Isolation and characterization of osteoblast precursor cells from human bone marrow

JOURNAL OF BONE AND MINERAL RESEARCH Volume 11 , Number 3, I996 Blackwell Science. Inc.

Isolation and Characterization of Osteoblast Precursor Cells from Human Bone Marrow

DAVID J . RICKARD,' MOUSTAPHA KASSEM,' THERESA E. HEFFERAN,' GOBINDA SARKAR,' THOMAS C. SPELSBER@ and B. LAWRENCE RIGGS'

ABSTRACT

Osteoblasts are derived from precursor cells present in low frequency in the stromal element of bone marrow. Because of the lack of a practical procedure to isolate osteoblast precursors from early cultures of plastic adherent cells from bone marrow, previous studies of marrow stromal cells have been made in confluent cultures of bone marrow when the osteoblast (OB) precursors are already differentiated. Also these studies utilized cultures containing mixed populations of cells including hematopoietic cells. Thus we have employed a negative immunoselection procedure to remove contaminating hematopoietic cells and to isolate nearly homogeneous populations of early human stromal cells derived from the plastic-adherent mononuclear marrow cells cultured in the presence of serum. By reverse transcriptase polymerase chain reaction (RT-PCR) analysis for mRNA, and by immunocytochemical study for protein, we studied the sequential expression in culture of multiple markers of the osteoblast phenotype-alkaline phosphatase, osteopontin, parathyroid hormone receptor, types I and I11 procollagen, and osteocalcin-as well as lipoprotein lipase (LPL), a marker of the adipocyte phenotype. At an early stage of culture (7-9 days), human OB precursors formed colonies of variable sizes that expressed low levels of mRNA and protein concentrations of OB markers, and their concentration increased on growth to a confluent monolayer (approximately 14 days). LPL mRNA was expressed at high levels in the colony stage, and its level decreased upon confluency, suggesting a loss of potential for commitment to the adipocyte lineage. Interestingly, treatment with dexamethasone at lo-' M increased the expression for some of the osteoblast markers and for the LPL gene and was required for the deposition of mineralized matrix and for the formation of adipocytes containing cytoplasmic lipid droplets in confluent cultures. Cloned single early colonies were able to coexpress the osteoblast and adipocyte markers (as assessed by RT-PCR). Thus these immunoselected marrow stromal cells have the chardc- teristics of authentic human osteoblast precursor cells which also are capable of differentiating into adipocytes. (J Bone Miner Res 1996;11:312-324)

INTRODUCTION

IXXJIAI~ION 01, o s i I o i i i . A s i I ) I I . I ~ I : I I I : N I ~ I A I ION must occur to R maintain the continuous supply o f mature osteoblasts needed for bone growth, remodeling, and fracture repair. Because of the lack o f a suitable method for their isolation, the characteristics of human osteoblast precursors have not been determined and factors regulating their differentiation have not been well defined.

Osteoblast precursors as well as precursors of the other mesenchymal lineages-fibroblasts, myoblasts, adipocytes, and chondrocytes-are believed to be derived from a multipotential stem cell of bone marrow stroma.(','' A common origin for these cells is suggested by the existence of cells from embryonic fibroblasts,(3' fetal ~ a l v a r i a , ' ~ . ~ ' and bone marrow stroma'".') that can differentiate into multiple mesenchymal cell types including osteoblasts. The ostcoblast precursors in bone marrow stroma when cultured in vitro

'Endocrinc Research Unit, Division of Endocrinology and Metabolism, Mayo Clinic and Mayo Foundation, Rochestcr, Minnesota.

'Department o f Orthopcdics, Mayo Clinic and Mayo Foundation, Rochester, Minnesota. U.S.A. 'Dcpartmcnt of Biochemistry and Molecular Biology, Mayo Clinic and Mayo Foundation, Rochester, Minnesota. U.S.A.

U.S.A.

312

CHARACTERIZATION OF HUMAN OSTEOPROGENITOR CELLS 313

appear its adherent, highly proliferative, colony-forming cells with i t fibroblast-like morphology (which Friedenstein and Owen have termed colony forming units-fibroblast [CFU-fl".2)). The number of CFU-f in the total marrow mononuclear cell population is extremely low (- 1 cell/ 100,000 marrow cells) with the great majority of cells be- longing to the various hematopoietic lineages. These cells form cartilage and bone when transplanted into diffusion ch;imbers in vivo.'' I") and. when cultured in vitro, they produce fibroblastic stronial cells (henceforth referred to its

stronial cells). When cultured to confluence in the presence o f serum, the stromal cells possess many of the phenotypic characteristics o f differentiated osteoblasts including deposition o f ;I mineralized matrix." '-I5'

Several models are currently available for studying osteoblast differentiation and maturation in culture. These arc derived from chicken bone,'"" rat calvaria,'" I " ) rat stro-

man ostcoblast precursors thus far have been studied only in confluent cultures o f marrow stromal cells. In such cultures the ostcoblast precursors havc undergone several population doublings and have already differentiated, so that their resultant phenotype may differ substantially from that o f the original precursor cell. At confluency these late stronial cells produce alkaline phosphatase (AP), osteopontin. bone sialoprotein, osteocalcin, and type I collagen,'"'- 14)

markers that define the late stages o f osteoblast differentiation in the well characterized ostcogenic fetal rat calvarial culture system.'

In ;iddition. marrow cultures that have previously been studied are heterogeneous and contain variable numbers of ni:icroph:iges, monocytcs, and endothclial c~lls.""~~" The presence of these contaminating cells may confound any sttidy that aims at characterizing products made by early ostcoblast precursors when they are present in low numbers in culture. To overcome these problems, we developed a negative imniunosclection procedure for obtaining highly purified, nearly homogeneous preparations o f stromal cells from heterogeneous early cultures o f adherent human bone marrow cells. The isolated cells were characterized by reverse t rxwriptase polymerase chain reaction (RT-PCK) and by immunocytochemistr. We present evidence herein that the immunosclected cells are ostcoblast precursors that also arc capable o f differentiating into adipocytes.

niaI cc~Is." I I.') and human bone marrow.' IJ,15m 23) Hu-

MATERIALS AND METHODS

All reagents were purchased from Sigma Chemical Co. (St. Louis, MO, U.S.A.) or GIBCO BRL (Grand Island, NY. U.S.A.) unless otherwise stated. 1,25-dihydroxyvitamin D,? (1,25[OH],D,) was from Biomol Research Inc. (Ply- mouth, PA, U.S.A.). Tissue culture plasticware was from Corning (Corning, NY, U.S.A.), and tissue culture medium and fetal bovine serum (FBS, certified) were from GlBCO BRL.

Cell culture

Bone niurrow strornul cell culture.: Bone marrow (5-10 ml) was obtained by iliac aspiration from healthy volunteers or as waste from patients in remission from hematologic ma- lignancy. Their ages ranged from 17-85 years (mean 49 years). The normal miirrow donors gave informed consent, and the procedure was approved by the Mayo Clinic Insti- tutional Review Board.

Mononuclear cells were isolated by centrifugation over ii Ficoll-Paqueo density gradient (Pharimcia Biotech Inc., Piscataway, NJ, U.S.A.) at 500 g for 25 minutes at room temperature. Cells from the interface were washed once in phosphate-buffered saline (PBS) before they were counted with a hcmocytometer. The cells were plated into 25-cm' tissue culture flasks at a density o f - I X 10" cclls/cm' (except for cloning o f stromal cell colonies, see bc- low) in phenol red-free alpha modified essential rncdium (0-MEM) containing penicillin ( I00 Uiml), streptomycin (100 pdml) , and 10%) (v/v) heat-inactivated fetal bovine serum (FBS). The FBS was hatch-tested for its ability to support stromal cell growth.

The cells were incubated in a humidified atmosphere (95% air, 5% CO,) at 37°C. Twenty-four hours after plating (day I ) , ascorbic acid at 5 0 p&nl was added to all cultures: dcxamethasone (10 ' M) or 1,25(0€1)2D, ( I 0 ' M ) or both were added to appropriate cultures. On day 5 , nonadhercnt marrow cells were removed by two vigorous wash- ings with PBS. Thereafter medium with ascorbic acid and hormones was changed twice weekly until the cells were harvested.

Without specific analysis, n o gross differences in colony numbers and cell behavior were noted between marrows from donors of different ages. However. greater numbers of total mononuclear cells were consistently obtained from the malignant specimens compared with normals. although these samples contained CFU-fs at the expected frequency and plating density, and the resultant stromal cell cultures had characteristics indistinguishable from cultures derived from normal volunteers. For studies o n expression o f dii- ferentiation markers, equal numbers o f marrow samples (n = 4) from both donor groups were used.

Ncgutive immunoselection: Adherent marrow stromal cells were trypsinized and aliquots (between 0.25 and 0.5 X 10'' cells) were incubated with the following monoclonal antibod- ics to cell surface antigens of the nonstromal cell (hybridoma TIB228 [American Type Culture Collection, Rockville, MD, U.S.A.]) which recognizes monocyte/macro- phage lineage cells; antLCD3 liplatelet- cndothelinl cell adhc- sion molecule (monoclonal JC70, Biomcda Corp., Foster City, CA, U.S.A.) which recognizes endothelial and anti-CDl lalLFA-I a-chain (Biosource International, Camarillo, CA, U.S.A.) which recognizes lymphocytes. The cells were then rinsed and incubated with sheep antimouse IgG-coated magnetic beads (Dynabeads, Dynal Inc., Lake Success, NY, U.S.A.) at a bead-to-cell ratio o f 5:l. The reactive cells were separated with a magnetic particle con- centrator (Dynal Inc., Fort Lee, NJ, U.S.A.). For quantita- tion o f antibody-positive cells, the number o f cells in the bead-attached fraction was determined and expressed as ii

314 RICKARD ET AL.

percentage of the total number of cells remaining in an identically treated tube to which no antibodies were added, thereby allowing for cell losses. Batches (10,000 cells) of the cells left in suspension were analyzed by RT-PCR as described below.

Cloning of stromul cell colonies: Marrow cells ( 1 X 10') were seeded at low density into 10-cm' culture dishes (-0.15 X 10" cellslcm') and allowed to form colonies in the presence or absence of dexamethasone ( l o p x M) or 1,25(OH),D, (IO-" M) or both. At this plating density, the stromal colonies were widely spaced enabling the picking of single colonies. When colonies comprised approximately 25-1 00 cells, single colonies were transferred to a 24-well plate by trypsinization within cloning cylinders (Bellco Glass, Vineland, NJ, U.S.A.). An equal volume of medium (IS0 pl) was added to each well, and the cells were allowed to attach for 4-5 hours, at which time the medium was changed and culture was continued under the same treatment. The cells became confluent after a further 4 weeks of growth, and then RNA was extracted from each well and RT-PCR analysis was performed as described for immunoselected cells (see below).

Culture of normal human trabecular osteoblast-like cells and skin fibroblasts: Human osteoblast-like cells were cultured from explants of trabecular bone fragments as described.("') These cells have been shown to express a differentiated osteoblast phenotype including production of osteocalcin, osteonectin, and type I collagen, 1,25(OH),D,- inducible expression of osteocalcin and alkaline phosphatase, responsiveness to PTH, and the formation of a mineraliz- able matrix.'3"' Skin fibroblasts were released from dermal layers of punch biopsy specimens by collagenase digestion. Semiconfluent cultures of fibroblasts and osteoblasts were treated with and without dexamethasone ( lopx M) or 1,25(OH),D, (10 ' M) for 7 days prior to extraction of total RNA (see below).

Histochemical and immunocytochernical staining of stromal cells

Stromal cells fixed in 10% neutral buffered formalin (NBF) were stained for AP, nonspecific esterase (NSE), and acid phosphatase (AcP) using naphtholidiazonium salt substrates. For mineralized matrix formation, postconfluent (3-4 weeks old) stromal cultures were treated with 4 mM p-glycerophosphate for the final 48 h of culture, fixed with 10% NBF, and stained with Alizarin red S. Adipocytes in postconfluent cultures were identified by staining NBF- fixed cells for cytoplasmic lipid droplets with Oil Red 0.

For immunocytochemistry, marrow stromal cells from the carly colony and the confluent monolayer stage of culture were plated onto 8-well Permanox chamber slides (Nunc Inc., Naperville, IL, U.S.A.) at a density of 4,000 cells/cm' and cultured for 48 h in the presence or absence of dexamethasone ( l o p x M) or 1,25(OH),D, (lo-' M). Im- munoperoxidase staining of cells was performed as described.(-'" The polyclonal antibodies tested were: LF-83 (antibone sialoprotein), LF-32 (antiosteocalcin), BON-I (an- tiosteonectin), LF-7 (antiosteopontin), LF-67 (anti-type I collagen) (all generously provided by Dr. Larry Fisher, NIH,

Bethesda, MD, U.S.A.) and anti-type I11 collagen (provided by Drs. Leila and Juha Risteli, Oulu, Finland). Normal rabbit serum diluted 1:lOO was used as a negative control.

Factor VIII and the CD31 cell surface antigen were dc- tected by direct and indirect immunofluorescence, respectively. Paraformaldehyde-fixed confluent adherent marrow cells were incubated with either sheep antihuman factor VIll antibody-fluorescein isothiocyanate (FITC) conjugate (Har- lan Bioproducts, Indianapolis, IN, U.S.A.) or anti-CD3 1 (Biomeda Corp.). For CD31 staining, cells were then incubated with rat antimouse IgG,-FITC conjugate as secondary antibody (Biosource International).

RNA extraction, cDNA synthesis, and RT-PCR

RNA was extracted from cultures of confluent stromal cells, normal human trabecular osteoblast-like cells, and normal human skin fibroblasts by the method of Chom- czynski and Sacchi.'"' cDNA was synthesized from 4 pg of total RNA in a 20-pl reaction mixture containing I X reverse transcriptase buffer (5X = 50 mM MgCI?, 250 mM KCI, 250 mM Tris . HCI [pH 8.31, 50 mM DTT, 2.5 mM spermidine [Promega, Madison, W1, U.S.A.]), dCTP, dGTP, dATP, and dTTP each at 2 mM (Boehringer Mann- heim, Indianapolis, IN, U.S.A.), 20 U of RNAse inhibitor (Promega), 8-10 U of AMV reverse transcriptase (Pro- mega), 200 pmol of random hexamer primer, and 50 pmol of poly * dT,, primer (Boehringer Mannheim). Reaction times were at least 3 h at 42°C.

Aliquots (4%) of the total cDNA were amplified in each PCR in a 20-pl reaction mixture that contained 5-10 pmol of 5' and 3' primer, 1X PCR buffer (1OX = 500 mM KCI, 100 mM Tris. HCI [pH 9.01, 1% [v/v] Triton X-100 [Pro- mega]), dCTP, dGTP, dATP, and dTTP each at 0.2 mM. 1 .5 mM MgCI,, 0.25 pI of [d 'P]dCTP (10 pCiIpI; New En- gland Nuclear, Boston, MA, U.S.A.), and 0.5 U of Tuq polymerase (Promega or Perkin-Elmer, Nonvalk, CT, U.S.A.). Each cDNA sample was run in duplicate for every PCR. Amplifications were performed in a GeneAmp 9600 thermal cycler (Perkin-Elmer) for 30 cycles after an initial denaturation at 94°C for 2 minutes, except that PTH rccep- tor and p-actin were amplified for 35 and 20 cycles, respectively. The same reaction profile was used for all primer sets: 94°C for 30 s, 55°C for 2 minutes, and 72°C for 2 minutes. Amplification reactions specific for the following cDNAs were performed: bonelliverlkidney AP, osteopontin, osteocalcin, parathyroid hormone (PTH) receptor, lipoprotein lipase (LPL), and the housekeeping gene p-actin. The PCR primer sequences are given in Table 1.

Reaction products were analyzed by electrophoresis of 10-pl samples in 1.5% agarose gels. The amplified DNA fragments were visualized by ethidium bromide staining and quantified by counting the amount of radioactivity in gel slices. The quantitative differences between cDNA samples were calculated after normalizing for the radioactivity present in the corresponding p-actin PCR product.

For the immunoselected stromal cells, RNA was isolated from aliquots of 10' cells by lysis of the cell pellet in 5 0 pl of guanidinium isothioeyanate buffer and 0.1 vol o f 2 M sodium acetate (pH 4.5) followed by a single extraction with


TABLE 1. OI.IFODEOX\~NUC.LEOTIDE PRIMERS USED I N ‘ n i t PCR

p-act in

Alkaline phosphatasc

Ostcopon tin

Osteocalcin

PTf1 receptor

Type I procollagen

Type 111 procollagen

Lipoprotein lipasc

Primer sequence (5’-3’) *

5 ’ : AGCCATGTACGTTGCTA 3‘:AGTCCGCCTAGAAGCA 5 ‘ :ACGTGGCTAAGAATGTCATC 3’:CTGGTAGGCGATGTCCTA 5 ’ :CCAAGTAAGTCCAACGAAAG 3 ’ :GGTG ATGTCCTCGTCTGTA

5 ’ :CATGAGAGCCCTCACA 3’:AGAGCGACACCCTAGAC 5’:AGGCCAGCCAGCATAATGGAA 3’:CTCCCGTTCACGAGTCTCAT

5’:TGACGAGACCAAGAACTG 3 ‘ :CCATCCAAACCACTGAAACC U: GCGGAGTAGCAGTAGGAG L: GTCATTACCCCGAGCACC U: GAGA’MTCTCTGTATGGCACC L: CTGCAAATGAGACACTTTCTC

Restriction digest.‘

800 bp

475 bp Ddel: 262, 160, 60 347 bp Accl: 235. 112 ~ ~ 4 1 : 257, 90 310 bp Burn 141: 193, 122 374 bp LldeI: 274, 94, h BsaH1: 231, 143 599 bp Tuql: 427, 105, 69 484 bp

276 bp DdeI: 227, 49

TuqI: 318, 166

~~ ~~

* U = upperis’ primer; L. 2 loweri3’ primer. rhe first numher denotes the size o f the PCR product in hase pairs (bp) followed by thc enzyme and the sizes of the digestion products

in hp. For genes with ii known introniexon organization, primers to different cxons were used to cnahlc distinction between PCR products derived from cDNA and those from possible genomic DNA contamination.

1 -

an equal volume of phenol (pH 4.5) and 0.2 vol of chloro- formiisoamyl alcohol (24: I [viv]). The volume of the aque- ous phase was adjusted to - 80 pI with diethylpyrocarbon- ate-treated water and desalted on a Sephadcx (3-50 spin column (Pharmacia Biotech). The eluates were divided into 10 aliquots, each representing the RNA from 10’ cells. Each aliquot was vacuuni dried, and the entire residue was used for cDNA synthesis for a minimum of 3 h at 42°C in a 10-p1 reaction mixture. The reaction mixture contained 1 x reverse transcriptase buffer (see above); 20 U of RNAse inhibitor; dATP, dCTP, dGTP. and dTTP each at 2 mM; 8-10 U of AMV reverse transcriptase; 200 pmol of random hcxanicr primer; and 50 pniol of poly . dT,, primer.

For PCR of the immunoselectcd stromal cells, 5-pl aliquots of cDNA were used in a reaction mixture containing 1 pl cach of the 5‘ and 3’ primers (5-10 pmolipl); 5 pl of I X rcvcrse transcriptase buffer; I p1 of 350 mM KCI, 50 mM EDTA solution; 0.5 pl of Tuq polymerase ( 5 Uipl); 0.25 pl of [(Y-~”P]~CTP (10 pC3ip.l); and distilled water to 15 pl. Each cDNA sample was run in duplicate in the PCR. Amplification rcactions specific for the following cDNAs were performed: AP. osteopontin, osteocalcin, PTH receptor, type I procollagen a-chain, type 111 procollagen cu-chain, LPL. and p-actin (Table I ) . Amplification conditions were as previously described except that p-actin was amplified for 22 cycles, and both osteocalcin and PTH receptor were amplified for 35 cycles.

RESULTS Growth characteristics of stronial cell ciiltiires

When seeded at I X 10” marrow mononuclear cellsicm’, the initial adherent stromal cells appeared as widely scat-

tered CFU-f which divided to form discretc colonies (3-41 cm’, is., the CFU-f comprise approximately 1 cell/105 marrow cells)“5) and later expanded and eventually merged to generate a confluent stromal cell monolayer, typically after 14 days in culture. The earliest stromal cells stained in- tensely for AP activity (Fig. IA), and most cells in the later cultures also stained positively. The cultures were studied at three different stages, defined as follows: (i) “early colony,” stromal cells formed discrete colonies, each consisting of 100-300 cells (typically, day 7-9); (ii) “confluent monolayer,” the individual stromal colonies first merged to form a complete monolayer (typically, around day 14); and ( i i i ) “postconfluent culture,” the period subsequent to the formation of a confluent monolayer and when, under appropriate treatment conditions, the different stromal cell types were morphologically distinguishable (3-5 weeks).

Pheriotypic characteristics of confluent stromal cells

In order to assess the completeness of differentiation of confluent stromal cells and the specificity of markers for the osteoblast phenotype, we compared mRNA and protein for osteoblast markers among confluent stromal cells, trabecular osteoblasts, and skin fibroblasts. Our initial studies examined the phenotype characteristics of confluent marrow stromal cells. As assessed by histochemical and immunocytochemical staining, the confluent stromal cells revealed their ability to express multiple markers of OB phenotype, AP, osteopontin, and collagen type I and type 111 (see below). Only in the presence of dexamethasone (10 ~ M) were postconfluent stromal cultures able to form mincral- ized matrix when supplemented with P-glycerophosphate, as evidenced by positive staining with Alizarin Red S (Fig.

316 RICKARD ET AL.

IE). By this time (typically after 4 weeks of culture) the stromal cells had formed multilayers. Interestingly the presence o f dexamethasone also resulted in the formation of mature adipocytes (Fig. ID) that could stain positively with Oil Red 0.

Although confluent stromal cell cultures have been reported to exhibit characteristics of differentiated osteoblasts, the similarities in phenotype between stromal cells and differentiated ostcoblasts were assessed by comparing the mRNA levels for differentiated osteoblast markers as well a s for a marker of adipocyte differentiation. Any uniqueness in the mRNA profile o f the stromal cells was further confirmed by comparison with the expression levels in skin fibroblasts, used as an example of typical connective tissue fibroblasts. The levels o f mRNA for AP, osteopontin, ostcocalcin, PTH receptor (osteoblast) and LPL (adipocytcs) were determined by RT-PCR in confluent stromal cell cultures without immunoselection (at approximately

day 14) and in confluent trabecular osteoblast-like cells and skin fibroblasts. Modulation by dexamethasone (I0 M ) and 1,25(OH),D, (10 M) was also investigated. Figure 2 shows agarose gels o f the PCR-generated fragments. Figure 3 shows the relative expressions after correction for p-actin levels.

Steady-state levels o f AP mRNA were similar in stromal cells and osteoblasts and were 15-fold more than in fibroblasts. Dexamethasone increased AP mRNA in stromal cells and osteoblasts, whereas I ,2S(OH),D, had little effect. Osteopontin expression was 3- and 5-fold greater in stromal cells than in osteohlasts and fibroblasts, respectively, and was inhibited by dexamethasonc. The constitutive osteocalcin mRNA level was considerably higher in osteoblasts than in stromal cells, although comparable increases in gene expression were induced by 1,2S(OH)2D, in both cell types. Osteocalcin mRNA was undetectable in fibroblasts. All three cell types exhibited low basal PTH receptor levels,

FIG. 1. Constituent cell types in adherent marrow cultures. (A) Histo- chemical staining in day 4 cultures for NSE (black) and AP (blue) in macro- phage polykaryons and rounded cells, and o f fibroblastic stromal cells, respectively (x200). Immunofluores- cent staining in confluent cultures for (B) Factor VlIl (cytoplasmic, X200), and (C) CD31 (cell surface, X400). (D) A cluster o f adipocytes with prominent cytoplasmic lipid droplets in a nonim- munosclccted postconfluent dexametha- sow-treated culture on day 26 (X 100). (E) Alizarin red S stain for mineralized deposits in a nonimmunoselected dex- amcthasone-treated postconfluent culture o n day 23 (X 100). (F) Replated stromal cells stained histochemically for AP after negative immunoselection with anti-CD14 and anti-CD31 antibodies ( x 100).

A B

E F


FIG. 2. RT-PC'R analysis for expression o f osteoblast and dipocyte- related genes in marrow stromal cells, trahecular osteoblast-like cells, and skin fibroblasts. Cells were cultured in the presence m d ; h e n c e of 10 M dcxamethasone (Dex) or 1,25(OH),D, (1,2SD). At confluence, t o t a l RNA was extracted. reverse transcribctl into cDNA, and amplified by using specific oligonucleotide primers ac- cording to the standard PCR proto- col (see Materials and Methods). RNA wiis isolated from whole stro- ma1 cell cultures without prior immunoselection. Separate PCRs were performed for p-iictin, alkaline phosphatase (AP) with ostcopontin (OP). osteocalcin (OC). PTH receptor, a n d lipoprotein lipase (LPL). Each cDNA sample was amplified in duplicate. Re- action products were visualized o n cthidium bromide-stained agarose gels. The size, in base pairs (hp), of each prorl- uct is indicated.

whereas ;I dex~imeth~isone-mediated induction was specific for stroniiil cells. LPL is ;I marker o f the adipocyte lineage that is expressed in preadipocytes, and its level increases dramatically prior to morphologic differentiation to mature adipocytes."" We detected mRNA for LPL only in the stromal cell cultures. and its expression was stimulated by dexaniet hasone.

A.w.ssrncwt of' cdliilur Iictcrogc.rwi@ in bone marrow ('1 i It i i rc~s by iriir i i n om r i p i et ic sclcction

Although the majority o f adherent cells in marrow stronial cultures exhibited fibroblastic morphology, cultures

phocytes was negligible. The purity of the CD14 K D 3 1 cell fraction was assessed hy staining the repliited cells for NSE: and AcP; immunopanning with anti-CD14 and anti- CD3 1 depleted the cultures almost completely o f NSF: ' and AcP' cells and produced a nearly homogeneous culture o f stromal cells (06-98%' AP 'INSE /Ad' ) (Fig. I f )

Charigc.s in phenotypic mrirkrrs rrt d i [ f rwt i t s t q c y s of culturci

We then used these immunopurified stromal cells to assess the sequential expression of ostccihlast phenotype markers during culture. mRNAs for the phenotypic mark-

also contained low numbers of small, rounded, or slightly elongated cells that stained positively for NSE and AcP. Some o f these cells were believed to he macrophages be- C;IIISC large NSE ' multinuclented polykaryons formed in the h e n c e o f 1.2S(OH),D, (Fig. IA). Sonic NSE 'IAcP' cells were also identified a s endothelid cells by immunofluorescence staining for factor Vlll and for endothelial cell-specific CD3 I (Figs. I H and IC). Hone marrow endo-

ers were measured hy RT-PCR a t the early colony stage and at the confluent monolayer stage. For each time point. the cells had been treated continuously with or without dexamethasone (10 M) or 1,2S(OH)?D, (10 M). Agarose gels of the RT-PCR product for p-actin, AP and ostcopontin, osteocalcin, PTH receptor, types I and I I I procollagen. and L,PL are shown in Fig. 4. and the relative expression (after normalizing for the p-actin content) is presented in

thcli;il cells. like monocytes and macrophages, express NSE Table 3. In the absence of treatment with dexamethasone or and AcP hut lack detectable AP activity.""."' 1,2S(OH),D,, growth from the early colony stage to con-

LJsing a n immunomagnctic panning procedure that em- fluency was associated with ii decrease in ostcopontin cx- ployed specific monoclonal antibodies for endothelial cells pression; constitutive osteocalcin gene transcription was (CD3 I ) . lymphocytes (CD I la), and monocytc/macro- undetectable at the colony stage but was easily detectable at phages (C7D14), we quantitated the percentage of these confluency. The abundance o f type I and 111 procollagen cells ; i t different times o f culture a n d also removed these mRNAs increased with time, suggesting a progressive de- cel ls to obtain pure preparations o f stromal cells. As shown velopment o f matrix-synthesizing capacity. Dcxamethasone i n 'lahle 2, a t the early colony stage o f culture, IS-20% o f treatment markedly increased the PTH receptor. t1ormon;il the total adherent cells carried CD14 and CD3 1 surface treatment ;ilterctl adipocyte differentiation a s assessed hy antigens. In confluent cell cultures, <10% o f the cells were changes in LPL mRNA. Cells in the colony stage had high nonstronial. Ahout 7 0 9 of the nonstromal cells were mac- levels of LPL under all conditions hut by confluency expres- rophages (CD 14 ) and about 30% were endothelial sion had declined in control and 1,25(0H),D,-treatctI C I I I - (('113 I ' ). The contamination o f adherent cultures by lym- turcs. In the presence of dcxamcthasonc, however, LPL.

318

30

25

20

15

10

5 -

RICKARD ET AL.

PTH receptor -

- - -

- t f

C 0 In In .- f! n X al 0 > m .- 4- - d

C 0 In In .- E n X al 0) > m .- * - d

C 0 In In .- E n Q 0 > m .- CI - 2

4

AP

1

oc :::I 25

0 -

lor LPL

Stromal Trabecular Skin cells osteoblasts fibroblasts

I .5

I

0.5

0

OP T

FIG.3. Relative expression of mRNAs for osteoblast and adipocyte phcno- typic markers in confluent (nonimmunoselected) marrow stromal cells, trabecular osteoblast-like cells, and skin fibroblasts with dexamethasone at 10 ' M 11 t stipple) or 1,25(OH),D, at 10- M (dense stipple) or no trcat- ment (control, open bars). The RT- PCR amplifications shown in Fig. 2 were performed in the prescncc of a radiolabeled nucleotide, and the amount of PCR-generated fragment was dc- termined bv counting the radioactiv-

$'*

Stromal Trabecular Skin " ity in gel slices. Production lcvcls cells osteoblasta fibroblasts

levels at confluency were maintained or had risen above those in the early colony stage. Thus these findings indicate increased osteogenic differentiation under all conditions, enhanced osteogenic and adipogenic differentiation in the presence of dexamethasone, and loss of adipogenic potential in the absence of dexamethasone.

As assessed by immunocytochemical methods, stromal cells passaged from the early colony culture stage stained very weakly for osteopontin, osteocalcin, and type 111 collagen and more strongly for osteonectin and type I collagen. The intensity of staining for osteopontin, osteocalcin, and

were normalized to the amount of p-actin product detected in the same cDNA samples. The data are prc- sented as the mean mRNA levels (-f SD) relative to control stromal cells (relative expression = l.O), of three separate PCRs using the mRNA from different cultures. AP, alkaline phosphatase; OP, osteopontin; OC, osteocalcin; LPL, lipoprotein lipasc.

type I collagen was higher in cells stimulated with 1,25(OH),D, (Fig. 5). However, consistent with the increased mRNA expression, passaged cells from confluent monolayers displayed increased staining for all the osteoblast-associated proteins compared with cells from the early colonies. The intensity of staining in confluent cells was particularly increased for type I collagen and osteopontin. Interestingly, in the confluent monolayer cells, osteocalcin staining was not enhanced in cells treated with 1,25(OII),D, compared with untreated controls. The proportion o f stained cells varied depending on the marker; an overall

TABLE 2. Ttw PROPORTION OF N~NSTROMAL CELL TYPES IN ADHERENT CULTURES

Confluent Early colonies monolayer

~~~~~ Hybndoma supernatant Cell type or monoclonal antibody n % n %

Macrophages TIB 288 (anti-CD14) 4 14.1 -f 7.6 3 7.3 ? 5.4 Lymphocytes anti-CD1 la/LFA-1 2 < 1 - ND Endothelial cells anti-CD31 (JC70) 4 6.2 -f 3.9 1 2.9

Total adherent cells of culturcs at the early colony stage (days 8-9) or at conflucncy (day 14) were successively incubated with monoclonal antibodies to cell-specific surface antigens and then with immu- nomagnetic beads. The numbers of cells of each type were counted after magnetic separation. Data are the mean (2 SD) percentage of total adherent cells. ND = not determined.


+ beta-acti 800 1,p

+Al' 475 f o p 347

f ( ' 0 1 I

rc I,PI. 27

FIG. 4. Changes in the expression levels of phenotype markers with the stage o f culture. RNA was isolated from stromal cells purified by immunoselection at two culture stages: early colonies (approximately day 7) and confluent monolayers (approximately day 14). Cultures were treated continuously with or without dexamethasone at 1 0 ~ M (Dex) or 1,25(OH),D, at 10 ' M (1,25D). RT-PCR was performed on aliquots o f the purified stromal cells (see Materials a n d Methods). PCR for the following mRNAs was performed: 0-actin, alkaline phosphatase (AP). osteopontin (OP), osteocalcin (OC), PTH receptor, type I procollagen a-chain (COL I ) , type 111 procollagen a-chain (COL I l l ) , and lipoprotein lipase (LPL). The size of each PCR product is indicated in base pairs (bp). Radiolabeled nucleotidc was incorporated into the products to permit direct quantification o f expression levels as presented in Table 3.

assessment o f the relative staining intensity is given in Table 4. Unfortunately, because the cells wcrc plated into chamber slides prior to staining, n o information could be obtained regarding the possible heterogeneity in staining between individual colonies.

I Y i c r i o h p i c uriu1vsi.s of itirliiirliial stronial cell colonies

After confirming the presence of both osteoblastic cells and adipocytes in stromal cell cultures, we wanted to establish whcthcr thcse cells originate from common or separate precursor cells. t3ecause the early colonies represent the progeny o f ;I single adherent cell, we analyzed individual stromal cell colonies obtained by ring cloning. After trans- fer o f individual colonies to 24-well plates, secondary colonies were fornied. A total of 84 colonies (20 control, 25 with

dexamethasone treatment, 20 with 1,25(OH),D, treatment, and 19 with both treatments) were isolated. Control and 1,25(0H),D,-treated cells were more fibroblast-like, whereas cells treated with dexamethasone or dexamethasone plus 1,2S(OH),D, were more cuboidal. Adipocytcs were identified in 24 of the 25 colonies treated with dexamethasone and in all colonies treated with dexamethasone and 1,2S(OH),D,.

mRNA was analyzed in 1 I control colonies, 12 treated with dexamethasone, 1 1 trcatcd with 1,25(OH),D,, and 1.3 treated with both, but the results of RT-PCR analysis for only 8 colonies (2 colonies per condition) are shown (Fig. 6). Different colonies stimulated with the samc hormone expressed predominantly the same mRNAs, and the pattern in each treatment paralleled that observed in multicolony cultures (compare Figs. 4 and 6). For example, dexamethasone-treated colonies had decreased levels of osteopontin mRNA but increased levels of PTH receptor and LPL mRNAs, whereas 1,25(OH),D,-treated colonies exhibited maximal levels of osteocalein mRNA but levels o f AP. osteopontin, PTH receptor, and LPL mRNAs that were comparable to those of the control colonies. With cotreat- ment with dexamethasone and 1,25(OH),D,, both the osteoblastic and adipocytic differentiation markers were induced. Thus individual early stromal cells are capable o f expressing both osteoblastic and adipocytic phenotype markers.

DISCUSSION

Several lines of evidence reported here suggest that the immunoselected stromal cells that we isolated from the early colony stage of culture are in fact authentic osteoblast precursors. First, markers for the late phase of osteoblast differentiation-osteocalcin and the PTH receptor-were undetectable in the early colony stage cells but could be induced by treatment with dexamethasone or 1,25(OH),D,. Second, the coexpression of genes characteristic of osteoblast (AP, osteoealcin, osteopontin, and PTH receptor) and adipocyte (LPL) lineages in clonal colonies indicates that the early stromal cells were uncommitted. In addition, in the presence of dexamethasone or dexamethasone plus 1,2S(OH),D,, isolated single colonies of stromal cells all expressed mRNA for both osteoblast and adipocyte lineage markers, and >90% of the cells contained adipocytes that were fully differentiated morphologically. Third, mRNA and protein for osteoblast differentiation markers wcrc present in low levels in the early colony cells but increased substantially during growth to the confluent monolayer stage, whereas the concentration o f LPL decreased, suggesting increased osteoblast differentiation with a loss o f adipogenic potential. Finally, when the immunoselected early stromal cells were cultured to the postconfluent stage in the presence of dexamethasone and serum, there was abundant deposition of mineralized matrix and formation of mature adipocytes.

Because only a small number of immunoselected early stromal cells were available for study, it was necessary t o use sensitive techniques for their phenotypic characterization. Gene expression could bc assessed only by RT-PCR

320 RICKARD ET AL.

mRNA*

Eurly colonies

Control + Dex + 1,25(0H)&$

AP OP OC PTk1 receptor ('OL I C'OI, I l l LPI,

1 .o 2.2 -+ 1.1 1.5 t 0.3 1 .o 0 .5 ? 0.4 0.9 i- 0.4 1 .o 0.5 t 0.4 11.8 -+ 4.6 1 .o 3.6 i- 2.4 1.5 2 0.9 1 .o 0.2 i- 0.1 1 . I ? 0.5 1 .o 0.4 +- 0.2 1.4 2 0.3 1 .o 1 .1 -+ 0.5 0.9 t 0.7

Control

0.8 5 0.4 0.7 t 0.0 2.9 i- I .O 1.5 -+ 0.7 3.8 -+ 1.8 3.3 -+ 2.2 0.3 -+ 0.1

Confluent monolu.yerS

+ Dex + 1,2S(OH),D I

2.8 -c 1.3 I .o -+ 0.6 0.3 5 0.2 0.8 ? 0.3 I .4 t 0.2 14.6 ? 5.3

17.5 t 14.7 2.8 ? 2.1 2.1 & 1.8 11.5 i- 0.4 3.0 t 1.1 3.2 2 1.7 2.3 t- 0.7 0.4 i- 0.3

( 'ells were continuously treated with vehiclc (control), 10 M dexamethasone (+ Dex) or 10 ' M 1,2S(OH),D,. Results are presented ;IS the mean i- SD o f threc experiment\ using different marrow cultures. Each value was normalized to p-actin and the testlp-actin viiluc is expressed relative to the control-treatcd cells at the early colony stage (early colonies, control = 1.0).

* AP. alkaline phosphatase; OP, o\tcopontin; OC, osteocalcin; COL I, type I procollagen wchain; COL 111. type 111 procollagen wchain; LPL. lipoprotein lipase.

FIG. 5. Immunocytochcmical staining for ostcoblast-related proteins in stromal cells passaged from thc early colony (A, C, E, and G) and confluent monolayer (B, D, F, and H) stages of culture. Ostcocalcin: A (treated with 1,2S[OH],D,) and B (control). Osteopontin: C (control) and D (treatcd with 1,2S[OH],D,). Type I procollagen: E (control) and F (control). Background staining controls (no antibody): G and H. Magnification X200. Thc intcnsity of staining for these and other proteins was graded and is presented i n Tablc 4.

CHARACTERIZATION OF HUMAN OSTEOPROGENITOR CELLS 32 I

I'rotciir

Alkaline phosphatasc ++ + + +++ + + + Osteopontin +I- + ++ t- + + Osteocalcin +I- + ++ ++ Osteoncctin + +I- + + h n c sialoprotcin ND N 1) + + +I-- Type I procollagen + -t + ++++ ++++ Type I l l procollagen +I- +I- ++ +t

C'ulturcs were treated continuously with o r without 10 ' M 1,25(0H),D, (1,250) and stained iinmunocytocl~c~nic~illy o r , i n the cahc 01

* Intensity o f staining was graded :IS follows: +/ -, weak to undetectable staining; +, definite staining but ol low intensity; t t , niodcratc cd from arcas in the cciitcr

;ilkalinc phosphalaac. histochcmically.

staining: + + +, intense staining: + t + t. very intense staining; ND, not determined. The staining was a o f t l ic wcIIs where the background staining was lowest.

which, with normalization to the house-keeping gene 6-actin. provided ;I semiquantitative assessment of steady-state mRNA Icvcls.'-"" Indeed we found that, for the RT-PCR measurements for characterization of the immunoselected cells. the coefficients of variation for duplicate nicasure- nieiits o f abundant mRNAs. such a s @-actin, AP, osteopon- t i n . and I F L , were about 10-2074. The ability o f RT-PCR to detect consistent differences in the mRNA levels between treatments and culture stages supports the utility of this approach when cell numbers are limited. Furthermore, that the changes in mRNA levels determined by RT-PCR retlcctcd actual expression o f the proteins was demonstrated by the finding that the intensity of immunocyto- chemicol staining changed in parallel with the mRNA levels.

The adherence o f stromal cells to plastic has been utilized by previous investigators' I 1~-15.'") and was also used by us to obtain stromal cells from mononuclear bone marrow cells. I n previous studies. stromal cultures were not purified further to rcmovc other contaminating hematopoietic cells and were studied only after they were grown to confluence, by which time they contained markers for the highly differentiated osteoblast phenotype. We resolved these two defi- ciencies by using negative immunoselection to isolate a nearly homogeneous population of osteoblast progenitor cells at the early colony stage and by using sensitive methods to study them without further cell expansion in culture.

Pure preparations o f adherent stromal cells have also been isolated from human bone marrow using a monoclonal antibody, STRO- I"" (which also recognized erythroid progcnitors). and recently it was reported that osteoblast precursors are contained exclusively within the STRO-I ' cell fr:ictioii."." Although i t is potentially useful. nothing is known about the antigenic epitope recognized by the stromal antibody. Also in yet another approach to this difficult prohlcni, Long ct isolated osteoprogenitor cells from the nonadhercnt fraction o f human marrow. These cells exhibited cell-surface alkaline phosphatase and osteocalcin

expression and responded to bone matrix-derived growth factors in serum-free culture.'") At present the relationship between stromal cells obtained using these different procc- durcs and the stromal cells that we have studied is unclear.

c t r

FIG. 6 . Analysis of mRNAs for osteoblastic and adipocytic markers in individual stromal cell colonies. Colonies at an early culture stage were ring cloned and exparided for approximately 4 weeks in the continuous presence o f dexamethasone at 10 ' M (Dex) or 1,25(OH),L), at 10 " M (1,25D) or both hormones or no treatment. KNA was extracted from each colony and analyzed separately by RT- PCR. Ethidium bromide-stained agarose gels of PCR products for eight different colonies (two colonies pcr treatment) are shown. The size in base pairs (bp) of each product is indicated. AP, alkaline phosphatase; OP, 05-

teopontin; OC', ostcocalcin; LPL, lipoprotein lipase.

322 RICKARD ET AL.

Osteoblast differentiation has also been investigated using osteoblastic cells released by sequential collagenase digestion of fetal rat calvaria with selection of an osteoblast-rich fraction. In the presence of serum these cells will differentiate spontaneously over time, a process characterized by three phases in which there is sequential expression of genes associated first with cell proliferation and subsequently with matrix formation, matrix maturation, and finally matrix mineraliza- tion,' 1 x 3 ) However, only a small fraction of the calvarial cells are osteoblast precursors whose progeny undergo either a similar pattern of development culminating in the formation of a bone nodule'") or exhibit multilineage potential.(4,3h) The remainder of the calvarial cells already possess an overtly osteoblastic phenotype, and unfractionated cultures form mincral deposits even in the absence of inducers of differentiation,( 1'1.37) Therefore, we believe that the culture method described here is more suitable for studying the initial stages of osteoblast differentiation.

The vast majority of immunoselected stromal cells appear to represent more immature osteoblastic lineage cells, because they are capable of differentiating into adipocytes and are unable to deposit mineral spontaneously. In addition, the colony-forming cells of stromal cultures may exist in a more uniform stage of differentiation than those from calvarial cultures. We found that the pattern of mRNA expression among the different individual cloned colonies was the same after a given treatment program and paral- lcled that observed in multicolony cultures. In contrast, calvarial cultures are generated from pooled populations of collagenase-released cells, and resultant colonies exhibit mixed fibroblasticiosteoblastic morphologies and variable gene expression.(-3x'

The stromal cells from the early colony stage of culture had a high level of constitutive gene expression for AP and osteopontin and gene expression for osteocalcin could be readily induced by treatment with 1,2S(OH),D,. This con- trasts with rat marrow stromal cells which require the presence of potent inducers of osteogenic differentiation such as dexamethasone or BMP-2 for the production of signifi- cant levels of AP, osteopontin, and osteocalcin."") Further- more, rat bone marrow stromal cells differentiate rapidly in culture and express a more mature osteoblast phenotype prior to confluency."") These findings suggest that there may be important differences between man and rodents in the sequence of osteoblast differentiation.

Our finding that human bone marrow contains a common precursor for both osteoblasts and adipocytes is consistent with previously reported studies in rodents. Beres- ford et al.'""' reported an inverse relationship between osteoblastic and adipocytic differentiation in cultured rat marrow after treatment with dexamethasone in the presence or absence of 1,25(OH),D,. Dorheim et al.(41) found that certain preadipocytic murine stromal cell lines exhibited osteoblastic characteristics which decreased during ad- ipogenesis. Finally, Bennett et al.") reported that adipocytes derived from rabbit marrow stroma developed an osteogenic tissue when implanted into diffusion chambers in vivo. Our findings from the multicolony cultures cannot exclude the possibility that different colonies are comprised of cells all committed to either one lineage or the other.

However, expression of mRNA for both osteoblast and adipocyte-related genes in all of the cloned stromal cell colonies examined provides the most direct cvidcnce for a common osteoblast and adipocyte precursor because this finding demonstrates that the initial adherent stromal cell (CFU-f) or its early descendants are not yet committed to either lineage and are at least bipotential. The fact that in all of the cloned colonies both adipocytes and differentiated osteoblast markers could be demonstrated, together with the finding that mRNA expression in the multicolony culture resembled each individual colony, suggests that the initial stromal cell colony-initiating cells are phenotypically quite homogeneous even though at subsequent stages cells within the same colony differentiate along both lineages. Furthermore, because each colony is derived from a single cell investigation of individual colonies isolated by ring cloning offers an alternative approach to limiting dilution for assessing heterogeneity within the stromal cell population. The presence of a common precursor to osteoblasts and adipocytes in marrow also could explain the histologic findings that there is a reciprocal relationship betwccn marrow adipose tissue development and trabecular bone formation in dogd4" and in man.(".3) Another possible con- sequence of a common origin for these lineages is agents that d o not accelerate osteoblast differentiation directly still could increase osteogenesis by inhibiting the opposing path- way for adipocyte differentiation.

In the presence of only serum, expression of the genes for osteoblast markers increased between early colonics and confluence whereas levels of LPL mRNA decreased; however, the addition of dexamethasone was required for the deposition of a mineralized matrix. Both serum and dexu- methasone were required for the differentiation t o the adipocyte phenotype (increasing levels o f LPL mRNA and the formation of cytoplasmic lipid droplets). Thus dexamethasone is required for the complete expression o f both phenotypes. This is consistent with reports that glucocorticoids promote the differentiation of various niesenchymal cell types (myoblasts, chondrocytes, osteoblasts. and adipocytes) from multipotential mesenchymal cell I n contrast, the only demonstrable effect of 1,2S(OH),D, on stromal cells, at both the early colony and the confluent monolayer stage, was an increase in osteocalcin mRNA and protein. Although 1,2S(OH),D, increases the production o f AP, osteopontin, and type I collagen in other osteoblast culture ~ y s t e m s , ( ~ ~ . ~ - ~ ' it was without effect in the human stromal cells, suggesting that 1,2S(OH)2D, may not be ii major mod- ulator of the initial stages in differentiation of human ostcoblast precursors.

Confluent stromal cell and trabecular ostcoblast-like cell cultures both exhibited markers for the diffcrentiatcd osteoblast phenotype, but there were quantitative and quali- tative differences in the mRNA profiles: the stromal cells had higher levels o f osteopontin mRNA, lower lcvcls o f osteocalcin mRNA, a dexamethasone-inducible exprcssion of PTH receptor, and the presence o f LPL. These diffcr- ences in osteocalcin, osteopontin, PTH receptor. and LPL expression suggest that although confluent stromal cells exhibit several markers of differentiated osteoblasts, they should still be considered osteoblast precursors or inima-


turc osteoblasts. The specificity of the m R N A profiles in the stromal cells was confirmed by finding that levels of the osteoblast phenotype markers were very low or absent in skin fibroblasts, with the exception of the constitutive level o f PTH receptor.

An interesting observation was the maximal expression of PTH receptor mRNA levels in dexamethasone-treated confluent stromal cells. implying that this receptor may be most abundant on more differentiated osteoblast progenitors and less abundant on immature osteoblast progenitors and differentiated osteoblasts. O u r findings are in agreement with previous data demonstrating increased PTH responsiveness of stromal cells following treatment with dexa- niethasone or BMP-2.(2".4") However, localization of PTH receptor mRNA and [''51]PTH binding in rat bones revealed the highest receptor expression in osteoblasts lining bone surfaces with weaker expression in some marrow stro- ma1 cell^.'^^^^^' Taken together, the PTH receptor may thus be a relatively late marker for osteoblast differentiation, and variation in stromal cell expression in situ may signify ostcoblast precursors at different stages of maturation.

In conclusion. we have developed a new method for isolating and characterizing early undifferentiated human marrow stromal cells with the potential t o develop into either the osteoblast o r adipocyte lineages. This method should permit a systematic study of factors regulating the differentiation and commitment of osteoblast lineage cells from progenitors in normal human marrow. It should also ullow a search for abnormalities of osteoblast progenitor differentiation in osteopenic diseases.

ACKNOWLEDGMENTS

We are greatly indebted to Dr. Mark Bolander for help- ful discussion. Marlys Anderson, Susan Bonde, and Kevin Hicok are thanked for their excellent technical assistance. These studies were supported by NIH Grant AG-04875.

REFERENCES

I .

-. 7

3.

4.

5.

6.

f:ricdcnstein AJ. Chnilakhyan RK, Gerasimov UV 1987 Bone marrow osteogcnic stem cells: In vitro cultivation and trans- plantation in diffusion chambers. Cell Tissue Kinet 20263-272. Owen ME I988 Marrow stromal stem cells. J Cell Sci 10

Katagiri T. Yamaguchi A, lkeda T, Yoshiki S, Wozney JM, Rosen V. Wang EA, Tnnaka H, Ornura S, Suda T 1990 The nonostcogcnic mousc pluripotential cell line, C3HlOT112, is induced t o differentiate into osteoblastic cells by recombinant humnn hone niorphogenetic protein-2. Biochem Biophys Res Coinmun 172:195-2YY. Grigoriadis AE. Heerschc HNM, Aubin JE 1988 Differentia- tion of muscle, fat, cartilage and bone from progenitor cells present in a bone-derived clonal cell population: Effect of dcxarncthasone. J Cell Biol 106:2139-2151. Yaniaguchi A. Kahn AJ 1991 Clonal osteogenic cell lines express myogcnic and adipogenic developmental potential. (', 1 .'. Zipori D, Duskin D, Tarnir M, Argarnan A, Toledo J, Malik K 19x5 Cultured niousc marrow stromal cell lines. 11. Distinct

(Suppl):h3-76.

A cit Tissuc Int 49221-22s.

7.

8.

9.

10.

11.

12.

13.

14.

1s.

16.

17.

18.

19.

20.

21.

22.

23.

24.

subtypes differing in morphology, collagen types, myelopoietic factors and leukemic cell growth modulating activities. J Cell Physiol 12281-00. Bennett JH, Joyner CJ, Triffitt JT, Owen ME 190 I Adipocyte cells cultured from marrow have osteogenic potcntial. J Cell Sci 99131-139. Ashton BA, Allen TD, Howlett CR, Eaglesom CC, Ilattori A. Owen ME 1980 Formation of bone and cartilage by marrow stromal cells in diffusion chambers in vivo. Clin Orthop 151: 294-307. Bab I, Ashton BA, Gazit D, Marx G, Williamson MC, Owen ME 1986 lne t i c s and differentiation of marrow stromal cells in diffusion chambers in vivo. J Cell Sci W.139-151. Owen ME, Friedenstein AJ 1988 Stromal stem cells: marrow- derived osteogenic precursors. In: Evered D, Harnett S (eds.) Cell and Molecular Biology of Vertebrate Hard Tissues. Wilcy. Chichester, pp. 42-60. Maniatopoulos C, Sodek J , Melcher AH I 9XX Bone formation in vitro by stromal cells obtained from bone marrow of young adult rats. Cell Tissue Res 254:3 17-330. Benayahu D, Kletter Y, Zipori D, Weintroub S 19x9 Bone marrow-derived stromal cell line expression osteoblastic phc- notype in vitro and osteogenic capacity in vivo. J Cell Physiol 1401-7. Leboy PS, Beresford JN, Devlin C, Owen ME 1991 Dexameth- asone induction of osteoblast mRNAs in rat bone marrow stromal cell cultures. J Cell Physiol 146570-378. Haynesworth SE, Goshima J, Goldberg VM, Caplan A1 1992 Characterization of cells with osteogenic potential from human marrow. Bone 13231-88. Kassem M, Risteli L, Mosekilde L, Melsen F, Eriksen EF 1901 Formation of osteoblast-like cells from human mononuclenr bone marrow cultures. AEMIS 99269 -274. Gerstenfeld LC, Chipman SD, Glowacki J, Lian J B 1987 Ex- pression of differentiated function by mineralizing cultures of chicken osteoblasts. Dev Biol 12240-60. Aronow MA, Gerstenfeld LC, Owen TA, Tassinari MS, Stein GS, Lian JB 1990 Factors that promote progressive development of the osteoblast phenotype in cultured fetal rat calvaria cells. J Cell Physiol 143213-221. Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, Kennedy MB, Pockwinse S, Lian JB, Stein GS 1990 Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J Cell Physiol 143:

Bellows CG, Aubin JE, Heersche JNM, Antosz ME 19x0 Mineralised bone nodules formed in vitro from enzymatically released rat calvaria cell populations. Calcif Tissuc I n t 38143- 154. Cheng S-L, Yang JW, Rifas L, Zhang S-F, Avioli LV I994 Differentiation of human bone marrow osteogenic stromal cells in vitro: Induction of osteoblast phenotype by dexamethasone. Endocrinology 134:277-286. Simmons PJ, Torok-Storb B 1991 Identification of stromal cell precursors in human bone marrow by a novel monoclonal antibody, STRO-1. Blood 7855-62. Gronthos S, Graves SE, Ohta S, Simmons PJ I994 The STRO-1' fraction of adult human bone marrow contains the osteogenic precursors. Blood 84:4 164-4 173. Long MW, Robinson JA, Ashcraft EA. Mann KG 19YS Reg- ulation of human bone marrow-derived osteoprogenitor cells by osteogenic growth factors. J Clin Invest 95:881-887. Malaval L, Modrowski D, Gupta AK, Aubin JE 1094 Cellular expression of bone-related proteins during in vitro osteogenc-

420-430.

324 RICKARI) ET AL.

sis i n rat bone niiirrow stromal cell cultures. J Cell Physiol

25. Pockwinsc SM. Wilming LG, Conlon DM, Stein t iS, Lian JB 1YY2 Expression o f cell growth and hone-specific genes at single cell resolution during development of bone tissue-like orgxniration in primary osteohlast cultures. J Cell Biochem 49:310-323.

26. Fei R-G, Penn PE. Wolf NS l0Y0 A method to establish pure fihrohlust and endothclial cell colony cultures from murine hone marrow. Exp Hematol 18:YS3-957.

27. l'enn PE. Jiang D-Z, Frei K-G, Sitnicka E, Wolf NS lYY3 llissccting the hematopoietic microenvironment. IX. Further chimctcrization o f murine hone marrow stromal cells. Blood X I : 1205-12 13.

2X. Parunis DV. Cordcll JL, Micklcm K, Heryet AR, Gatter KC, Mason IIY IYYO JC70: A new monoclonal antibody that de- tects vascular endotheliuni associated antigen on routinely pro- c c w d tissue sections. J Clin Pathol 43:752-757.

20. Kohey PG. 'l'ermine J D 10x5 Human bone cells in vitro. Calcif 'l'issuc Int 37:453-460.

30. Horke JL. Eriksen EF. Minanii J , Keeting P, Mann KG, Pen- riiston JT. Kiggs BL, Kuniar R I Y X X Epitupes o f the human crythrocytc C'a: ' -Mg2 ' Al'P21sc pump in human osteohlast- like cell plasma membranes. J C'lin Eiidocrinol Metah 67:lZOY- 1304.

3 I . Bianco P, Fisher LW, Young MF, Terniine JD. Gchron Kobey t' IVY0 Expression and localization of the two small protcogly- ciins higlycan and dccoi-in in developing human skeleton and non-skeletal tissues. J Histocheni Cytochcm 38:1540-1503.

32. C'hoincrynski P, Sacchi N 10x7 Single-step method o f RNA isolation by acid guanidinium thiocyanatc-phenol-chloroform extraction. Anal Biochem 162: 156-15Y.

33. Kirchgcssncr TG, LeBoeuf KC, Langner CA, Zollman S. ('hang C'H, Taylor UA. Schotz MC, Gordon JI. Lusih AJ l9XY Genetic and developmental regulation of thc lipoprotein lipasc genc. Loci both distal and proximal to the lipoprotein lipase sti iictural genc control enLymc expression. J Biol Cheni 264: 1473-14x2.

34. Kappolcc DA, Mark 0, Banda MJ. Werb Z I Y X X Wound maciophages express TGFu and other growth factors in vivo: Analysis hy mRNA phcnotyping. Science 241:70X-712.

35. Bellows CG, Auhin J E I Y X Y Dcterniination of the numbers of osteoprogcnitors in isolated fetal rat calvarial cells in vitro. Dev Biol 13:X--l3.

30. Hcllows <Xi, Wang Y-I{, H chc HNM. Auhin J E 1004 I ,25-Dihydroxyvitaniin D, stimulates adipocytic differentiation i n cultures o f fctal rat calvarial cells: Comparihon with the ctt'ccts of dexamethusone. Endocrinology 134:2221-222Y.

37. Ucllows CG, Aubin JE, Heersche HNM 19x7 Physiological concentrations o f glucocorticoids stimulate formation of bone nodulcs from isolated rat calvarial cells in vitro. Endocrinology 121: I YX5- lY92.

3X. Liu F, Mal;ival L, Gupta AK, Auhin J E 1904 Simultaneous

isn:555-~72. detection o f multiple bone-related mRNAs and protein expression during osteohlast differentiation: Polymerase chain reoc- tion and imniunocytoehemic;iI studies at the single cell level. Dev Biol 166220-234.

3Y. Rickard DJ, Sullivan TA. Shenker BJ, Lcboy PS. Kazlirlan I 1904 Induction of rapid osteohlast differentiation in rat bone marrow stronial cell cultures by dexamethasonc and BMP-2. Dev Biol 161:218-228.

40. Bcresford JN, Bennett JH, Devlin C, Lehoy PS, Owen ME 1992 Evidence for an inverse relationship hetwcen the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J Cell Sci 102:341-351.

41. Dorheim M-A, Sullivan M, Dandapani V. Wu X. Hudson J, Scgarini PR, Roscn DM, Aulthouse AL, Gimble JM IYY3 Ostcohlnstic gene expression during adipogcnesis in hcmato- poietic supporting niurine hone marrow stromal cells. J Cell Physiol 1.543 17-328.

42. Wronski TJ, Smith JM, Jee WSS I Y X I Variations i n mineral apposition rate of trahecular hone within the Beagle skeleton. C 21 1." L i t Tissue Int 33:SX3-5X(i.

43. Meunier PJ, Aaron J. Edouard C , Vignon G 1Y71 Osteoporosis and the replucemcnt o f cell populations o f the marrow hy adipose tissue. Clin Orthop Rcl Rcs 8 0 147-154.

44. Beresford JN, Gallagher JA, Russell RCX IYXO 1.25-Dihy- droxyvitamin D, and human bone-derived cel ls in vitro: Effects on alkaline phosphatase, type I collagen and prolifcr;ition. Endocrinology 119: 1770-1 7x5.

45. Yoon K, Bucnagn R. Rodan G A 1987 Tissue specificity ;ind developmental expression o f rat osteopontin. Biochem Biophys Res Comniun 148:I l2Y-I 136.

46. Thies RS. Bauduy M. Ashton BA. Kurtzlierg L, Wozncy JM. Rosen V lYY2 Recombinant human bone morphogenctic protein-2 induces ostcohlastic differentiation in w-20- 17 stronial cells. Endocrinology 130: 131 X-1324.

47. Rouleau MF, Mitchell J, Goltznian D I Y X X In vitro distribution of parathyroid hormone receptors in hone. Evidcncc that i i

predominant O S ~ ~ O U S target cell is not the mature ohtcohlast. Endocrinology 123: lX7-lYl.

48. Lee K, Deeds JD, Chihn S, Un-No M, Bond AT. Scgre G V 1Y04 Parathyroid hormone induces sequential c-fos expression in hone cells in vivo: I n situ localizntion o f its receptor and c-fob messenger RNAs. Endocrinology 134441-450.

Address reprint requests to: B. Lawrcwc, Kiggs, M. I).

North 6 Plirninic~r M q o C 7 i t i i c

200 First Strcvt S W Kochcster, M N 55905. U. S.A.

Received in original form June 30, 1995: in revised form Octoher 7, 1995: accepted November 3. 1005.

Documents

Isolation and characterization of osteoblast precursor cells from human bone marrow