0.006

r of DNA binding 2 2.423 0.0005

main, class 3, transcription factor 1 9.077

x containing gene 4 2.526 0.02

ucine zipper and W2 domains 2 3.710 0.0005

on factor sui1 homolog 3.667 0.01

ding cassette, sub-family A (ABC1), member 1 3.999 0.004

lase domain containing 3 2.076 0.04

ption termination factor, mitochondrial-like 2.048 0.02

cer overexpressed 1 2.753 0.004

ger protein 216 2.686 0.001

) binding protein 4 2.094 0.012

r only one sequence is listed for each gene.

Fig. 2. Categorization of up-regulated genes (a) and down-regulated genes

(b) into functional categories.

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714 707

Genes involved in cell cycle (cyclin D1 and cyclin D3), in cell

adhesion and motility (cd9-antigen), and trophic support (cntf)

were selected to confirm the microarray results by semiquantitative

RT-PCR reactions. We observed a full correspondence between

levels of gene expression in microarray hybridization and semi-

quantitative RT-PCR (Table 4). A significant (P b 0.05) up-

regulation of the cyclin (ccnd1 and ccnd3) transcripts was found in

Fig. 3. Categorization of modulated genes from the most representative functio

percentage was calculated by division of the number of down- or up-regulated g

both hemizygous and homozygous rats as compared to normal

controls. A significant (P b 0.05) down-regulation of the ciliary

neurotrophic factor (cntf) and the cd9-antigen transcripts was

observed only in the homozygous pmp22 overexpressing nerves,

but the hemizygous ones also showed lower levels of these genes

compared to normal controls. We also analyzed the expression

levels of genes coding for other important neurotrophic factors

using semiquantitative RT-PCR. We tested the expression of nerve

growth factor (ngf), brain derived neurotrophic factor (bdnf), glial

derived neurotrophic factor (gdnf), and neurotrophin 3 (nt3). The

cDNA corresponding to those transcripts was spotted on the mouse

gene chip but did not show altered expression in transgenic nerves.

The results of the RT-PCR experiments (Fig. 4) confirmed that cntf

is the only neurotrophic factor significantly down-regulated in

pmp22 overexpressing nerves.

Cntf expression in CMT1A

Considering the strong and specific reduction of cntf mRNA in

pmp22 overexpressing nerves, we further studied its expression in

experimental and human CMT1A and in cultures of pmp22

overexpressing Schwann cells.

In archived sural nerves, we could quantify by real-time PCR

the CNTF mRNA in all normal controls. Instead, the transcript was

not detectable in CMT1A nerves. To reliably compare cntf

expression in human and experimental CMT1A, we repeated the

transcript analysis, in rat sciatic nerves, by real-time PCR. Again, a

down-regulation of cntf was found in pmp22 transgenic hemi-

zygous (0.49 F 0.07) and homozygous (0.02 F 0.01) nerves

compared to normal controls.

As a reduced expression of cntf could be merely due to a loss of

Schwann cells in CMT1A nerves, we counted Schwann cells

number in pmp22 rat nerves and in normal controls. We did not

observe any difference between homozygous (13.4 F 0.4 cells/

mm2), hemizygous (13.4 F 0.65 cells/mm2), and normal nerves

(12.5 F 1.34 cells/mm2).

nal categories in the up (gray)- and down (white)-regulated groups. The

enes by the total number of genes in each category.

Table 3

Modulated genes lying in chromosomal regions associated with CMT

Accession no. Symbol Name Human chromosome Disease

BG073735 Col2a1 procollagen, type I, alpha-2 12q13 CMT2G

AA461746 Ssg1-pending steroid sensitive gene 1 3q13 HMSNP

AA047966 Fhl1 four and a half LIM domains 1 Xq26 CMT2X

AA240923 Gpc3 glypican 3 Xq26 CMT2X

BG073597 Tnnt1 troponin T1 19q13 AR-CMT2B2

AA002733 Myoz1 myozenin 1 10q22 HMSNR

AA220458 Gpsn2 glycoprotein, synaptic 2 19p13 DI-CMTB

AA013851 Rap1ga1 Rap1, GTPase-activating protein 1 19p13 DI-CMTB

BG073341 Rsdr1-pending retinal short-chain dehydrogenase/reductase 1 1p36 DI-CMTC

HMSN-P: hereditary motor and sensory neuropathy, proximal type; HMSN-R: hereditary motor and sensory neuropathy, russe type; DI-CMTB: Charcot–

Marie–Tooth neuropathy, dominant intermediate type B; DI-CMTC: Charcot–Marie–Tooth neuropathy, dominant intermediate type C.

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714708

Furthermore, to evaluate the ability of pmp22 overexpressing

Schwann cells to produce cntf in the absence of contaminating

cells and independently to the axon, we analyzed cntf expression in

short-term Schwann cells cultures. Again, real-time PCR was used

to quantify cntf mRNA in normal and transgenic Schwann cells

isolated from 30-day-old sciatic nerves (Nobbio et al., 2004). We

observed that mRNA levels of cntf were reduced in hemizygous

(0.7 F 0.06) and homozygous (0.53 F 0.07) transgenic cultures

compared to normal ones.

Using an ELISA method we also quantified the levels of cntf in

sciatic nerves and in Schwann cells cultures. We observed a

significantly (P b 0.01) lower concentration of protein in sciatic

nerves from homozygous (4.3 F 1.2 pg/Ag of total proteins) and

hemizygous (14.18 F 1.7 pg/Ag of total proteins) pmp22

overexpressing nerves compared to normal controls (64.4 F 19.2

pg/Ag of total proteins). Moreover, we found a significant (P b

0.01) decrease of cntf in homozygous (12.8 F 1.3 pg/Ag of total

proteins) and hemizygous (18.3 F 0.3 pg/Ag of total proteins)

purified Schwann cells compared to normal ones (47.9F 0.8 pg/Agof total proteins). We also quantified cntf protein in the culture

medium, observing that in homozygous (2.6 F 0.6 pg/100 Al) andhemizygous (2.15 F 0.4 pg/100 Al) Schwann cells cntf releasing

was significantly (P b 0.01) reduced compared to control cultures

(11.79 F 2.7 pg/100 Al). These results strongly support the

hypothesis that pmp22 overexpressing Schwann cells are primarily

unable to produce and release normal levels of cntf.

Discussion

We used cDNA microarrays technology to perform a complete

gene expression profiling in sciatic nerves of transgenic rats

overexpressing pmp22. In fact, although the genetic cause of

Table 4

Differential gene expression by cDNA microarrays (expressed as the average of log

intensity and ribosomal RNA 28S)

Gene Normal Heterozygous

cd9 1.268 F 0.23 0.442 F 0.09

cntf 1.138 F 0.32 0.57 F 0.19

ccnd1 0.16 F 0.02 0.39 F 0.11

ccnd3 0.11 F 0.007 0.26 F 0.06

Animals tested 4 4

RT-PCR tests were performed on four animals independently for each condition.

* Statistical significance ( P b 0.05) obtained with ANOVA test.

CMT1A is well known, and an abnormal expression of a few genes

coding for myelin proteins and Schwann cells differentiation

markers has been previously described in pmp22 overexpressing

rats (Niemann et al., 2001), little is known about the pathomechan-

isms underlying the disease and the effect of pmp22 over-

expression on the transcriptional activity in the peripheral

nervous system. We analyzed gene expression in nerves from

30-day-old rats, because at this age homozygous rats are easily

distinguishable from hemizygous ones (Sereda et al., 1996) and

their nerves show clear clinical, neuropathological, and neuro-

physiological abnormalities (Grandis et al., 2004).

Our microarray experiment first indicates that the increased

dosage of pmp22 induces a general down-regulation of gene

expression in sciatic nerves. This observation may represent a

generic damage to the nerve tissue by the genetic modification

more than a specific consequence of pmp22 overexpression. We

found only a minority of genes that were up-regulated in pmp22

transgenic rats. Among these, cyclin D1 and cyclin D3 mRNAs

seem to be particularly interesting. D-type cyclins are required for

the initial steps in cell division and nuclear import is crucial for the

function of cyclin D1 in promoting cell proliferation. Myelinating

Schwann cells express cyclin D1 in the perinuclear region, but after

axons are severed, cyclin D1 is strongly up-regulated in parallel

with Schwann cell proliferation and translocates into Schwann cell

nuclei (Atanasoski et al., 2001). In pmp22 overexpressing rats an

up-regulation in cyclin D1 expression was already found in the

Schwann cells nucleus (Atanasoski et al., 2002). A cyclin D1 up-

regulation was also reported in peripheral nerves after axotomy

(Kubo et al., 2002). Since the pmp22 gene shows homology to the

growth arrest-specific gene gas3, an effect of pmp22 over-

expression has been proposed on Schwann cells proliferation, but

results are contrasting in this regard. In vitro experiments on

PMP22 overexpressing human Schwann cells show a decreased

arithms) and semiquantitative RT-PCR (expressed as ratio between the band

Homozygous Microarray ratio

homozygous/norma

0.298 F 0.04* 0.36

0.084 F 0.01* 0.075

* 0.717 F 0.11* 3.8

* 0.45 F 0.15* 2.77

4

l

Fig. 4. RT-PCR analysis of neurotrophic factors expression. Representative gels from control (1), hemizygous (2), and homozygous (3) rat sciatic nerves. No

significant differences were found, between groups, in mRNA expression of (a) BDNF (0.54 F 0.12 n. 4 vs. 0.77 F 0.26 n. 4 vs. 0.62 F 0.028 n. 4; n.s.); (b)

GDNF (0.05 F 0.04 n. 4 vs. 0.34 F 0.18 n. 4 vs. 0.21 F 0.08 n. 4; n.s.); (c) NGF (0.31 F 0.12 n. 4 vs. 0.30 F 0.08 n. 4 vs. 0.28 F 0.12 n. 4; n.s.); (d) NT3

(0.75F 0.15 n. 4 vs. 0.88F 0.08 n. 4 vs. 0.5F 0.2 n. 4; n.s.). On the contrary, CNTF transcript levels (e) were significantly higher in control nerves compared

to homozygous ones (1.138 F 0.32 n. 4 vs. 0.57 F 0.19 n. 4 vs. 0.084 F 0.01 n. 4; P b 0.01).

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714 709

proliferation (Hanemann et al., 1997). However, in a CMT1A

animal model, a continued Schwann cell proliferation into

adulthood was observed (Magyar et al., 1996). Our results,

although insufficient to make any conclusion, are in keeping with

the previous study (Atanasoski et al., 2002) showing that pmp22

overexpressing Schwann cells proliferate after demyelination.

Moreover, we found a deregulation of other genes involved in

negative modulation of cell proliferation, suggesting that in pmp22

overexpressing nerves impairment in the cell cycle regulation

affects the resident proliferating cellular populations. Finally,

among the up-regulated genes we identified several transcription

factors (Idb2, Sox4, Scip). Further studies are needed to elucidate a

possible role of these nuclear proteins in the Schwann cells

biology.

We found that a large group of down-regulated genes is

involved in lipidic and glucidic metabolism. Impairment in the

cholesterol biosynthesis pathways has been shown in tellurium-

induced neuropathy (Harry et al., 1989), and the consequent lack of

cholesterol destabilizes myelin (Wagner-Recio et al., 1991). Many

genes directly involved in lipid metabolism have been found

regulated by microarray analysis during myelination (Nagarajan et

al., 2002; Verheijen et al., 2003), underscoring the relevance of

Schwann cells cholesterol synthesis in myelination. Finding a

down-regulation of genes coding for enzymes involved in

cholesterol biosynthesis is consistent with the absence of myelin

in homozygous transgenic rats.

Genes coding for cytoskeleton components were also down-

regulated in homozygous transgenic nerves. It has been shown that

pmp22 overexpression affects the differentiation and the spreading/

adhesion properties of Schwann cells (Brancolini et al., 2000;

Magyar et al., 1996). Finding a diffuse down-regulation of

cytoskeleton elements further supports the idea that overexpression

of pmp22 induces changes in the ability of a Schwann cell to

change its shape and switch on the myelination process (Nobbio et

al., 2004). As Schwann cells are the highly predominant population

in peripheral nerves and morphological abnormalities of other

components of sciatic nerve, like axons, are not present at this age

(Grandis et al., 2004), changes in transcriptional profile have to be

considered mainly caused by the imbalance in Schwann cell

function.

PMP22 is a tetraspan membrane protein (Bolin et al., 1997;

Magyar et al., 1997; Taylor et al., 1995). Our microarray

experiment shows a down-regulation of Cd9 mRNA, another

tetraspan cell surface protein expressed in the peripheral nervous

system by Schwann cells (Banerjee and Patterson, 1995; Kaprie-

lian et al., 1995; Tole and Patterson, 1993). Down-regulation of

cd9 could represent a defensive mechanism carried out by

Schwann cells to counterbalance pmp22 overexpression. Gene

compensation mechanisms occur in different models (Bowe et al.,

2002; Groussin et al., 2000). We propose a similar mechanism to

explain Cd9 loss in pmp22 overexpressing nerves. Cd9 was shown

to be associated with h3, h6, and h1 integrins (Hadjiargyrou et al.,

1996), and perturbation of its expression alters Schwann cell

adhesion, proliferation, and migration as well as neurite outgrowth

in sympathetic neurons (Anton et al., 1995; Hadjiargyrou and

Patterson, 1995). Therefore, down-regulation of Cd9 could itself

account for some of the shaping defects previously observed in

pmp22 overexpressing Schwann cells (Brancolini et al., 2000;

Nobbio et al., 2004).

Another group of down-regulated genes was represented by

extracellular matrix components such as collagens. In literature,

contrasting results have been reported about expression of

collagens in hereditary neuropathies of the CMT type. In human

and experimental CMT1A an up-regulation of collagen types I, III,

IV, V, and VI and an increased collagen deposition were,

respectively, observed (Palumbo et al., 2002; Robaglia-Schlupp

et al., 2002). Instead, in the sciatic nerves of Trembler-J mouse,

which carries a point mutation in the pmp22 gene, a reduction of

collagen IV was reported (Misko et al., 2002). Discrepancies in the

animal species and in the disease stage may account for these

differences. However, further studies are needed to elucidate the

role of collagens in the development of CMT1A.

The most interesting result of our cDNA microarrays experi-

ment is the profound down-regulation of the cntf gene observed in

homozygous CMT1A rats. Schwann cells are sources of cytokines

and neurotrophins that can affect the survival, differentiation, and

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714710

growth of neurons (Bunge, 1993). Cntf is one of the most

important neurotrophic factors produced by myelinating Schwann

cells (Sendtner et al., 1990) and is also able to enhance myelin

formation (Stankoff et al., 2002). Its levels dramatically fall in the

early stages of Wallerian degeneration (Sendtner et al., 1990). A

consistent reduction of the cntf transcript was also found in sciatic

nerves from the Trembler mouse (Friedman et al., 1992).

Accordingly, we found a dramatic decrease of the cntf mRNA

and protein in pmp22 overexpressing nerves. Interestingly, cntf is

the only neurotrophic factor to show a down-regulation, as

expression of bdnf, gdnf, ngf, and nt3 does not change, as

confirmed by RT-PCR analysis. We also found a complete absence

of the CNTF transcript in sural nerve biopsies from CMT1A

patients. Several reports described a reduction of CNTF expression

in different neuropathies (Ito et al., 2001; Lee et al., 1996;

Yamamoto et al., 2001, 2002), but a total absence of this

neurotrophic factor in peripheral nerves was never found. Finding

a normal number of Schwann cells in pmp22 overexpressing

sciatic nerves, as previously observed in human CMT1A sural

biopsies (Hanemann et al., 1997), excludes that the extreme

reduction of CNTF expression is due to a loss of Schwann cells.

Taken together, these results suggest that both in human and

experimental CMT1A there is a deficiency in CNTF support from

the Schwann cells to the axon, which could contribute to the

development of the axonal atrophy, observed in the late stages of

CMT1A (Sahenk et al., 1999; Sancho et al., 1999). In agreement

with this hypothesis, we also showed that pmp22 overexpressing

Schwann cells, besides expressing lower level of cntf transcript,

also produce and release low levels of the protein. This happens

both in the presence and absence of the axon, suggesting a primary

inability of transgenic Schwann cells in the production of this

specific neurotrophic factor.

In conclusion, our study provides the first comprehensive list of

genes showing altered expression levels in sciatic nerves of pmp22

transgenic rats. This gene expression profile suggests that pmp22

overexpression deeply alters the delicate balance regulating the

Schwann cells proliferation and differentiation, as showed by the

observation of a severe derangement in the expression of genes

involved in cell cycle support and in the cytoskeletal organization.

Moreover, finding reduced levels of cntf in CMT1A nerves and

Schwann cell cultures suggests that the trophic support offered by

pmp22 overexpressing Schwann cells to the axon is highly

insufficient.

Finally, since some of the modulated genes map into

chromosomal regions linked to other types of hereditary neuro-

pathies, our results might be of help in future mutational analysis to

reveal new disease responsible genes.

Experimental methods

Animal model

We used 30-day-old homozygous transgenic rats overexpress-

ing pmp22 (Sereda et al., 1996). Although the hemizygous

condition is a more appropriate model of CMT1A, we compared

homozygous rats with the normal controls, as we were interested in

studying the general consequences of pmp22 overexpression on

sciatic nerve mRNA profile. Next to homozygous animals, we also

used hemizygous ones, when we looked at selected genes by

semiquantitative RT-PCR, real-time PCR, and ELISA. Rearing

conditions were consistent with the guidelines of the Italian Health

Ministry relating to the use and storage of transgenic organisms.

RNA extraction

Total RNA was obtained from sciatic nerves using standard

methods to perform cDNA microarrays experiments. Eight sciatic

nerves from sex-matched homozygous animals and four sciatic

nerves from normal littermates were homogenized in TriPure

Isolation Reagent (Boehringer Mannheim, Germany), with a

Polytron homogenizer (Kinematica Srl, Italy) for 15 s. An equal

volume of 70% ethanol was added to the watering phases deriving

from chloroform extraction, and samples were transferred to

Qiagen Rneasy Mini Kit columns (Qiagen SpA, Germany). The

extraction proceeded according to the manufacturer instructions.

Digestion of contaminant DNA was performed in the columns,

using an RNAse-free DNAse (Qiagen SpA, Germany). Total RNA

extraction was repeated two times to perform the microarray

hybridization twice. The quality and the concentration of RNA

were checked with NanoDrop Spectophotometer ND-1000 (Nano

Drop Technologies Inc., Delaware, USA).

cDNA microarray

The mouse gene set consisted of five separate microarrays

containing a total of 21,492 cDNA fragments from the 6K

collection of Incyte (Mouse Gem I, Incyte, USA) and from the

15K collection of the National Institute of Aging (http://

lgsun.grc.nia.nih.gov). On each of the five slides, on average

4300 cDNAs were spotted in duplicate, distant from each other, on

type VIIstar silane-coated slides (Amersham BioSciences, Buck-

inghamshire, UK). The cDNA inserts were PCR amplified using

M13 primers, purified with MultiScreen-PCR plate (Millipore,

Belgium), and arrayed in 50% DMSO on Type VII silane-coated

slides (Amersham BioSciences, Buckinghamshire, UK) using a

Molecular Dynamics Generation III printer (Amersham BioScien-

ces). Slides were blocked in 2� SSPE, 0.2% SDS for 30 min at

258C.A minimum of 5 Ag total RNA was linearly amplified using in

vitro transcription as previously described (Puskas et al., 2002).

Briefly, RNA was reverse transcribed to double-stranded cDNA

using an anchored oligo-dT + T7 promoter (5V-GGCCAGT-GAATTGTAATACGACTCACTATAGGGAGGCGG-T24(ACG)-

3V) (Eurogentec, Belgium). From this cDNA, RNA was produced

via T7-in vitro transcriptase until an average yield of 10–30 Agamplified RNA (aRNA). From the aRNA, 5 Ag was labeled by

reverse transcription using random nonamer primers (Genset,

Paris, France), 0.1 mM d(G/T/A)TPs, 0.05 mM dCTP (Amersham

BioSciences, UK), 0.05 mM Cy3-dCTP or Cy5-dCTP (Amersham

BioSciences, UK), 1� first strand buffer, 10 mM DTT, and 200

Units of SuperScript II (Invitrogen, Belgium) in 20 Al total volume.

The RNA and primers were denatured at 758C for 5 min and

cooled on ice before adding the remaining reaction components.

After 2 h incubation at 428C, mRNA was hydrolyzed in 250 mM

NaOH for 15 min at 378C. The sample was neutralized with 10 Alof 2 M MOPS and purified with Qiaquick (Qiagen, Germany).

The probes were resuspended in 210 Al hybridization solution

containing 50% formamide, 1� hybridization buffer (Amersham

BioSciences, UK), 0.1% SDS, and 60 Ag/ml poly-dT. Hybrid-

ization and post-hybridization washing were performed at 458Cusing an automated slide processor (ASP; Amersham BioSciences,

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714 711

UK). Post-hybridization washing was performed in 1� SSC, 0.1%

SDS, followed by 0.1� SSC, 0.1% SDS, and 0.1� SSC. The

complete ASP program can be downloaded from www.

microarrays.be (/technology/protocols). Arrays were scanned at

532 and 635 nm using a Generation III scanner (Amersham

BioSciences, UK). Image analysis was performed with ArrayVi-

sion (Imaging Research Inc, Ontario, Canada). Two biological

repeats and each hybridization were repeated in a dye swap.

Spot intensities were measured as artifact removed total

intensities, subtracted with the local background (sARVol), and

filtered based on two standard deviations above background. For

each gene, ratios of red (Cy-5) over green (Cy-3) intensities (I)

were calculated and normalized via a Lowess Fit of the log2 ratios

[log2(Icy-5 / Icy-3)] over the log2 total intensity [log2(Icy-5 � Icy-

3)]. Mean ratios were calculated from the duplicate spots, and only

values with covariance (CV) b0.5 were further taken into account.

Normalized ratios that were statistical significant using a two-tailed

t test (5% level) between the dye-swap repeat and higher than 1 or

lower than �1 (log2 scale) were considered differentially

expressed.

Semiquantitative reverse transcriptase PCR

To confirm the accuracy of cDNA microarrays, semiquantita-

tive RT-PCR was performed on selected genes, known to be

important in the biology of Schwann cells. Specific oligonucleotide

primer pairs (Table 5) were designed using Primer 3 software

(http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi)

in order to amplify fragments of 180–250 bp in length. To avoid

the amplification of contaminant genomic DNA, we selected

primers lying on distinct exons. We performed RT-PCR on sciatic

nerves from four different rats for genetic condition, each of them

Table 5

Oligonucleotide pairs used in semiquantitative RT-PCR experiments

Gene

Forward primers (5V–3V)Reverse primers (5V–3V)

ccnd1

gcgtaccctgacaccaatct

gaaccggtccaggtagttca

ccnd3

tgcatctatacggaccaagctat

aggtctgagcatgctttttga

cntf

gcaaacacctctgacccttc

acggtaagcctggaggttct

cd9

tgggattgttcttcggattc

gctatgccacagcagttcaa

bdnf

acttttgagcacgtgatcgaaga

ggtagttcggcattgcgagt

gdnf

ggacgggactctaagatgaagtt

cgtcatcaaactggtcaggata

ngf

cacaggagcaagcgctcatc

acacacacgcaggctgtatctatc

Trkb

cgacactcaggatttgtattgcc

tccgtgtgattggtgacgtgtatt

coming from a different breeding. Results were expressed as the

mean of the four animals.

First-strand cDNA was synthesized from 250 ng of total RNA

in a 30 Al reaction using the Superscript system (Invitrogen Srl,

Italy). Semiquantitative amplification was performed from 10 Al ofthe first strand reaction. The product of the endogenous 18S RNA

served as an internal standard. Amplification following hot start (5

min at 958C) was carried out for 20 cycles consisting of 1 min at

958C, 1 min at 568C, and 1 min at 728C; an additional extension

time of 10 min was added. Preliminary experiments were

conducted to ensure that measurements were performed in the

exponential phase of amplification process and the expression of

the reference gene was uniform in every condition. PCR products

were analyzed on 2% agarose gels, and band intensity was

measured on a Gel Doc 1000 image system (Bio-Rad, Hercules,

CA). Results were expressed as ratio between specific band

intensity and 18S RNA band.

Real-time PCR

cDNA was prepared from sciatic nerves of 30-day-old pmp22

overexpressing rats and their normal littermates and from primary

Schwann cell cultures. Moreover, we analyzed human sural nerve

biopsies from control subjects and patients with CMT1A. Total

RNA was extracted as previously described from an independent

pool of at least nine animals per genetic condition and from three

human subjects per group. Relative quantification of expression of

human and rat CNTF was performed using an ABI PRISM 7700

Sequence Detection System with SYBR green chemistry (Applied

Biosystem) as described (http://www.docs.appliedbiosystems.com/

pebiodocs/04303859.pdf). Dissociation curve analysis was per-

formed using Dissociation Curve 1.0 software (ABI) for each PCR

reaction to detect and eliminate possible primer–dimer artefacts.

Oligonucleotides were selected to amplify a fragment containing

sequences from two adjacent exons in order to avoid contaminating

genomic DNA amplification. To standardize the amount of cDNA

in each reaction, we measured the amount of 18S rRNA, which

showed no variation in expression in both human and animal

samples. The comparative cycle threshold (Ct) method (User

Bulletin 2, 1997; Applied Biosystems, Foster City, CA) was used

to analyze the data by generating relative values of the amount of

target cDNA. Relative quantification for cntf gene, expressed as

fold variation over control, was calculated by the DDCt method,

using control samples as calibrators.

Human sural nerves biopsy

Archived sural nerve biopsies, obtained for diagnostic purpose

when the genetic diagnosis of CMT1A was not yet available, were

used for this study. Negative controls are nerves that were biopsied

in the suspect of a peripheral neuropathy but showed to be normal

after morphological and morphometrical evaluation at the light and

electron microscopy levels. Sural nerves were biopsied under local

anesthesia at midcalf. Samples were snap frozen in liquid nitrogen

and stored at �808C until used.

Immunohistochemistry

Rat sciatic nerves were fixed in 4% paraformaldehyde in

sodium cacodylate 0.025 M for 18 h at room temperature and

embedded in paraffin. Sections of 5 Am were digested with trypsin

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714712

for 15 min at 378C, then incubated with 10% normal goat serum in

PBS for 15 min at room temperature. A mouse anti-rat S100

monoclonal antibody (Sigma-Aldrich, Saint Louis, Missouri, USA)

was used 1:400 in PBS containing 1% normal goat serum and

incubated over night at 48C in humid chamber. Sections were

washed in PBS and incubated with biotinylated anti-mouse

immunoglobulins (Biogenex Laboratories, San Ramon, CA) for

20 min at RT, then with peroxidase-conjugated streptavidin

(Biogenex Laboratories, San Ramon, CA). The peroxidase activity

was demonstrated using the DAB substrate (Biogenex Laborato-

ries, San Ramon, CA). For each nerve fascicle three frames,

randomly selected at a 20� magnification to cover at least 80% of

the fascicle, were digitized and stored, using the Pro Plus Imaging

System (Immagini e Computer, Rho, Italy). S100-positive cells

were counted. We analyzed three sciatic nerves per genetic

condition. Results are expressed as number of Schwann cells/mm2.

Primary Schwann cells cultures

Cell cultures were established from sciatic nerves of 30-day-old

pmp22 transgenic homozygous and hemizygous rats according to a

technique optimized for adult animals (Nobbio et al., 2004). Wild

type rats from the corresponding genetic background were used as

controls. Cntf expression and release were analyzed in Schwann

cell cultures treated with serum-free medium containing 0.1%

bovine serum albumin for 48 h. The supernatants were collected

and frozen and, at the same time, Schwann cells were carefully

rinsed with sterile phosphate-buffered saline (PBS), scraped from

the culture dish, recovered through centrifugation, and immediately

frozen.

ELISA quantification

Sciatic nerves and Schwann cells, scraped from the culture

dish, were mechanically disrupted in PBS containing 0.1 mM

PMSF. The extracts were obtained after two 15-min centrifuga-

tions at 100,000 � g. Protein concentration in the supernatants

was measured using Biorad Protein Detection kit (Bio-Rad

Laboratories, Srl, Milan). Cntf content was determined by ELISA

using a Rat Cntf DuoSet kit (R&D Systems, Inc, MN) according

to manufacturer instructions. Briefly, mouse-anti-rat cntf capture

antibody was coated at 2 Ag/ml into 96-well immunoassay plates

(Corning Incorporated) overnight at room temperature. Then,

plates were blocked with 1% BSA, 5% sucrose in phosphate-

buffered saline (PBS, pH 7.4) for at least 1 h at room

temperature, and washed with 0.01% Tween 20 in PBS (PBST).

Sciatic nerve and Schwann cells extracts (10 Ag/well) were added

to the plates and incubated at room temperature (RT) for 2 h. To

quantify the cntf released in cultures medium, we tested 100 Al ofthe serum-free medium from Schwann cell cultures. Plates were

washed three times with PBST between each assay step.

Biotynilated goat anti-rat cntf detection antibody, diluted to 200

ng/ml with 1% BSA in PBST, was incubated in wells for 1 h at

RT. The assay was developed with tetramethylbenzidine in

phosphate buffer pH 6.0 and 0.1% H2O2 (R&D Systems, Inc,

MN). Optical densities at 450 nm were measured using a

spectrophotometric plate reader (Metertech). For sciatic nerves

and Schwann cells extracts results were expressed as ratio

between cntf and total proteins concentration. For the quantifi-

cation of released cntf we normalized cntf concentration by the

number of Schwann cells.

Statistical analysis

Results were evaluated using a one-way analysis of variance

(ANOVA), followed by a Dunnet post-test to separately compare

the pathological conditions with the normal control.

Acknowledgments

We thank Dr. Giulio Palmisano for help in RNA extraction.

This work was financially supported by the European Science

Foundation (ESF) Integrated Aproaches for Functional Genomics

Program (L.N.); by Telethon contract GP02169 2002 (A.S.); by

FISM 2001/R/59 (A.S.); by FIRB RBAUO1KJE4/002 (M.A.);

and by COFIN-MIUR 2002 (M.A.). K.V. is a postdoctoral fellow

of the Fund for Scientific Research, FWO-Flanders, and N.V. is

received a PhD fellowship of the Institute for Science and

Technology, IWT, Belgium.

References

Anton, E.S., Hadjiargyrou, M., Patterson, P.H., Matthew, W.D., 1995. CD9

plays a role in Schwann cell migration in vitro. J. Neurosci. 15 (1 Pt. 2),

584–595.

Atanasoski, S., Shumas, S., Dickson, C., Scherer, S.S., Suter, U., 2001.

Differential cyclin D1 requirements of proliferating Schwann cells

during development and after injury. Mol. Cell. Neurosci. 18 (6),

581–592.

Atanasoski, S., Scherer, S.S., Nave, K.A., Suter, U., 2002. Proliferation of

Schwann cells and regulation of cyclin D1 expression in an animal

model of Charcot–Marie–Tooth disease type 1A. J. Neurosci. Res. 67

(4), 443–449.

Baechner, D., Liehr, T., Hameister, H., Altenberger, H., Grehl, H., Suter, U.,

Rautenstrauss, B., 1995. Widespread expression of the peripheral

myelin protein-22 gene (PMP22) in neural and non-neural tissues

during murine development. J. Neurosci. Res. 42 (6), 733–741.

Banerjee, S.A., Patterson, P.H., 1995. Schwann cell CD9 expression is

regulated by axons. Mol. Cell. Neurosci. 6 (5), 462–473.

Berciano, J., Combarros, O., 2003. Hereditary neuropathies. Curr. Opin.

Neurol. 16 (5), 613–622.

Bolin, L.M., McNeil, T., Lucian, L.A., DeVaux, B., Franz-Bacon, K.,

Gorman, D.M., Zurawski, S., Murray, R., McClanahan, T.K., 1997.

HNMP-1: a novel hematopoietic and neural membrane protein differ-

entially regulated in neural development and injury. J. Neurosci. 17

(14), 5493–5502.

Bowe, D.B., Kenney, N.J., Adereth, Y., Maroulakou, I.G., 2002. Suppres-

sion of Neu-induced mammary tumor growth in cyclin D1 deficient mice

is compensated for by cyclin E. Oncogene 21 (2), 291–298.

Brancolini, C., Edomi, P., Marzinotto, S., Schneider, C., 2000. Exposure at

the cell surface is required for gas3/PMP22 To regulate both cell death

and cell spreading: implication for the Charcot–Marie–Tooth type 1A

and Dejerine–Sottas diseases. Mol. Biol. Cell 11 (9), 2901–2914.

Bunge, R.P., 1993. Expanding roles for the Schwann cell: ensheathment,

myelination, trophism and regeneration. Curr. Opin. Neurobiol. 3 (5),

805–809.

Cameron, A.A., Vansant, G., Wu, W., Carlo, D.J., Ill, C.R., 2003.

Identification of reciprocally regulated gene modules in regenerating

dorsal root ganglion neurons and activated peripheral or central nervous

system glia. J. Cell. Biochem. 88 (5), 970–985.

Costigan, M., Befort, K., Karchewski, L., Griffin, R.S., D’Urso, D.,

Allchorne, A., Sitarski, J., Mannion, J.W., Pratt, R.E., Woolf, C.J.,

2002. Replicate high-density rat genome oligonucleotide microarrays

reveal hundreds of regulated genes in the dorsal root ganglion after

peripheral nerve injury. BMC Neurosci. 3 (1), 16.

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714 713

De Sandre-Giovannoli, A., Chaouch, M., Kozlov, S., Vallat, J.M., Tazir, M.,

Kassouri, N., Szepetowski, P., Hammadouche, T., Vandenberghe, A.,

Stewart, C.L., Grid, D., Levy, N., 2002. Homozygous defects in

LMNA, encoding lamin A/C nuclear-envelope proteins, cause autoso-

mal recessive axonal neuropathy in human (Charcot–Marie–Tooth

disorder type 2) and mouse. Am. J. Hum. Genet. 70 (3), 726–736.

Draghici, S., Khatri, P., Bhavsar, P., Shah, A., Krawetz, S., Tainsky, M.A.,

2003. Onto-Tools, The toolkit of the modern biologist: Onto-Express,

Onto-Compare, Onto-Design and Onto-Translate. Nucleic Acids Res.

31 (13), 3775–3781.

Dyck, P.J., Chance, P., Lebo, R., Carney, J.A., 1993. Hereditary motor and

sensory neuropathies. In: Dyck, P.J., Thomas, P.K., Griffin, S.W., Low,

P.A., Poduslo, J.F. (Eds.), Peripheral Neuropathy, 3rd ed. WB Saunders,

Philadelphia, pp. 1094–1136.

Friedman, B., Scherer, S.S., Rudge, J.S., Helgren, M., Morrisey, D.,

McClain, J., Wang, D.Y., Wiegand, S.J., Furth, M.E., Lindsay, R.M., et

al., 1992. Regulation of ciliary neurotrophic factor expression in

myelin-related Schwann cells in vivo. Neuron 9 (2), 295–305.

Grandis, M., Leandri, M., Vigo, T., Cilli, M., Sereda, M.W., Gherardi, G.,

Benedetti, L., Mancardi, G., Abbruzzese, M., Nave, K.A., Nobbio, L.,

Schenone, A., 2004. Early abnormalities in sciatic nerve function and

structure in a rat model of Charcot–Marie–Tooth type 1A disease. Exp.

Neurol. 190 (1), 213–223.

Groussin, L., Massias, J.F., Bertagna, X., Bertherat, J., 2000. Loss of

expression of the ubiquitous transcription factor cAMP response

element-binding protein (CREB) and compensatory overexpression of

the activator CREMtau in the human adrenocortical cancer cell line

H295R. J. Clin. Endocrinol. Metab. 85 (1), 345–354.

Guilbot, A., Williams, A., Ravise, N., Verny, C., Brice, A., Sherman, D.L.,

Brophy, P.J., LeGuern, E., Delague, V., Bareil, C., Megarbane, A.,

Claustres, M., 2001. A mutation in periaxin is responsible for CMT4F,

an autosomal recessive form of Charcot-Marie-Tooth disease. Hum.

Mol. Genet. 10 (4), 415–421.

Hadjiargyrou, M., Patterson, P.H., 1995. An anti-CD9 monoclonal antibody

promotes adhesion and induces proliferation of Schwann cells in vitro.

J. Neurosci. 15, 574–583.

Hadjiargyrou, M., Kaprielian, Z., Kato, N., Patterson, P.H., 1996.

Association of the tetraspan protein CD9 with integrins on the surface

of S-16 Schwann cells. J. Neurochem. 67 (6), 2505–2513.

Hanemann, C.O., Muller, H.W., 1998. Pathogenesis of Charcot–Marie–

Tooth 1A (CMT1A) neuropathy. Trends Neurosci. 21 (7), 282–286.

Hanemann, C.O., Gabreels-Festen, A.A., Stoll, G., Muller, H.W., 1997.

Schwann cell differentiation in Charcot–Marie–Tooth disease type 1A

(CMT1A): normal number of myelinating Schwann cells in young

CMT1A patients and neural cell adhesion molecule expression in onion

bulbs. Acta Neuropathol. (Berl) 94 (4), 310–315.

Harry, G.J., Goodrum, J.F., Bouldin, T.W., Wagner-Recio, M., Toews,

A.D., Morell, P., 1989. Tellurium-induced neuropathy: metabolic

alterations associated with demyelination and remyelination in rat

sciatic nerve. J. Neurochem. 52 (3), 938–945.

Huxley, C., Passage, E., Manson, A., Putzu, G., Figarella-Branger, D.,

Pellissier, J.F., Fontes, M., 1996. Construction of a mouse model of

Charcot-Marie-Tooth disease type 1A by pronuclear injection of human

YAC DNA. Hum. Mol. Genet. 5 (5), 563–569.

Inoue, K., Dewar, K., Katsanis, N., Reiter, L.T., Lander, E.S., Devon, K.L.,

Wyman, D.W., Lupski, J.R., Birren, B., 2001. The 1.4-Mb CMT1A

duplication/HNPP deletion genomic region reveals unique genome

architectural features and provides insights into the recent evolution of

new genes. Genome Res. 11 (6), 1018–1033.

Ito, Y., Yamamoto, M., Mitsuma, N., Li, M., Hattori, N., Sobue, G., 2001.

Expression of mRNAs for ciliary neurotrophic factor (CNTF), leukemia

inhibitory factor (LIF), interleukin-6 (IL-6), and their receptors (CNTFR

alpha, LIFR beta, IL-6R alpha, and gp130) in human peripheral

neuropathies. Neurochem. Res. 26 (1), 51–58.

Kaprielian, Z., Cho, K.O., Hadjiargyrou, M., Patterson, P.H., 1995. CD9, a

major platelet cell surface glycoprotein, is a ROCA antigen and is

expressed in the nervous system. J. Neurosci. 15 (1 Pt. 2), 562–573.

Kubo, T., Yamashita, T., Yamaguchi, A., Hosokawa, K., Tohyama, M.,

2002. Analysis of genes induced in peripheral nerve after axotomy

using cDNA microarrays. J. Neurochem. 82 (5), 1129–1136.

Lee, D.A., Gross, L., Wittrock, D.A., Windebank, A.J., 1996. Localization

and expression of ciliary neurotrophic factor (CNTF) in postmortem

sciatic nerve from patients with motor neuron disease and diabetic

neuropathy. J. Neuropathol. Exp. Neurol. 55 (8), 915–923.

Magyar, J.P., Martini, R., Ruelicke, T., Aguzzi, A., Adlkofer, K., Dembic,

Z., Zielasek, J., Toyka, K.V., Suter, U., 1996. Impaired differentiation

of Schwann cells in transgenic mice with increased PMP22 gene

dosage. J. Neurosci. 16 (17), 5351–5360.

Magyar, J.P., Ebensperger, C., Schaeren-Wiemers, N., Suter, U., 1997.

Myelin and lymphocyte protein (MAL/MVP17/VIP17) and plasmolipin

are members of an extended gene family. Gene 189 (2), 269–275.

Misko, A., Ferguson, T., Notterpek, L., 2002. Matrix metalloproteinase

mediated degradation of basement membrane proteins in Trembler

J neuropathy nerves. J. Neurochem. (83), 885–894.

Nagarajan, R., Svaren, J., Le, N., Araki, T., Watson, M., Milbrandt, J.,

2001. EGR2 mutations in inherited neuropathies dominant-negatively

inhibit myelin gene expression. Neuron 30 (2), 355–368.

Nagarajan, R., Le, N., Mahoney, H., Araki, T., Milbrandt, J., 2002.

Deciphering peripheral nerve myelination by using Schwann cell

expression profiling. Proc. Natl. Acad. Sci. U. S. A. 99 (13),

8998–9003.

Niemann, S., Sereda, M.W., Suter, U., Griffiths, I.R., Nave, K.A., 2001.

Uncoupling of myelin assembly and Schwann cell differentiation by

transgenic overexpression of peripheral myelin protein 22. J. Neurosci.

20 (11), 4120–4128.

Nobbio, L., Vigo, T., Abruzzese, M., Levi, G., Brancolini, C., Mantero, S.,

Grandis, M., Benedetti, L., Mancardi, G.L., Schenone, A., 2004.

Impairment of PMP22 transgenic Schwann cells differentiation in

culture: implications for Charcot-Marie-Tooth type 1A disease. Neuro-

biol. Dis. 16 (1), 263–273.

Palumbo, C., Massa, R., Panico, M.B., Di Muzio, A., Sinibaldi, P.,

Bernardi, G., Modesti, A., 2002. Peripheral nerve extracellular matrix

remodeling in Charcot-Marie-Tooth type I disease. Acta Neuropathol.

(Berl) 104 (3), 287–296.

Perea, J., Robertson, A., Tolmachova, T., Muddle, J., King, R.H., Ponsford,

S., Thomas, P.K., Huxley, C., 2001. Induced myelination and

demyelination in a conditional mouse model of Charcot–Marie–Tooth

disease type 1A. Hum. Mol. Genet. 10 (10), 1007–1018.

Puskas, L.G., Zvara, A., Hackler Jr., L., Micsik, T., van Hummelen, P.,

2002. Production of bulk amounts of universal RNA for DNA

microarrays. BioTechniques 33(4), 898-900, 902, 904.

Roa, B.B., Garcia, C.A., Pentao, L., Killian, J.M., Trask, B.J., Suter, U.,

Snipes, G.J., Ortiz-Lopez, R., Shooter, E.M., Patel, P.I., et al., 1993.

Evidence for a recessive PMP22 point mutation in Charcot–Marie–

Tooth disease type 1A. Nat. Genet. 5 (2), 189–194.

Robaglia-Schlupp, A., Pizant, J., Norreel, J.C., Passage, E., Saberan-

Djoneidi, D., Ansaldi, J.L., Vinay, L., Figarella-Branger, D., Levy, N.,

Clarac, F., Cau, P., Pellissier, J.F., Fontes, M., 2002. PMP22 over-

expression causes dysmyelination in mice. Brain (125), 2213–2221.

Sahenk, Z., Chen, L., Mendell, J.R., 1999. Effects of PMP22 duplication

and deletions on the axonal cytoskeleton. Ann. Neurol. 45 (1), 16–24.

Sancho, S., Magyar, J.P., Aguzzi, A., Suter1, U., 1999. Distal

axonopathy in peripheral nerves of PMP22-mutant mice. Brain 122

(Pt 8), 1563–1577.

Sendtner, M., Kreutzberg, G.W., Thoenen, H., 1990. Ciliary neurotrophic

factor prevents the degeneration of motor neurons after axotomy. Nature

345 (6274), 440–441.

Sereda, M., Griffiths, I., Puhlhofer, A., Stewart, H., Rossner, M.J.,

Zimmerman, F., Magyar, J.P., Schneider, A., Hund, E., Meinck,

H.M., Suter, U., Nave, K.A., 1996. A transgenic rat model of

Charcot-Marie-Tooth disease. Neuron 16 (5), 1049–1060.

Sleeman, M.W., Anderson, K.D., Lambert, P.D., Yancopoulos, G.D.,

Wiegand, S.J., 2000. The ciliary neurotrophic factor and its receptor,

CNTFR alpha. Pharm. Acta Helv. 74 (2-3), 265–272.

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714714

Snipes, G.J., Orfali, W., Fraser, A., Dickson, K., Colby, J., 1999. The

anatomy and cell biology of peripheral myelin protein-22. Ann. N. Y.

Acad. Sci. 883, 143–151.

Stankoff, B., Aigrot, M.S., Noel, F., Wattilliaux, A., Zalc, B., Lubetzki, C.,

2002. Ciliary neurotrophic factor (CNTF) enhances myelin formation: a

novel role for CNTF and CNTF-related molecules. J. Neurosci. 22 (21),

9221–9227.

Suter, U., Scherer, S.S., 2003. Disease mechanisms in inherited neuro-

pathies. Nat. Rev., Neurosi. 4, 714–726.

Suter, U., Snipes, G.J., 1995. Peripheral myelin protein 22: facts and

hypotheses. J. Neurosci. Res. 40 (2), 145–151.

Taylor, V., Welcher, A.A., Program, A.E., Suter, U., 1995. Epithelial

membrane protein-1, peripheral myelin protein 22, and lens membrane

protein 20 define a novel gene family. J. Biol. Chem. 270 (48),

28824–28833.

Tole, S., Patterson, P.H., 1993. Distribution of CD9 in the developing and

mature rat nervous system. Dev. Dyn. 197 (2), 94–106.

Valentijn, L.J., Baas, F., Wolterman, R.A., Hoogendijk, J.E., van den

Bosch, N.H., Zorn, I., Gabreels-Festen, A.W., de Visser, M., Bolhuis,

P.A., 1992. Identical point mutations of PMP-22 in Trembler-J mouse

and Charcot-Marie-Tooth disease type 1A. Nat. Genet. 2 (4), 288–291.

Verheijen, M.H., Chrast, R., Burrola, P., Lemke, G., 2003. Local

regulation of fat metabolism in peripheral nerves. Genes Dev. 17

(19), 2450–2464.

Wagner-Recio, M., Toews, A.D., Morell, P., 1991. Tellurium blocks

cholesterol synthesis by inhibiting squalene metabolism: preferential

vulnerability to this metabolic block leads to Peripheral nervous system

demyelination. J. Neurochem. 57 (6), 1891–1901.

Xiang, Z., Yang, Y., Ma, X., Ding, W., 2003. Microarray expression

profiling: analysis and applications. Curr. Opin. Drug Discovery Devel.

6 (3), 384–395.

Xiao, Y., Segal, M.R., Rabert, D., Ahn, A.H., Anand, P., Sangameswaran,

L., Hu, D., Hunt, C.A., 2002. Assessment of differential gene

expression in human peripheral nerve injury. BMC Genomics 3 (1), 28.

Yamamoto, M., Ito, Y., Mitsuma, N., Li, M., Hattori, N., Sobue, G., 2001.

Pathology-related differential expression regulation of NGF, GDNF,

CNTF, and IL-6 mRNAs in human vasculitic neuropathy. Muscle Nerve

24 (6), 830–833.

Yamamoto, M., Ito, Y., Mitsuma, N., Li, M., Hattori, N., Sobue, G., 2002.

Parallel expression of neurotrophic factors and their receptors in chronic

inflammatory demyelinating polyneuropathy. Muscle Nerve 25 (4),

601–604.