MECHANOTRANSDUCTION OF STRETCH-INDUCED PROSTANOID RELEASE BY FETAL LUNG EPITHELIAL CELLS

Ian B Coplandac Denis Reynaudb Cecil Pace-Asciakbc and Martin Postabde

aLung and bIntegrative Biology Programs The Hospital for Sick Children Research Institute and cDepartments of Pharmacology dLaboratory Medicine and Pathobiology ePediatrics University of Toronto Toronto Ontario Canada Running Title Stretch Regulation of Eicosanoids in the Lung Address of correspondence Dr Martin Post Lung Biology Program The Hospital for Sick Children 555 University Avenue Toronto Ontario Canada M5G 1X8

Tel 416-813-6772 Fax 416-813-5002 Email martinpostsickkidsca

1

Page 1 of 37Articles in PresS Am J Physiol Lung Cell Mol Physiol (April 7 2006) doi101152ajplung005102005

Copyright copy 2006 by the American Physiological Society

SUMMARY

Mechanical ventilation is the primary supportive treatment for infants and adults

suffering from severe respiratory failure Adverse mechanical ventilation (overdistension

of the lung) triggers a proinflammatory response Along with cytokines inflammatory

mediators such as bioactive lipids are involved in the regulation of the inflammatory

response The arachidonic acid pathway is a key source of bioactive lipid mediators

including prostanoids Although ventilation has been shown to influence the production

of prostanoids in the lung the mechanotransduction pathways are unknown Herein we

established that cyclic stretch of fetal lung epithelial cells but not fibroblasts can evoke

an extremely sensitive rapid alteration in eicosanoid metabolism through a

cyclooxygenase (COX)-2 dependent mechanism Cyclic stretch significantly increased

PGI2 PGF2α PGD2 PGE2 and TXB2 levels in the media of epithelial cells but did not

alter LTB4 or 12-HETE levels Inhibition of COX-2 but not COX-1 attenuated the

cyclic stretch-induced PG increase in the media suggesting that cyclic stretch primarily

affected PG synthesis Substrate (free arachidonic acid) availability for prostaglandin

generation was increased due to a cyclic stretch-induced activation of cytosolic

phospholipase A2 (cPLA2) via an influx of extracellular calcium and phosphorylation by

mitogen activated protein kinase p4442MAPK The data are compatible with cPLA2

and COX-2 being intimately involved in regulating the injury response to adverse

mechanical ventilation

Keywords Stretch Prostanoids Lung COX-2 Mechanotransduction

2

Page 2 of 37

INTRODUCTION

Experimental models have left little doubt that high tidal volume ventilation triggers an

inflammatory response in the adult and neonatal lung (11 12 48) Although cytokines

have received most attention prostanoids also have the ability to control acute

inflammation They can produce both pro- and anti-inflammatory actions depending

upon the inflammatory stimulus the major prostanoid produced and profile of prostanoid

receptor expression (47) In contrast to cytokines which production is controlled at the

transcriptional level prostanoids are formed by post-translational processes (See Fig 1)

Thus altered prostanoid production andor release can be a very early response to stress

and may initiate many of the classical signs of ventilation-induced lung inflammation

Several studies have shown that mechanical stress influences the production of

prostanoids in the lung Stretch-induced prostanoid release by lung was first reported in

1969 (14) The mediator was identified as PGE2 and the authors suggested that the

release of PGE2 might contribute to the hemodynamic effects of mechanical ventilation

(7 14) The release of prostanoids appears also to be altered in mechanically ventilated

dogs and sheep (4 6) as well as in rat models of ventilation-induced lung injury (5253)

In vitro physical deformation by gentle scraping or agitation of cultured human

pulmonary endothelial cells has been shown to increase the release of PGI2 (24) Cyclic

stretching of fetal lung cells had a similar effect (42) In addition to lung cells uterine

myometrial cells tendon fibroblasts macrophages and osteoblasts have all been shown to

increase their prostanoid production due to increased mechanical stress (16 25 32 43)

Thus mechanostimulation of prostanoid production andor release may be a conserved

3

Page 3 of 37

event in the evolution of the inflammatory response triggered by mechanical forces The

mechanotransduction pathways leading to increased prostanoid formation upon physical

stimulation remain to be elucidated

Herein we studied the intracellular signaling pathways of stretch-stimulated

prostanoid formation in primary fetal lung cells We report that cyclic stretch causes cell

type- amplitude- and duration-dependent increases in prostanoid production which are

mediated via calcium-dependent PLA2 p4442 mitogen activated protein kinase (MAPK)

and COX-2

4

Page 4 of 37

MATERIALS AND METHODS

Materials - Culture media trypsin antibiotics and fetal bovine serum (FBS) were from

GIBCO BRL (ON Canada) DNase and collagenase were from Worthington (NJ USA)

Bioflex six-well plates (Bioflex Collagen Type I culture plates) were from Flexcell

International (NC USA) SB203580 was from Alexis Biochemical (CA USA) U0126

AACOF3 HELSS and BAPTAAM were from Cedarlane (ON Canada) Ibuprofen

Gadolinium and EGTA were from Sigma Chemical (ON Canada) while SC-560 and

NS-398 were from Calbiochem (ON Canada)

Cell Culture - Female timed-pregnant Wistar rats were obtained from Charles River (St

Constant Quebec) and were housed in the Hospital for Sick Children animal facilities

until used All animal procedures were in accordance with Canadian Council of Animal

Care guidelines and were approved by the Animal Care and Use Committee of the

Hospital for Sick Children Fetal timed pregnant rats and their fetuses were sacrificed at

day 19 of gestation (term=22 days) Rat fetal lung fibroblast and epithelial cells were

isolated as described previously (10) The purity of each cell type was gt90 Within 24

hours of isolation fetal lung cells were harvested from cell culture plates with 025

(wv) trypsin in 04 mM EDTA Fibroblast and epithelial cells were separately inoculated

at a density of 106 cellswell onto 6-well type-1 collagen-coated BioFlex plates Cells

were maintained for 24 hours in MEM + 10 (vv) FBS Four hours prior to the cells

being stretched the medium was changed to MEM + 05 (vv) FBS After 3 hours cells

5

Page 5 of 37

were changed to fresh MEM + 05 (vv) FBS with and without inhibitors incubated for

another hour and then subjected to cyclic stretch or static culture

Mechanical stretch of fetal lung cells The Flexercell Strain Unit FX-4000 (Flexercell

Int NC USA) is a computer driven instrument that simulates biological strain conditions

using vacuum pressure to deform cells cultured on flexible matrix-bonded growth

surfaces An equibiaxial strain across the surface of the membrane is achieved by

applying vacuum underneath which pulls the membrane downward to a pre-programmed

level of elongation while the membrane is positioned over a stationary post This ensures

that the membrane is stretched in a single plane so that a uniform strain is generated in

both the radial and circumferential direction Thus the Flexercell system stretches the

cells by changing the surface area on which the cells are attached and the degree of

stretch relates to the percent change in surface area (ΔSA) Cyclic continuous radial

elongations of 5 10 or 17 were applied at intervals of 30 cycles per min for various

durations Based upon an equation (ΔSA = 00057 (TLC)2 - 02608 (TLC) +

48021) describing the relationship between epithelial basement membrane surface area

and lung volume in isolated rat lungs (49) these stretch regimens equate roughly to

percent changes in epithelial basement membrane surface area seen in vivo at 47 62 and

75 TLC A 5 stretch regimen simulates the stretch amplitude of fetal breathing

movements (FBM) which are intermittent movements ie the fetus spends ~30 of its

time making fetal breathing movements at late gestation Thus fetal lung cells in utero

will be exposed to a 5 stretch but not continuously Neither cell viability (trypan blue

exclusion) nor cell attachment were affected by any of the applied stretch regimens or

6

Page 6 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

SUMMARY

Mechanical ventilation is the primary supportive treatment for infants and adults

suffering from severe respiratory failure Adverse mechanical ventilation (overdistension

of the lung) triggers a proinflammatory response Along with cytokines inflammatory

mediators such as bioactive lipids are involved in the regulation of the inflammatory

response The arachidonic acid pathway is a key source of bioactive lipid mediators

including prostanoids Although ventilation has been shown to influence the production

of prostanoids in the lung the mechanotransduction pathways are unknown Herein we

established that cyclic stretch of fetal lung epithelial cells but not fibroblasts can evoke

an extremely sensitive rapid alteration in eicosanoid metabolism through a

cyclooxygenase (COX)-2 dependent mechanism Cyclic stretch significantly increased

PGI2 PGF2α PGD2 PGE2 and TXB2 levels in the media of epithelial cells but did not

alter LTB4 or 12-HETE levels Inhibition of COX-2 but not COX-1 attenuated the

cyclic stretch-induced PG increase in the media suggesting that cyclic stretch primarily

affected PG synthesis Substrate (free arachidonic acid) availability for prostaglandin

generation was increased due to a cyclic stretch-induced activation of cytosolic

phospholipase A2 (cPLA2) via an influx of extracellular calcium and phosphorylation by

mitogen activated protein kinase p4442MAPK The data are compatible with cPLA2

and COX-2 being intimately involved in regulating the injury response to adverse

mechanical ventilation

Keywords Stretch Prostanoids Lung COX-2 Mechanotransduction

2

Page 2 of 37

INTRODUCTION

Experimental models have left little doubt that high tidal volume ventilation triggers an

inflammatory response in the adult and neonatal lung (11 12 48) Although cytokines

have received most attention prostanoids also have the ability to control acute

inflammation They can produce both pro- and anti-inflammatory actions depending

upon the inflammatory stimulus the major prostanoid produced and profile of prostanoid

receptor expression (47) In contrast to cytokines which production is controlled at the

transcriptional level prostanoids are formed by post-translational processes (See Fig 1)

Thus altered prostanoid production andor release can be a very early response to stress

and may initiate many of the classical signs of ventilation-induced lung inflammation

Several studies have shown that mechanical stress influences the production of

prostanoids in the lung Stretch-induced prostanoid release by lung was first reported in

1969 (14) The mediator was identified as PGE2 and the authors suggested that the

release of PGE2 might contribute to the hemodynamic effects of mechanical ventilation

(7 14) The release of prostanoids appears also to be altered in mechanically ventilated

dogs and sheep (4 6) as well as in rat models of ventilation-induced lung injury (5253)

In vitro physical deformation by gentle scraping or agitation of cultured human

pulmonary endothelial cells has been shown to increase the release of PGI2 (24) Cyclic

stretching of fetal lung cells had a similar effect (42) In addition to lung cells uterine

myometrial cells tendon fibroblasts macrophages and osteoblasts have all been shown to

increase their prostanoid production due to increased mechanical stress (16 25 32 43)

Thus mechanostimulation of prostanoid production andor release may be a conserved

3

Page 3 of 37

event in the evolution of the inflammatory response triggered by mechanical forces The

mechanotransduction pathways leading to increased prostanoid formation upon physical

stimulation remain to be elucidated

Herein we studied the intracellular signaling pathways of stretch-stimulated

prostanoid formation in primary fetal lung cells We report that cyclic stretch causes cell

type- amplitude- and duration-dependent increases in prostanoid production which are

mediated via calcium-dependent PLA2 p4442 mitogen activated protein kinase (MAPK)

and COX-2

4

Page 4 of 37

MATERIALS AND METHODS

Materials - Culture media trypsin antibiotics and fetal bovine serum (FBS) were from

GIBCO BRL (ON Canada) DNase and collagenase were from Worthington (NJ USA)

Bioflex six-well plates (Bioflex Collagen Type I culture plates) were from Flexcell

International (NC USA) SB203580 was from Alexis Biochemical (CA USA) U0126

AACOF3 HELSS and BAPTAAM were from Cedarlane (ON Canada) Ibuprofen

Gadolinium and EGTA were from Sigma Chemical (ON Canada) while SC-560 and

NS-398 were from Calbiochem (ON Canada)

Cell Culture - Female timed-pregnant Wistar rats were obtained from Charles River (St

Constant Quebec) and were housed in the Hospital for Sick Children animal facilities

until used All animal procedures were in accordance with Canadian Council of Animal

Care guidelines and were approved by the Animal Care and Use Committee of the

Hospital for Sick Children Fetal timed pregnant rats and their fetuses were sacrificed at

day 19 of gestation (term=22 days) Rat fetal lung fibroblast and epithelial cells were

isolated as described previously (10) The purity of each cell type was gt90 Within 24

hours of isolation fetal lung cells were harvested from cell culture plates with 025

(wv) trypsin in 04 mM EDTA Fibroblast and epithelial cells were separately inoculated

at a density of 106 cellswell onto 6-well type-1 collagen-coated BioFlex plates Cells

were maintained for 24 hours in MEM + 10 (vv) FBS Four hours prior to the cells

being stretched the medium was changed to MEM + 05 (vv) FBS After 3 hours cells

5

Page 5 of 37

were changed to fresh MEM + 05 (vv) FBS with and without inhibitors incubated for

another hour and then subjected to cyclic stretch or static culture

Mechanical stretch of fetal lung cells The Flexercell Strain Unit FX-4000 (Flexercell

Int NC USA) is a computer driven instrument that simulates biological strain conditions

using vacuum pressure to deform cells cultured on flexible matrix-bonded growth

surfaces An equibiaxial strain across the surface of the membrane is achieved by

applying vacuum underneath which pulls the membrane downward to a pre-programmed

level of elongation while the membrane is positioned over a stationary post This ensures

that the membrane is stretched in a single plane so that a uniform strain is generated in

both the radial and circumferential direction Thus the Flexercell system stretches the

cells by changing the surface area on which the cells are attached and the degree of

stretch relates to the percent change in surface area (ΔSA) Cyclic continuous radial

elongations of 5 10 or 17 were applied at intervals of 30 cycles per min for various

durations Based upon an equation (ΔSA = 00057 (TLC)2 - 02608 (TLC) +

48021) describing the relationship between epithelial basement membrane surface area

and lung volume in isolated rat lungs (49) these stretch regimens equate roughly to

percent changes in epithelial basement membrane surface area seen in vivo at 47 62 and

75 TLC A 5 stretch regimen simulates the stretch amplitude of fetal breathing

movements (FBM) which are intermittent movements ie the fetus spends ~30 of its

time making fetal breathing movements at late gestation Thus fetal lung cells in utero

will be exposed to a 5 stretch but not continuously Neither cell viability (trypan blue

exclusion) nor cell attachment were affected by any of the applied stretch regimens or

6

Page 6 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

INTRODUCTION

Experimental models have left little doubt that high tidal volume ventilation triggers an

inflammatory response in the adult and neonatal lung (11 12 48) Although cytokines

have received most attention prostanoids also have the ability to control acute

inflammation They can produce both pro- and anti-inflammatory actions depending

upon the inflammatory stimulus the major prostanoid produced and profile of prostanoid

receptor expression (47) In contrast to cytokines which production is controlled at the

transcriptional level prostanoids are formed by post-translational processes (See Fig 1)

Thus altered prostanoid production andor release can be a very early response to stress

and may initiate many of the classical signs of ventilation-induced lung inflammation

Several studies have shown that mechanical stress influences the production of

prostanoids in the lung Stretch-induced prostanoid release by lung was first reported in

1969 (14) The mediator was identified as PGE2 and the authors suggested that the

release of PGE2 might contribute to the hemodynamic effects of mechanical ventilation

(7 14) The release of prostanoids appears also to be altered in mechanically ventilated

dogs and sheep (4 6) as well as in rat models of ventilation-induced lung injury (5253)

In vitro physical deformation by gentle scraping or agitation of cultured human

pulmonary endothelial cells has been shown to increase the release of PGI2 (24) Cyclic

stretching of fetal lung cells had a similar effect (42) In addition to lung cells uterine

myometrial cells tendon fibroblasts macrophages and osteoblasts have all been shown to

increase their prostanoid production due to increased mechanical stress (16 25 32 43)

Thus mechanostimulation of prostanoid production andor release may be a conserved

3

Page 3 of 37

event in the evolution of the inflammatory response triggered by mechanical forces The

mechanotransduction pathways leading to increased prostanoid formation upon physical

stimulation remain to be elucidated

Herein we studied the intracellular signaling pathways of stretch-stimulated

prostanoid formation in primary fetal lung cells We report that cyclic stretch causes cell

type- amplitude- and duration-dependent increases in prostanoid production which are

mediated via calcium-dependent PLA2 p4442 mitogen activated protein kinase (MAPK)

and COX-2

4

Page 4 of 37

MATERIALS AND METHODS

Materials - Culture media trypsin antibiotics and fetal bovine serum (FBS) were from

GIBCO BRL (ON Canada) DNase and collagenase were from Worthington (NJ USA)

Bioflex six-well plates (Bioflex Collagen Type I culture plates) were from Flexcell

International (NC USA) SB203580 was from Alexis Biochemical (CA USA) U0126

AACOF3 HELSS and BAPTAAM were from Cedarlane (ON Canada) Ibuprofen

Gadolinium and EGTA were from Sigma Chemical (ON Canada) while SC-560 and

NS-398 were from Calbiochem (ON Canada)

Cell Culture - Female timed-pregnant Wistar rats were obtained from Charles River (St

Constant Quebec) and were housed in the Hospital for Sick Children animal facilities

until used All animal procedures were in accordance with Canadian Council of Animal

Care guidelines and were approved by the Animal Care and Use Committee of the

Hospital for Sick Children Fetal timed pregnant rats and their fetuses were sacrificed at

day 19 of gestation (term=22 days) Rat fetal lung fibroblast and epithelial cells were

isolated as described previously (10) The purity of each cell type was gt90 Within 24

hours of isolation fetal lung cells were harvested from cell culture plates with 025

(wv) trypsin in 04 mM EDTA Fibroblast and epithelial cells were separately inoculated

at a density of 106 cellswell onto 6-well type-1 collagen-coated BioFlex plates Cells

were maintained for 24 hours in MEM + 10 (vv) FBS Four hours prior to the cells

being stretched the medium was changed to MEM + 05 (vv) FBS After 3 hours cells

5

Page 5 of 37

were changed to fresh MEM + 05 (vv) FBS with and without inhibitors incubated for

another hour and then subjected to cyclic stretch or static culture

Mechanical stretch of fetal lung cells The Flexercell Strain Unit FX-4000 (Flexercell

Int NC USA) is a computer driven instrument that simulates biological strain conditions

using vacuum pressure to deform cells cultured on flexible matrix-bonded growth

surfaces An equibiaxial strain across the surface of the membrane is achieved by

applying vacuum underneath which pulls the membrane downward to a pre-programmed

level of elongation while the membrane is positioned over a stationary post This ensures

that the membrane is stretched in a single plane so that a uniform strain is generated in

both the radial and circumferential direction Thus the Flexercell system stretches the

cells by changing the surface area on which the cells are attached and the degree of

stretch relates to the percent change in surface area (ΔSA) Cyclic continuous radial

elongations of 5 10 or 17 were applied at intervals of 30 cycles per min for various

durations Based upon an equation (ΔSA = 00057 (TLC)2 - 02608 (TLC) +

48021) describing the relationship between epithelial basement membrane surface area

and lung volume in isolated rat lungs (49) these stretch regimens equate roughly to

percent changes in epithelial basement membrane surface area seen in vivo at 47 62 and

75 TLC A 5 stretch regimen simulates the stretch amplitude of fetal breathing

movements (FBM) which are intermittent movements ie the fetus spends ~30 of its

time making fetal breathing movements at late gestation Thus fetal lung cells in utero

will be exposed to a 5 stretch but not continuously Neither cell viability (trypan blue

exclusion) nor cell attachment were affected by any of the applied stretch regimens or

6

Page 6 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

event in the evolution of the inflammatory response triggered by mechanical forces The

mechanotransduction pathways leading to increased prostanoid formation upon physical

stimulation remain to be elucidated

Herein we studied the intracellular signaling pathways of stretch-stimulated

prostanoid formation in primary fetal lung cells We report that cyclic stretch causes cell

type- amplitude- and duration-dependent increases in prostanoid production which are

mediated via calcium-dependent PLA2 p4442 mitogen activated protein kinase (MAPK)

and COX-2

4

Page 4 of 37

MATERIALS AND METHODS

Materials - Culture media trypsin antibiotics and fetal bovine serum (FBS) were from

GIBCO BRL (ON Canada) DNase and collagenase were from Worthington (NJ USA)

Bioflex six-well plates (Bioflex Collagen Type I culture plates) were from Flexcell

International (NC USA) SB203580 was from Alexis Biochemical (CA USA) U0126

AACOF3 HELSS and BAPTAAM were from Cedarlane (ON Canada) Ibuprofen

Gadolinium and EGTA were from Sigma Chemical (ON Canada) while SC-560 and

NS-398 were from Calbiochem (ON Canada)

Cell Culture - Female timed-pregnant Wistar rats were obtained from Charles River (St

Constant Quebec) and were housed in the Hospital for Sick Children animal facilities

until used All animal procedures were in accordance with Canadian Council of Animal

Care guidelines and were approved by the Animal Care and Use Committee of the

Hospital for Sick Children Fetal timed pregnant rats and their fetuses were sacrificed at

day 19 of gestation (term=22 days) Rat fetal lung fibroblast and epithelial cells were

isolated as described previously (10) The purity of each cell type was gt90 Within 24

hours of isolation fetal lung cells were harvested from cell culture plates with 025

(wv) trypsin in 04 mM EDTA Fibroblast and epithelial cells were separately inoculated

at a density of 106 cellswell onto 6-well type-1 collagen-coated BioFlex plates Cells

were maintained for 24 hours in MEM + 10 (vv) FBS Four hours prior to the cells

being stretched the medium was changed to MEM + 05 (vv) FBS After 3 hours cells

5

Page 5 of 37

were changed to fresh MEM + 05 (vv) FBS with and without inhibitors incubated for

another hour and then subjected to cyclic stretch or static culture

Mechanical stretch of fetal lung cells The Flexercell Strain Unit FX-4000 (Flexercell

Int NC USA) is a computer driven instrument that simulates biological strain conditions

using vacuum pressure to deform cells cultured on flexible matrix-bonded growth

surfaces An equibiaxial strain across the surface of the membrane is achieved by

applying vacuum underneath which pulls the membrane downward to a pre-programmed

level of elongation while the membrane is positioned over a stationary post This ensures

that the membrane is stretched in a single plane so that a uniform strain is generated in

both the radial and circumferential direction Thus the Flexercell system stretches the

cells by changing the surface area on which the cells are attached and the degree of

stretch relates to the percent change in surface area (ΔSA) Cyclic continuous radial

elongations of 5 10 or 17 were applied at intervals of 30 cycles per min for various

durations Based upon an equation (ΔSA = 00057 (TLC)2 - 02608 (TLC) +

48021) describing the relationship between epithelial basement membrane surface area

and lung volume in isolated rat lungs (49) these stretch regimens equate roughly to

percent changes in epithelial basement membrane surface area seen in vivo at 47 62 and

75 TLC A 5 stretch regimen simulates the stretch amplitude of fetal breathing

movements (FBM) which are intermittent movements ie the fetus spends ~30 of its

time making fetal breathing movements at late gestation Thus fetal lung cells in utero

will be exposed to a 5 stretch but not continuously Neither cell viability (trypan blue

exclusion) nor cell attachment were affected by any of the applied stretch regimens or

6

Page 6 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

MATERIALS AND METHODS

Materials - Culture media trypsin antibiotics and fetal bovine serum (FBS) were from

GIBCO BRL (ON Canada) DNase and collagenase were from Worthington (NJ USA)

Bioflex six-well plates (Bioflex Collagen Type I culture plates) were from Flexcell

International (NC USA) SB203580 was from Alexis Biochemical (CA USA) U0126

AACOF3 HELSS and BAPTAAM were from Cedarlane (ON Canada) Ibuprofen

Gadolinium and EGTA were from Sigma Chemical (ON Canada) while SC-560 and

NS-398 were from Calbiochem (ON Canada)

Cell Culture - Female timed-pregnant Wistar rats were obtained from Charles River (St

Constant Quebec) and were housed in the Hospital for Sick Children animal facilities

until used All animal procedures were in accordance with Canadian Council of Animal

Care guidelines and were approved by the Animal Care and Use Committee of the

Hospital for Sick Children Fetal timed pregnant rats and their fetuses were sacrificed at

day 19 of gestation (term=22 days) Rat fetal lung fibroblast and epithelial cells were

isolated as described previously (10) The purity of each cell type was gt90 Within 24

hours of isolation fetal lung cells were harvested from cell culture plates with 025

(wv) trypsin in 04 mM EDTA Fibroblast and epithelial cells were separately inoculated

at a density of 106 cellswell onto 6-well type-1 collagen-coated BioFlex plates Cells

were maintained for 24 hours in MEM + 10 (vv) FBS Four hours prior to the cells

being stretched the medium was changed to MEM + 05 (vv) FBS After 3 hours cells

5

Page 5 of 37

were changed to fresh MEM + 05 (vv) FBS with and without inhibitors incubated for

another hour and then subjected to cyclic stretch or static culture

Mechanical stretch of fetal lung cells The Flexercell Strain Unit FX-4000 (Flexercell

Int NC USA) is a computer driven instrument that simulates biological strain conditions

using vacuum pressure to deform cells cultured on flexible matrix-bonded growth

surfaces An equibiaxial strain across the surface of the membrane is achieved by

applying vacuum underneath which pulls the membrane downward to a pre-programmed

level of elongation while the membrane is positioned over a stationary post This ensures

that the membrane is stretched in a single plane so that a uniform strain is generated in

both the radial and circumferential direction Thus the Flexercell system stretches the

cells by changing the surface area on which the cells are attached and the degree of

stretch relates to the percent change in surface area (ΔSA) Cyclic continuous radial

elongations of 5 10 or 17 were applied at intervals of 30 cycles per min for various

durations Based upon an equation (ΔSA = 00057 (TLC)2 - 02608 (TLC) +

48021) describing the relationship between epithelial basement membrane surface area

and lung volume in isolated rat lungs (49) these stretch regimens equate roughly to

percent changes in epithelial basement membrane surface area seen in vivo at 47 62 and

75 TLC A 5 stretch regimen simulates the stretch amplitude of fetal breathing

movements (FBM) which are intermittent movements ie the fetus spends ~30 of its

time making fetal breathing movements at late gestation Thus fetal lung cells in utero

will be exposed to a 5 stretch but not continuously Neither cell viability (trypan blue

exclusion) nor cell attachment were affected by any of the applied stretch regimens or

6

Page 6 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

were changed to fresh MEM + 05 (vv) FBS with and without inhibitors incubated for

another hour and then subjected to cyclic stretch or static culture

Mechanical stretch of fetal lung cells The Flexercell Strain Unit FX-4000 (Flexercell

Int NC USA) is a computer driven instrument that simulates biological strain conditions

using vacuum pressure to deform cells cultured on flexible matrix-bonded growth

surfaces An equibiaxial strain across the surface of the membrane is achieved by

applying vacuum underneath which pulls the membrane downward to a pre-programmed

level of elongation while the membrane is positioned over a stationary post This ensures

that the membrane is stretched in a single plane so that a uniform strain is generated in

both the radial and circumferential direction Thus the Flexercell system stretches the

cells by changing the surface area on which the cells are attached and the degree of

stretch relates to the percent change in surface area (ΔSA) Cyclic continuous radial

elongations of 5 10 or 17 were applied at intervals of 30 cycles per min for various

durations Based upon an equation (ΔSA = 00057 (TLC)2 - 02608 (TLC) +

48021) describing the relationship between epithelial basement membrane surface area

and lung volume in isolated rat lungs (49) these stretch regimens equate roughly to

percent changes in epithelial basement membrane surface area seen in vivo at 47 62 and

75 TLC A 5 stretch regimen simulates the stretch amplitude of fetal breathing

movements (FBM) which are intermittent movements ie the fetus spends ~30 of its

time making fetal breathing movements at late gestation Thus fetal lung cells in utero

will be exposed to a 5 stretch but not continuously Neither cell viability (trypan blue

exclusion) nor cell attachment were affected by any of the applied stretch regimens or

6

Page 6 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

inhibitors Higher stretch regimens were not applied as significant cell death was noted

when rat primary alveolar type II cells were subjected to a stretch regimen of 25 (50)

Control cells were grown on the Bioflex collagen I plates treated in the same manner as

stretched cells but were not subjected to stretch

Mass Spectral Analysis of Prostanoids ndash Following exposure to the same duration of

stretch or static culture stable hydrolysis products of prostaglandins leukotrienes and

lipoxins were measured in the cells and culture media using an API4000 triple-

quadrupole mass spectrometer (MDS SCIEX Concord On Canada) in the electrospray

ionization negative-ion mode with TurboIon-Spray Experimental samples were spiked

with 1 ng of a mixture of deuterated analogs of the prostanoids to be measured (Cayman

Chemical Co Ann Arbor MI) acidified to pH 4 with 1 N HCl and extracted three times

with ethyl acetate The ethyl acetate layer washed to neutrality with water was

evaporated to dryness under a stream of nitrogen and transferred to siliconized minivials

for analysis by MSMS Quantitation was carried out by comparing the deuterium-to-

protium ratio of the prostanoids in the sample with standard lines generated from

authentic mixtures of eicosanoids An Agilent HPLC 1100 was at the front end equipped

with a short Zorbax SB-phenyl column (30 x 50 mm 35-microm spherical size

Chromatographic Specialties Inc Brockville Ont) The MS source temperature was

maintained at 500degC and the ion source voltage at 4500 V Compounds were separated

on HPLC with a direct inlet into the MS source HPLC solvents contained 4 microlL

propionic acid HPLC followed the program 8020 (volvol) water-acetonitrile at sample

injection and maintained for 2 min 7525 (volvol) for 05 min 5050 (volvol) by 5 min

7

Page 7 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

4555 (volvol) by 62 min and 0100 (volvol) by 11 min The latter solvent was

maintained for another 15 min prior to being replaced by 8020 (volvol) water-

acetonitrile for the next run The flow rate was at 400 microlmin MSMS parameters were

established through infusion (20 microlmin) of each authentic standard separately The Q1

spectrum was first obtained followed by selection of the M-1 fragment ion and recording

of a Q3 spectrum after collision-induced decomposition (CID) Optimization of the

parameters was carried out either manually or by running the quantitative optimization

program to establish conditions for use in the analysis by the metabolic rate monitor The

CID gas was nitrogen Authentic standards in appropriate dilutions (1 ng deuterated

prostanoids of interest mixed with 10 pg to 1 ng of undeuterated prostanoids) were

prepared and standard concentrations of eicosanoid were analyzed at the same time as the

samples containing unknown amounts of the compound Typically 1 ng of deuterated

standard was added to each unknown sample and 20 (volvol) of the sample was

injected for analysis

RNA preparation - Two million cells (approx 2 wells of a 6-well bioflex plate) were

placed in RLT lysis buffer homogenized and applied to RNA purification columns

according to manufactures instructions (RNeasyreg Qiagen Missassauga ON Canada)

After washing the columns the bound RNA was treated with DNAse I washed and

eluted

Real-time PCR - Total RNA (2 microg) was reverse transcribed in a total volume 50 microL

using random hexamers The Sybrgreen Universal Master Mix was used according to the

8

Page 8 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

manufactureracutes protocol (Applied Biosystems Foster City CA USA) in which 50 ng of

cDNA was amplified for COX-1 and COX-2 while 5 ng cDNA was amplified for 18S

COX-1 (forward primer CCTCACCAGTCATTCCCTGT reversed primer

AGGTGGCATTCACAAACTCC) and COX-2 (forward primer

TACCCGGACTGGATTCTA CG reversed primer AAGTTGGTGGGCTGTCAATC)

specific primers were designed using Primer3 a web based software program (http

frodowimitedu cgi-bin primer3 primer3_wwwcgi) provided by the Whitehead

Institute (36) 18S primers were purchased from Applied Biosystems (Applied

Biosystems Foster City CA USA) At the end of the PCR reaction a melting curve

(disassociation curve) was run to ensure that only a single specific product was amplified

Relative mRNA Quantitation - For each probe a dilution series determined the efficiency

of amplification of each primerprobe set allowing the relative quantification method to

be employed (31) For relative quantization PCR signals were compared between groups

after normalization using 18S as an internal reference Fold change was calculated

according to Livak et al (31)

Graphical and Statistical Analysis - All data are presented as fold change compared to

static control cultures (medium collected at the same time as that of the stretch

condition) All values are shown as means plusmn SEM of at least 3 separate experiments

One-way analysis of variance was used to determine statistical significance (plt005)

followed by post hoc analysis using Duncanrsquos multiple comparison test (JMPreg statistical

software)

9

Page 9 of 37

RESULTS

Stretch induces prostanoid releaseproduction by fetal lung epithelial cells - Initially

we tested both fetal lung epithelial cells and fibroblasts for their prostanoid responses to

cyclic stretch Under static conditions both cell types released measurable levels of

eicosanoids with 12-HETE being the most abundant prostanoid and PGF2α the least

(Table 1) A 30-minutes cyclic stretch (17 change in surface area) significantly

increased the prostaglandin content in the media of fetal lung epithelial cells specifically

that of PGI2 (measured as 6-keto PGF1α) PGF2α PGD2 and PGE2 (Fig 2a) TXB2 levels

were also increased after a 30-minute cyclic stretch however the increase was far more

modest than those of PGI2 PGF2α PGD2 and PGE2 (Fig 2a) A 180-minute cyclic

stretch revealed further increases in the media content of PGI2 PGF2α PGD2 PGE2 (Fig

2a) Cyclic stretch of fetal lung epithelial cells did not alter the media levels of LTB4 or

12-HETE (Fig 2a) In contrast to fetal lung epithelial cells cyclic stretch did not alter

the prostaglandin amount in the media of fetal lung fibroblasts (Fig 2b) Cyclic stretch

caused a small but significant decrease in TXB2 and 12-HETE in the media of fetal lung

fibroblasts (Fig 2b) Additional experiments established that stretch of fetal lung

epithelial cells also increased the intracellular content of prostaglandins which mimicked

the changes seen in the media (data not shown) Based on these results all further

experiments focused on fetal lung epithelial cells and prostaglandins (ie PGI2 PGF2α

PGD2 and PGE2) in the media of these cells Temporally significant increases in PG

content in the media were already discernible after 10 minutes of cyclic stretch and PG

10

Page 10 of 37

content further increased with duration of stretch (Fig 3a) Increased levels of free

arachidonic acid (AA) were also evident 10 minutes after the initiation of cyclic stretch

and like PGI2 PGF2α PGD2 and PGE2 the AA levels increased progressively with

duration of stretch (Fig 3a) In addition to a time-dependent response we also found that

the PG response to cyclic stretch was amplitude-dependent Using a variety of stretch

amplitudes we found that a 5 cyclic stretch for 30 min was sufficient to increase both

PG (ie PGI2 PGF2α PGD2 and PGE2) and AA content in the media of epithelial cells

The PG (ie PGI2 PGF2α PGD2 and PGE2) and AA content were further elevated with

greater degrees of stretch (Fig 3b)

Inhibition of phospholipase A2 abolishes stretch-induced prostaglandin

releaseproduction - Cyclic stretch altered the levels of free archidonic acid in the media

(Fig 3a) and in the cells (not shown) the primary substrate required for PG synthesis

Generally the cell increases the levels of AA by the action of cytosolic phospholipases

(cPLA2) (19 30) To investigate the role of cPLA2 in cyclic stretch-induced AA and PG

production fetal lung epithelial cells were pretreated with inhibitors of cPLA2 activity

prior to exposure to cyclic stretch AACOCF3 specifically inhibits the Ca2+-dependent

cPLA2 isoform whereas HELSS is a specific inhibitor for the Ca2+-independent PLA2

isoform (1 3 5 26) With the exception of PGF2α only inhibition of the Ca2+-dependent

cPLA2 isoform attenuated the cyclic stretch-induced content of PGs in the media (Fig

4a) implying a prominent regulatory role for calcium in stretch-induced PG production

To further clarify the role of calcium we applied either the extracellular calcium chelator

EGTA the intracellular calcium chelator BAPTAAM or the stretch-activated calcium

11

Page 11 of 37

channel blocker gadolinium (Gd3+) to the cells and subjected them to cyclic stretch for 30

minutes BAPTAAM significantly reduced the stretch-induced increase of PGs in the

media however the effect was more robust with EGTA (Fig 4b) The removal of

extracellular calcium by EGTA reduced the stretch-induced increase of PGI2 by 91

PGE2 by 95 PGD2 by 91 and PGF2α by 86 while chelating of intracellular calcium

with BAPTAAM reduced the stretch-induced increase of PGI2 by 55 PGE2 by 66

PGD2 by 65 and PGF2α by 29 (Fig 4b) Only EGTA completely abolished the cyclic

stretch-induced release of free AA (Fig 4c) Thus it appears that an influx of

extracellular calcium and subsequent activation of a calcium-dependent cPLA2 are

requirements for the mechanoproduction of PG in fetal lung epithelial cells Interestingly

the calcium influx was independent of gadolinium-sensitive stretch-activated ion

channels (Fig 4bc)

Effect of p4244MAPK and p38 MAPK inhibition on stretch-induced prostaglandin

releaseproduction - Besides an increase in intracellular calcium necessary for cPLA2

translocation to membranes full enzymatic activation of cPLA2 also requires its

phosphorylation (1930) Mitogen activated protein kinases (MAPK) in particular

p4442MAPK have been shown to phosphorylate and activate cPLA2 (1930) In

addition cyclic stretch has been reported to activate p38MAPK and p4442MAPK in

lung epithelial cells (13 35) Using relative specific inhibitors for p4442MAPK (U0106)

and p38MAPK (SB203580) we found that p4442MAPK but not p38MAPK inhibition

resulted in a significant reduction of the stretch-induced increase of PGs in the media

12

Page 12 of 37

(Fig 5a) Inhibition of p4442MAPK also reduced the free AA levels (Fig 5b) in

agreement with a reduction in cPLA2 activity

Inhibition of cyclooxygenase activity blocks stretch-induced prostaglandin

releaseproduction - Once AA is released from cell membrane phospholipids it is

converted to prostaglandin H2 by the action of cyclooxygenase There are three isoforms

of cyclooxygenase COX 1-3 (41) Since COX-3 is only found in neuronal cells we

focused on the actions of the constitutively expressed COX-1 isoform and the inducible

isoform COX-2 Initially using ibuprofen a non-selective cyclooxygenase inhibitor we

determined that the stretch-induced increase of PGs in the media of fetal lung epithelial

cells was indeed due to de novo PG synthesis and not just the release of pre-formed PGs

Ibuprofen had a dose-dependent inhibitory effect on stretch-induced PG formation (Fig

6a) while it did not alter AA (Fig 6a) LTB4 (not shown) or 12-HETE levels (not

shown) Using COX-1 (SC-560) and COX-2 (NS-398) specific inhibitors we found that

inhibition of COX-2 but not COX-1 activity abolished the stretch-induced increase in

media PGs but did not affect AA formation (Fig 6b) In addition we demonstrated that

both COX-1 and COX-2 mRNAs are present in resting lung epithelial cells (Fig 6c)

Upon cyclic stretch epithelial fetal lung cells responded by increasing COX-2 mRNA

expression while slightly decreasing COX-1 message levels

13

Page 13 of 37

DISCUSSION

Recently it has become evident that the systemic response to overwhelming infection

ischemia-reperfusion injury or tissue damage involves an uncontrolled expression of the

inflammatory response This results in the development of the systemic inflammatory

response syndrome which can result in multiple organ dysfunction syndrome These

syndromes involve both the activation of inflammatory cells and the production of

multiple pro and anti-inflammatory mediators These mediators can act both locally and

systemically to enhance perpetuate or reduceresolve the inflammatory cascade Among

these mediators are prostanoids derived from membrane phospholipids (Fig 1) The

present study demonstrates that lung epithelial cells can significantly influence the

inflammatory response when exposed to overt levels of cyclic stretch or ventilation by

increasing prostaglandin and thromboxane formation In particular we found that the

mechanotransduction machinery necessary to increase prostaglandin synthesis is present

in fetal lung epithelial cells but not fetal lung fibroblasts and that the prostaglandin

response to stretch is triggered by an increase in calcium influx from the extracellular

milieu and requires the combined action of calcium-dependent cPLA2 p4442MAPK and

COX-2 for maximal response

Previous studies have reported that stretch increased PGI2 release in mixed fetal

lung cells (42) and PGE2 levels in the whole lung (7 14) In the present study we used

mass spectral analysis coupled with liquid chromatography to gain a better understanding

of the overall effect of mechanical stretch on eicosanoid metabolism We confirmed that

cyclic stretch increased PGI2 and PGE2 formation by fetal lung epithelial cells However

14

Page 14 of 37

we show for the first time that cyclic stretch also increases the release of PGD2 and

PGF2α by fetal lung epithelial cells while not affecting 8-isoprostane leukotriene or 12-

HETE formation Within the lung both prostaglandin PGE2 and PGI2 can act on the

endothelium to promote edema formation (47) a characteristic feature of volutrauma-

induced lung injury (55) However PGI2 has also been shown to have beneficial

hemodynamics (59) as well as anti-inflammatory effects (9) Thromboxane can also

promotes edema formation in the lung (40) and has the ability to increase platelet and

neutrophil aggregation as well as leukocyte adhesion (44) PGD2 on the other hand

may act as a chemotactic factor for leukocytes (22) or through its dehydration end

product PGJ2 act as an endogenous ligand for the transcription factor PPARγ thereby

evoking an anti-inflammatory response (39) The exact role of PGF2α in inflammation is

unknown but it may induce receptor-mediated increases in cAMP and intracellular

calcium in inflammatory cells and as such trigger a pro-inflammatory response (47)

In addition to an increase in extracellular prostanoids cyclic stretch of fetal lung

epithelial cells also increased extracellular arachidonic acid levels which by itself can act

as a second messenger and modulates a number of cellular functions independent of

prostanoids (20 29) Furthermore we clearly demonstrate that the increase of these

mediators in the media upon stretch is the result of de novo synthesis and not just the

release of endogenous pools In contrast to epithelial cells cyclic stretch of fetal lung

fibroblasts had either no effect or resulted in a small reduction of TBX2 and 12-Hete in

the media The reductions in media TXB2 and 12-Hete content may be due to either an

increased release of prostanoid catabolizing enzymes (46) or an enhanced uptake of

TBX2 and 12-Hete through receptor mediated endocytosis (21 45) In the lung the

15

Page 15 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

content further increased with duration of stretch (Fig 3a) Increased levels of free

arachidonic acid (AA) were also evident 10 minutes after the initiation of cyclic stretch

and like PGI2 PGF2α PGD2 and PGE2 the AA levels increased progressively with

duration of stretch (Fig 3a) In addition to a time-dependent response we also found that

the PG response to cyclic stretch was amplitude-dependent Using a variety of stretch

amplitudes we found that a 5 cyclic stretch for 30 min was sufficient to increase both

PG (ie PGI2 PGF2α PGD2 and PGE2) and AA content in the media of epithelial cells

The PG (ie PGI2 PGF2α PGD2 and PGE2) and AA content were further elevated with

greater degrees of stretch (Fig 3b)

Inhibition of phospholipase A2 abolishes stretch-induced prostaglandin

releaseproduction - Cyclic stretch altered the levels of free archidonic acid in the media

(Fig 3a) and in the cells (not shown) the primary substrate required for PG synthesis

Generally the cell increases the levels of AA by the action of cytosolic phospholipases

(cPLA2) (19 30) To investigate the role of cPLA2 in cyclic stretch-induced AA and PG

production fetal lung epithelial cells were pretreated with inhibitors of cPLA2 activity

prior to exposure to cyclic stretch AACOCF3 specifically inhibits the Ca2+-dependent

cPLA2 isoform whereas HELSS is a specific inhibitor for the Ca2+-independent PLA2

isoform (1 3 5 26) With the exception of PGF2α only inhibition of the Ca2+-dependent

cPLA2 isoform attenuated the cyclic stretch-induced content of PGs in the media (Fig

4a) implying a prominent regulatory role for calcium in stretch-induced PG production

To further clarify the role of calcium we applied either the extracellular calcium chelator

EGTA the intracellular calcium chelator BAPTAAM or the stretch-activated calcium

11

Page 11 of 37

channel blocker gadolinium (Gd3+) to the cells and subjected them to cyclic stretch for 30

minutes BAPTAAM significantly reduced the stretch-induced increase of PGs in the

media however the effect was more robust with EGTA (Fig 4b) The removal of

extracellular calcium by EGTA reduced the stretch-induced increase of PGI2 by 91

PGE2 by 95 PGD2 by 91 and PGF2α by 86 while chelating of intracellular calcium

with BAPTAAM reduced the stretch-induced increase of PGI2 by 55 PGE2 by 66

PGD2 by 65 and PGF2α by 29 (Fig 4b) Only EGTA completely abolished the cyclic

stretch-induced release of free AA (Fig 4c) Thus it appears that an influx of

extracellular calcium and subsequent activation of a calcium-dependent cPLA2 are

requirements for the mechanoproduction of PG in fetal lung epithelial cells Interestingly

the calcium influx was independent of gadolinium-sensitive stretch-activated ion

channels (Fig 4bc)

Effect of p4244MAPK and p38 MAPK inhibition on stretch-induced prostaglandin

releaseproduction - Besides an increase in intracellular calcium necessary for cPLA2

translocation to membranes full enzymatic activation of cPLA2 also requires its

phosphorylation (1930) Mitogen activated protein kinases (MAPK) in particular

p4442MAPK have been shown to phosphorylate and activate cPLA2 (1930) In

addition cyclic stretch has been reported to activate p38MAPK and p4442MAPK in

lung epithelial cells (13 35) Using relative specific inhibitors for p4442MAPK (U0106)

and p38MAPK (SB203580) we found that p4442MAPK but not p38MAPK inhibition

resulted in a significant reduction of the stretch-induced increase of PGs in the media

12

Page 12 of 37

(Fig 5a) Inhibition of p4442MAPK also reduced the free AA levels (Fig 5b) in

agreement with a reduction in cPLA2 activity

Inhibition of cyclooxygenase activity blocks stretch-induced prostaglandin

releaseproduction - Once AA is released from cell membrane phospholipids it is

converted to prostaglandin H2 by the action of cyclooxygenase There are three isoforms

of cyclooxygenase COX 1-3 (41) Since COX-3 is only found in neuronal cells we

focused on the actions of the constitutively expressed COX-1 isoform and the inducible

isoform COX-2 Initially using ibuprofen a non-selective cyclooxygenase inhibitor we

determined that the stretch-induced increase of PGs in the media of fetal lung epithelial

cells was indeed due to de novo PG synthesis and not just the release of pre-formed PGs

Ibuprofen had a dose-dependent inhibitory effect on stretch-induced PG formation (Fig

6a) while it did not alter AA (Fig 6a) LTB4 (not shown) or 12-HETE levels (not

shown) Using COX-1 (SC-560) and COX-2 (NS-398) specific inhibitors we found that

inhibition of COX-2 but not COX-1 activity abolished the stretch-induced increase in

media PGs but did not affect AA formation (Fig 6b) In addition we demonstrated that

both COX-1 and COX-2 mRNAs are present in resting lung epithelial cells (Fig 6c)

Upon cyclic stretch epithelial fetal lung cells responded by increasing COX-2 mRNA

expression while slightly decreasing COX-1 message levels

13

Page 13 of 37

DISCUSSION

Recently it has become evident that the systemic response to overwhelming infection

ischemia-reperfusion injury or tissue damage involves an uncontrolled expression of the

inflammatory response This results in the development of the systemic inflammatory

response syndrome which can result in multiple organ dysfunction syndrome These

syndromes involve both the activation of inflammatory cells and the production of

multiple pro and anti-inflammatory mediators These mediators can act both locally and

systemically to enhance perpetuate or reduceresolve the inflammatory cascade Among

these mediators are prostanoids derived from membrane phospholipids (Fig 1) The

present study demonstrates that lung epithelial cells can significantly influence the

inflammatory response when exposed to overt levels of cyclic stretch or ventilation by

increasing prostaglandin and thromboxane formation In particular we found that the

mechanotransduction machinery necessary to increase prostaglandin synthesis is present

in fetal lung epithelial cells but not fetal lung fibroblasts and that the prostaglandin

response to stretch is triggered by an increase in calcium influx from the extracellular

milieu and requires the combined action of calcium-dependent cPLA2 p4442MAPK and

COX-2 for maximal response

Previous studies have reported that stretch increased PGI2 release in mixed fetal

lung cells (42) and PGE2 levels in the whole lung (7 14) In the present study we used

mass spectral analysis coupled with liquid chromatography to gain a better understanding

of the overall effect of mechanical stretch on eicosanoid metabolism We confirmed that

cyclic stretch increased PGI2 and PGE2 formation by fetal lung epithelial cells However

14

Page 14 of 37

we show for the first time that cyclic stretch also increases the release of PGD2 and

PGF2α by fetal lung epithelial cells while not affecting 8-isoprostane leukotriene or 12-

HETE formation Within the lung both prostaglandin PGE2 and PGI2 can act on the

endothelium to promote edema formation (47) a characteristic feature of volutrauma-

induced lung injury (55) However PGI2 has also been shown to have beneficial

hemodynamics (59) as well as anti-inflammatory effects (9) Thromboxane can also

promotes edema formation in the lung (40) and has the ability to increase platelet and

neutrophil aggregation as well as leukocyte adhesion (44) PGD2 on the other hand

may act as a chemotactic factor for leukocytes (22) or through its dehydration end

product PGJ2 act as an endogenous ligand for the transcription factor PPARγ thereby

evoking an anti-inflammatory response (39) The exact role of PGF2α in inflammation is

unknown but it may induce receptor-mediated increases in cAMP and intracellular

calcium in inflammatory cells and as such trigger a pro-inflammatory response (47)

In addition to an increase in extracellular prostanoids cyclic stretch of fetal lung

epithelial cells also increased extracellular arachidonic acid levels which by itself can act

as a second messenger and modulates a number of cellular functions independent of

prostanoids (20 29) Furthermore we clearly demonstrate that the increase of these

mediators in the media upon stretch is the result of de novo synthesis and not just the

release of endogenous pools In contrast to epithelial cells cyclic stretch of fetal lung

fibroblasts had either no effect or resulted in a small reduction of TBX2 and 12-Hete in

the media The reductions in media TXB2 and 12-Hete content may be due to either an

increased release of prostanoid catabolizing enzymes (46) or an enhanced uptake of

TBX2 and 12-Hete through receptor mediated endocytosis (21 45) In the lung the

15

Page 15 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

channel blocker gadolinium (Gd3+) to the cells and subjected them to cyclic stretch for 30

minutes BAPTAAM significantly reduced the stretch-induced increase of PGs in the

media however the effect was more robust with EGTA (Fig 4b) The removal of

extracellular calcium by EGTA reduced the stretch-induced increase of PGI2 by 91

PGE2 by 95 PGD2 by 91 and PGF2α by 86 while chelating of intracellular calcium

with BAPTAAM reduced the stretch-induced increase of PGI2 by 55 PGE2 by 66

PGD2 by 65 and PGF2α by 29 (Fig 4b) Only EGTA completely abolished the cyclic

stretch-induced release of free AA (Fig 4c) Thus it appears that an influx of

extracellular calcium and subsequent activation of a calcium-dependent cPLA2 are

requirements for the mechanoproduction of PG in fetal lung epithelial cells Interestingly

the calcium influx was independent of gadolinium-sensitive stretch-activated ion

channels (Fig 4bc)

Effect of p4244MAPK and p38 MAPK inhibition on stretch-induced prostaglandin

releaseproduction - Besides an increase in intracellular calcium necessary for cPLA2

translocation to membranes full enzymatic activation of cPLA2 also requires its

phosphorylation (1930) Mitogen activated protein kinases (MAPK) in particular

p4442MAPK have been shown to phosphorylate and activate cPLA2 (1930) In

addition cyclic stretch has been reported to activate p38MAPK and p4442MAPK in

lung epithelial cells (13 35) Using relative specific inhibitors for p4442MAPK (U0106)

and p38MAPK (SB203580) we found that p4442MAPK but not p38MAPK inhibition

resulted in a significant reduction of the stretch-induced increase of PGs in the media

12

Page 12 of 37

(Fig 5a) Inhibition of p4442MAPK also reduced the free AA levels (Fig 5b) in

agreement with a reduction in cPLA2 activity

Inhibition of cyclooxygenase activity blocks stretch-induced prostaglandin

releaseproduction - Once AA is released from cell membrane phospholipids it is

converted to prostaglandin H2 by the action of cyclooxygenase There are three isoforms

of cyclooxygenase COX 1-3 (41) Since COX-3 is only found in neuronal cells we

focused on the actions of the constitutively expressed COX-1 isoform and the inducible

isoform COX-2 Initially using ibuprofen a non-selective cyclooxygenase inhibitor we

determined that the stretch-induced increase of PGs in the media of fetal lung epithelial

cells was indeed due to de novo PG synthesis and not just the release of pre-formed PGs

Ibuprofen had a dose-dependent inhibitory effect on stretch-induced PG formation (Fig

6a) while it did not alter AA (Fig 6a) LTB4 (not shown) or 12-HETE levels (not

shown) Using COX-1 (SC-560) and COX-2 (NS-398) specific inhibitors we found that

inhibition of COX-2 but not COX-1 activity abolished the stretch-induced increase in

media PGs but did not affect AA formation (Fig 6b) In addition we demonstrated that

both COX-1 and COX-2 mRNAs are present in resting lung epithelial cells (Fig 6c)

Upon cyclic stretch epithelial fetal lung cells responded by increasing COX-2 mRNA

expression while slightly decreasing COX-1 message levels

13

Page 13 of 37

DISCUSSION

Recently it has become evident that the systemic response to overwhelming infection

ischemia-reperfusion injury or tissue damage involves an uncontrolled expression of the

inflammatory response This results in the development of the systemic inflammatory

response syndrome which can result in multiple organ dysfunction syndrome These

syndromes involve both the activation of inflammatory cells and the production of

multiple pro and anti-inflammatory mediators These mediators can act both locally and

systemically to enhance perpetuate or reduceresolve the inflammatory cascade Among

these mediators are prostanoids derived from membrane phospholipids (Fig 1) The

present study demonstrates that lung epithelial cells can significantly influence the

inflammatory response when exposed to overt levels of cyclic stretch or ventilation by

increasing prostaglandin and thromboxane formation In particular we found that the

mechanotransduction machinery necessary to increase prostaglandin synthesis is present

in fetal lung epithelial cells but not fetal lung fibroblasts and that the prostaglandin

response to stretch is triggered by an increase in calcium influx from the extracellular

milieu and requires the combined action of calcium-dependent cPLA2 p4442MAPK and

COX-2 for maximal response

Previous studies have reported that stretch increased PGI2 release in mixed fetal

lung cells (42) and PGE2 levels in the whole lung (7 14) In the present study we used

mass spectral analysis coupled with liquid chromatography to gain a better understanding

of the overall effect of mechanical stretch on eicosanoid metabolism We confirmed that

cyclic stretch increased PGI2 and PGE2 formation by fetal lung epithelial cells However

14

Page 14 of 37

we show for the first time that cyclic stretch also increases the release of PGD2 and

PGF2α by fetal lung epithelial cells while not affecting 8-isoprostane leukotriene or 12-

HETE formation Within the lung both prostaglandin PGE2 and PGI2 can act on the

endothelium to promote edema formation (47) a characteristic feature of volutrauma-

induced lung injury (55) However PGI2 has also been shown to have beneficial

hemodynamics (59) as well as anti-inflammatory effects (9) Thromboxane can also

promotes edema formation in the lung (40) and has the ability to increase platelet and

neutrophil aggregation as well as leukocyte adhesion (44) PGD2 on the other hand

may act as a chemotactic factor for leukocytes (22) or through its dehydration end

product PGJ2 act as an endogenous ligand for the transcription factor PPARγ thereby

evoking an anti-inflammatory response (39) The exact role of PGF2α in inflammation is

unknown but it may induce receptor-mediated increases in cAMP and intracellular

calcium in inflammatory cells and as such trigger a pro-inflammatory response (47)

In addition to an increase in extracellular prostanoids cyclic stretch of fetal lung

epithelial cells also increased extracellular arachidonic acid levels which by itself can act

as a second messenger and modulates a number of cellular functions independent of

prostanoids (20 29) Furthermore we clearly demonstrate that the increase of these

mediators in the media upon stretch is the result of de novo synthesis and not just the

release of endogenous pools In contrast to epithelial cells cyclic stretch of fetal lung

fibroblasts had either no effect or resulted in a small reduction of TBX2 and 12-Hete in

the media The reductions in media TXB2 and 12-Hete content may be due to either an

increased release of prostanoid catabolizing enzymes (46) or an enhanced uptake of

TBX2 and 12-Hete through receptor mediated endocytosis (21 45) In the lung the

15

Page 15 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

(Fig 5a) Inhibition of p4442MAPK also reduced the free AA levels (Fig 5b) in

agreement with a reduction in cPLA2 activity

Inhibition of cyclooxygenase activity blocks stretch-induced prostaglandin

releaseproduction - Once AA is released from cell membrane phospholipids it is

converted to prostaglandin H2 by the action of cyclooxygenase There are three isoforms

of cyclooxygenase COX 1-3 (41) Since COX-3 is only found in neuronal cells we

focused on the actions of the constitutively expressed COX-1 isoform and the inducible

isoform COX-2 Initially using ibuprofen a non-selective cyclooxygenase inhibitor we

determined that the stretch-induced increase of PGs in the media of fetal lung epithelial

cells was indeed due to de novo PG synthesis and not just the release of pre-formed PGs

Ibuprofen had a dose-dependent inhibitory effect on stretch-induced PG formation (Fig

6a) while it did not alter AA (Fig 6a) LTB4 (not shown) or 12-HETE levels (not

shown) Using COX-1 (SC-560) and COX-2 (NS-398) specific inhibitors we found that

inhibition of COX-2 but not COX-1 activity abolished the stretch-induced increase in

media PGs but did not affect AA formation (Fig 6b) In addition we demonstrated that

both COX-1 and COX-2 mRNAs are present in resting lung epithelial cells (Fig 6c)

Upon cyclic stretch epithelial fetal lung cells responded by increasing COX-2 mRNA

expression while slightly decreasing COX-1 message levels

13

Page 13 of 37

DISCUSSION

Recently it has become evident that the systemic response to overwhelming infection

ischemia-reperfusion injury or tissue damage involves an uncontrolled expression of the

inflammatory response This results in the development of the systemic inflammatory

response syndrome which can result in multiple organ dysfunction syndrome These

syndromes involve both the activation of inflammatory cells and the production of

multiple pro and anti-inflammatory mediators These mediators can act both locally and

systemically to enhance perpetuate or reduceresolve the inflammatory cascade Among

these mediators are prostanoids derived from membrane phospholipids (Fig 1) The

present study demonstrates that lung epithelial cells can significantly influence the

inflammatory response when exposed to overt levels of cyclic stretch or ventilation by

increasing prostaglandin and thromboxane formation In particular we found that the

mechanotransduction machinery necessary to increase prostaglandin synthesis is present

in fetal lung epithelial cells but not fetal lung fibroblasts and that the prostaglandin

response to stretch is triggered by an increase in calcium influx from the extracellular

milieu and requires the combined action of calcium-dependent cPLA2 p4442MAPK and

COX-2 for maximal response

Previous studies have reported that stretch increased PGI2 release in mixed fetal

lung cells (42) and PGE2 levels in the whole lung (7 14) In the present study we used

mass spectral analysis coupled with liquid chromatography to gain a better understanding

of the overall effect of mechanical stretch on eicosanoid metabolism We confirmed that

cyclic stretch increased PGI2 and PGE2 formation by fetal lung epithelial cells However

14

Page 14 of 37

we show for the first time that cyclic stretch also increases the release of PGD2 and

PGF2α by fetal lung epithelial cells while not affecting 8-isoprostane leukotriene or 12-

HETE formation Within the lung both prostaglandin PGE2 and PGI2 can act on the

endothelium to promote edema formation (47) a characteristic feature of volutrauma-

induced lung injury (55) However PGI2 has also been shown to have beneficial

hemodynamics (59) as well as anti-inflammatory effects (9) Thromboxane can also

promotes edema formation in the lung (40) and has the ability to increase platelet and

neutrophil aggregation as well as leukocyte adhesion (44) PGD2 on the other hand

may act as a chemotactic factor for leukocytes (22) or through its dehydration end

product PGJ2 act as an endogenous ligand for the transcription factor PPARγ thereby

evoking an anti-inflammatory response (39) The exact role of PGF2α in inflammation is

unknown but it may induce receptor-mediated increases in cAMP and intracellular

calcium in inflammatory cells and as such trigger a pro-inflammatory response (47)

In addition to an increase in extracellular prostanoids cyclic stretch of fetal lung

epithelial cells also increased extracellular arachidonic acid levels which by itself can act

as a second messenger and modulates a number of cellular functions independent of

prostanoids (20 29) Furthermore we clearly demonstrate that the increase of these

mediators in the media upon stretch is the result of de novo synthesis and not just the

release of endogenous pools In contrast to epithelial cells cyclic stretch of fetal lung

fibroblasts had either no effect or resulted in a small reduction of TBX2 and 12-Hete in

the media The reductions in media TXB2 and 12-Hete content may be due to either an

increased release of prostanoid catabolizing enzymes (46) or an enhanced uptake of

TBX2 and 12-Hete through receptor mediated endocytosis (21 45) In the lung the

15

Page 15 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

DISCUSSION

Recently it has become evident that the systemic response to overwhelming infection

ischemia-reperfusion injury or tissue damage involves an uncontrolled expression of the

inflammatory response This results in the development of the systemic inflammatory

response syndrome which can result in multiple organ dysfunction syndrome These

syndromes involve both the activation of inflammatory cells and the production of

multiple pro and anti-inflammatory mediators These mediators can act both locally and

systemically to enhance perpetuate or reduceresolve the inflammatory cascade Among

these mediators are prostanoids derived from membrane phospholipids (Fig 1) The

present study demonstrates that lung epithelial cells can significantly influence the

inflammatory response when exposed to overt levels of cyclic stretch or ventilation by

increasing prostaglandin and thromboxane formation In particular we found that the

mechanotransduction machinery necessary to increase prostaglandin synthesis is present

in fetal lung epithelial cells but not fetal lung fibroblasts and that the prostaglandin

response to stretch is triggered by an increase in calcium influx from the extracellular

milieu and requires the combined action of calcium-dependent cPLA2 p4442MAPK and

COX-2 for maximal response

Previous studies have reported that stretch increased PGI2 release in mixed fetal

lung cells (42) and PGE2 levels in the whole lung (7 14) In the present study we used

mass spectral analysis coupled with liquid chromatography to gain a better understanding

of the overall effect of mechanical stretch on eicosanoid metabolism We confirmed that

cyclic stretch increased PGI2 and PGE2 formation by fetal lung epithelial cells However

14

Page 14 of 37

we show for the first time that cyclic stretch also increases the release of PGD2 and

PGF2α by fetal lung epithelial cells while not affecting 8-isoprostane leukotriene or 12-

HETE formation Within the lung both prostaglandin PGE2 and PGI2 can act on the

endothelium to promote edema formation (47) a characteristic feature of volutrauma-

induced lung injury (55) However PGI2 has also been shown to have beneficial

hemodynamics (59) as well as anti-inflammatory effects (9) Thromboxane can also

promotes edema formation in the lung (40) and has the ability to increase platelet and

neutrophil aggregation as well as leukocyte adhesion (44) PGD2 on the other hand

may act as a chemotactic factor for leukocytes (22) or through its dehydration end

product PGJ2 act as an endogenous ligand for the transcription factor PPARγ thereby

evoking an anti-inflammatory response (39) The exact role of PGF2α in inflammation is

unknown but it may induce receptor-mediated increases in cAMP and intracellular

calcium in inflammatory cells and as such trigger a pro-inflammatory response (47)

In addition to an increase in extracellular prostanoids cyclic stretch of fetal lung

epithelial cells also increased extracellular arachidonic acid levels which by itself can act

as a second messenger and modulates a number of cellular functions independent of

prostanoids (20 29) Furthermore we clearly demonstrate that the increase of these

mediators in the media upon stretch is the result of de novo synthesis and not just the

release of endogenous pools In contrast to epithelial cells cyclic stretch of fetal lung

fibroblasts had either no effect or resulted in a small reduction of TBX2 and 12-Hete in

the media The reductions in media TXB2 and 12-Hete content may be due to either an

increased release of prostanoid catabolizing enzymes (46) or an enhanced uptake of

TBX2 and 12-Hete through receptor mediated endocytosis (21 45) In the lung the

15

Page 15 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

we show for the first time that cyclic stretch also increases the release of PGD2 and

PGF2α by fetal lung epithelial cells while not affecting 8-isoprostane leukotriene or 12-

HETE formation Within the lung both prostaglandin PGE2 and PGI2 can act on the

endothelium to promote edema formation (47) a characteristic feature of volutrauma-

induced lung injury (55) However PGI2 has also been shown to have beneficial

hemodynamics (59) as well as anti-inflammatory effects (9) Thromboxane can also

promotes edema formation in the lung (40) and has the ability to increase platelet and

neutrophil aggregation as well as leukocyte adhesion (44) PGD2 on the other hand

may act as a chemotactic factor for leukocytes (22) or through its dehydration end

product PGJ2 act as an endogenous ligand for the transcription factor PPARγ thereby

evoking an anti-inflammatory response (39) The exact role of PGF2α in inflammation is

unknown but it may induce receptor-mediated increases in cAMP and intracellular

calcium in inflammatory cells and as such trigger a pro-inflammatory response (47)

In addition to an increase in extracellular prostanoids cyclic stretch of fetal lung

epithelial cells also increased extracellular arachidonic acid levels which by itself can act

as a second messenger and modulates a number of cellular functions independent of

prostanoids (20 29) Furthermore we clearly demonstrate that the increase of these

mediators in the media upon stretch is the result of de novo synthesis and not just the

release of endogenous pools In contrast to epithelial cells cyclic stretch of fetal lung

fibroblasts had either no effect or resulted in a small reduction of TBX2 and 12-Hete in

the media The reductions in media TXB2 and 12-Hete content may be due to either an

increased release of prostanoid catabolizing enzymes (46) or an enhanced uptake of

TBX2 and 12-Hete through receptor mediated endocytosis (21 45) In the lung the

15

Page 15 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

prostanoid mechanoresponse to cyclic stretch is cell-type dependent Supporting this

contention several reports have found that the mechanoproduction of prostaglandins is

cell-type dependent Gentle scraping or agitation of cultured human pulmonary

endothelial cells has been shown to increase the release of PGI2 (24) In contrast

mechanical stimulation of human and feline airway epithelial cells resulted in an decrease

in the synthesis of prostaglandins (37) Biologically these findings imply that there are

fundamental differences in the mechanomachinery of cells from different origins Our

present data show that the lung epithelial prostaglandin response to stretch is extremely

rapid and sensitive Thus the mechanoproduction of prostaglandins by lung epithelial

cells may be a rapid initial response to altered mechanical stress and these lipid mediators

could amplify the inflammatory response associated with bronchopulmonary dysplasia

and acute respiratory distress syndrome

When the inflammatory cascade is activated phospholipases A2 are often

involved Stimulation of PLA2 activity has been demonstrated in response to

inflammatory mediators like platelet activating factor (PAF) tumor necrosis factor

(TNF)α and interleukin (IL)-1β (17) Several in vitro studies have shown that

mechanical stress activates PLA2 in a variety of cells (2 34 51) High tidal volume

ventilation is a well known initiator of the inflammatory cascade in the lung (11 12 23

48) A recent study has shown that inhibition of PLA2 activation reduces the high tidal

volume-induced lung injury in mice (57) In the present study we found that PLA2 was a

key regulator of stretch-induced prostaglandin synthesis in the lung epithelium Thus we

speculate that the reported protective effect on ventilator-induced lung injury by

inhibition of cPLA2 (57) is due to a reduction in prostaglandin formation

16

Page 16 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

Mammalian cells contain structurally diverse forms of PLA2 including secretory

PLA2 (sPLA2) calcium-independent PLA2 and cytosolic PLA2 (cPLA2) Cytosolic PLA2

is ubiquitously expressed and is regulated by micromolar concentrations of Ca2+ and

reversible phosphorylation (30) Herein we show that stretch-induced prostaglandin

synthesis in lung epithelial cells is mediated via cPLA2 through an influx of extracellular

calcium Cytosolic PLA2 requires calcium for binding to membranes (30) and we assume

that cPLA2 translocates to membranes when intracellular calcium levels increase in

response to stretch Cyclic stretch mediated activation of cPLA2 through an extracellular

calcium influx has also been reported for kidney epithelial cells (2) In addition

Alexander and colleagues (2) reported that stretch activation of cPLA2 was dependent on

p4442MAPK activity Several other studies have demonstrated that cPLA2 activity can

be regulated by MAPKs (15 30 58) It has been suggested that p4442MAPK activation

and an increase of intracellular Ca2+ are both conjointly required for full cPLA2 activation

and subsequent arachidonate release (8 30) Our observation that inhibition of calcium-

dependent cPLA2 completely abolished the stretch-induced increase in PG content while

inhibition of p4442MAPK only partially reduced stretchndashinduced PG increases supports

the dual activation scenario for cPLA2 In contrast to a report suggesting that

phosphorylation of cPLA2 must precede the increase in intracellular Ca2+ to fully activate

the enzyme for AA release (38) our data are compatible with cyclic stretch promoting a

rapid Ca2+-induced translocation of cPLA2 resulting in enzyme activation and

subsequent further activation via p4442MAPK phosphorylation

Once AA is released by cPLA2 the cyclooxygenase pathway increases PGH2

levels which are further metabolized to PGE2 PGI2 PGD2 and TXA2 via their respective

17

Page 17 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

synthases Previous studies (42) have suggested that cyclooxygenases are involved in

cyclic stretch-mediated synthesis of prostacyclin in mixed fetal lung cells The present

finding of ibuprofen blocking cyclic stretch-induced increases in PG in fetal lung

epithelial cells corroborates the involvement of cyclooxygenases It also argues against

the possibility that the cyclic stretch-induced increases in PG content in the media are due

to the release of preformed mediators as has been shown for pulmonary surfactant (56)

Both COX-1 and COX-2 have been implicated in models of acute inflammation and it

appears that the degree to which each COX isoform contributes depends on the

inflammatory stimulus the inflamed organ and duration of inflammation (47) Studies

using mice deficient in the expression of either COX-1 or COX-2 have identified unique

roles of each COX isoform in various diseases For example COX-1 is the predominant

enzyme for PG formation in arachidonic acid-induced inflammation (28) and allergic

airway disease (18) COX-2 predominates in inflammation models of carrageenan air

pouch (27 54) and dextran sulfate colitis (33) In the present study we demonstrate

using selective COX-1 and -2 inhibitors that solely COX-2 mediates the cyclic stretch-

induced release of PG in fetal lung epithelial cells Our observation that cyclic stretch

increased COX-2 mRNA expression while decreasing Cox-1 mRNA expression is in

line with a predominant role for COX-2 in stretch-induced inflammation in the lung In

addition COX-2 mRNA expression has been shown to be up-regulated by mechanical

loading in various cell types (16 25 32 43) Thus it appears that COX-2 is the

predominant COX isoform regulating the mechanoproduction of prostanoids in the lung

epithelium

18

Page 18 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

ACKNOWLEDGEMENTS

This work was supported by grants (MOP-15272 MOP-74853) of the Canadian Institutes

of Health Research (CIHR) and the Ontario Block Term Grant Ian Copland is the

recipient of a Doctoral Research Award from the CIHR Martin Post is the holder of a

Canadian Research Chair (tier 1) in Respiration

19

Page 19 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

REFERENCES

1 Ackermann EJ Conde-Frieboes K and Dennis EA Inhibition of macrophage

Ca(2+)-independent phospholipase A2 by bromoenol lactone and trifluoromethyl

ketones J Biol Chem 270 445-450 1995

2 Alexander LD Alagarsamy S and Douglas JG Cyclic stretch-induced cPLA2

mediates ERK 12 signaling in rabbit proximal tubule cells Kidney Int 65 551-563

2004

3 Almeida T Cunha RA and Ribeiro JA Facilitation by arachidonic acid of

acetylcholine release from the rat hippocampus Brain Res 826 104-111 1999

4 Baier H Yerger L Moas R and Wanner A Vascular and airway effects of

endogenous cyclooxygenase products during lung inflation J Appl Physiol 59 884-889

1985

5 Balsinde J and Dennis EA Bromoenol lactone inhibits magnesium-dependent

phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse

P388D1 macrophages J Biol Chem 271 31937-31941 1996

6 Berend N Christopher KL and Voelkel NF The effect of positive end-

expiratory pressure on functional residual capacity role of prostaglandin production Am

Rev Respir Dis 126 646-647 1982

7 Berry EM Edmonds JF and Wyllie H Release of prostaglandin E2 and

unidentified factors from ventilated lungs Br J Surg 58 189-192 1971

8 Bhattacharya S Patel R Sen N Quadri S Parthasarathi K and

Bhattacharya J Dual signaling by the alpha(v)beta(3)-integrin activates cytosolic

20

Page 20 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

PLA(2) in bovine pulmonary artery endothelial cells Am J Physiol Lung Cell Mol

Physiol 280 L1049-1056 2001

9 Bulger EM Maier RV Lipid mediators in the pathophysiology of critical illness

Crit Care Med 28 N27-36 2000

10 Caniggia I Tseu I Han RN Smith BT Tanswell K and Post M Spatial and

temporal differences in fibroblast behavior in fetal rat lung Am J Physiol 261 L424-433

1991

11 Copland IB Kavanagh BP Engelberts D McKerlie C Belik J and Post M

Early changes in lung gene expression due to high tidal volume Am J Respir Crit Care

Med 168 1051-1059 2003

12 Copland IB Martinez F Kavanagh BP Engelberts D McKerlie C Belik J

and Post M High tidal volume ventilation causes different inflammatory responses in

newborn versus adult lung Am J Respir Crit Care Med 169 739-748 2004

13 Correa-Meyer E Pesce L Guerrero C and Sznajder JI Cyclic stretch

activates ERK12 via G proteins and EGFR in alveolar epithelial cells Am J Physiol

Lung Cell Mol Physiol 282 L883-891 2002

14 Edmonds JF Berry E and Wyllie JH Release of prostaglandins caused by

distension of the lungs Br J Surg 56 622-623 1969

15 Evans JH Fergus DJ and Leslie CC Inhibition of the MEK1ERK pathway

reduces arachidonic acid release independently of cPLA2 phosphorylation and

translocation BMC Biochem 3 30 2002

16 Fujishiro T Nishikawa T Shibanuma N Akisue T Takikawa S Yamamoto

T Yoshiya S and Kurosaka M Effect of cyclic mechanical stretch and titanium

21

Page 21 of 37

particles on prostaglandin E2 production by human macrophages in vitro J Biomed

Mater Res A 68 531-536 2004

17 Furue S Kuwabara K Mikawa K Nishina K Shiga M Maekawa N Ueno

M Chikazawa Y Ono T Hori Y Matsukawa A Yoshinaga M and Obara H

Crucial role of group IIA phospholipase A(2) in oleic acid-induced acute lung injury in

rabbits Am J Respir Crit Care Med 160 1292-1302 1999

18 Gavett SH Madison SL Chulada PC Scarborough PE Qu W Boyle JE

Tiano HF Lee CA Langenbach R Roggli VL and Zeldin DC Allergic lung

responses are increased in prostaglandin H synthase-deficient mice J Clin Invest 104

721-732 1999

19 Gijon MA and Leslie CC Regulation of arachidonic acid release and cytosolic

phospholipase A2 activation J Leukoc Biol 65 330-336 1999

20 Hallak H Muszbek L Laposata M Belmonte E Brass LF and Manning DR

Covalent binding of arachidonate to G protein alpha subunits of human platelets J Biol

Chem 269 4713-4716 1994

21 Hata AN and Breyer RM Pharmacology and signaling of prostaglandin

receptors multiple roles in inflammation and immune modulation Pharmacol Ther 103

147-166 2004

22 Hirai H Tanaka K Yoshie O Ogawa K Kenmotsu K Takamori Y

Ichimasa M Sugamura K Nakamura M Takano S and Nagata K Prostaglandin D2

selectively induces chemotaxis in T helper type 2 cells eosinophils and basophils via

seven-transmembrane receptor CRTH2 J Exp Med 193 255-261 2001

22

Page 22 of 37

23 Imai Y Parodo J Kajikawa O de Perrot M Fischer S Edwards V Cutz E

Liu M Keshavjee S Martin TR Marshall JC Ranieri VM and Slutsky AS

Injurious mechanical ventilation and end-organ epithelial cell apoptosis and organ

dysfunction in an experimental model of acute respiratory distress syndrome Jama 289

2104-2112 2003

24 Johnson AR Human pulmonary endothelial cells in culture Activities of cells

from arteries and cells from veins J Clin Invest 65 841-850 1980

25 Korita D Sagawa N Itoh H Yura S Yoshida M Kakui K Takemura M

Yokoyama C Tanabe T and Fujii S Cyclic mechanical stretch augments prostacyclin

production in cultured human uterine myometrial cells from pregnant women possible

involvement of up-regulation of prostacyclin synthase expression J Clin Endocrinol

Metab 87 5209-5219 2002

26 Kuwata H Nakatani Y Murakami M and Kudo I Cytosolic phospholipase

A2 is required for cytokine-induced expression of type IIA secretory phospholipase A2

that mediates optimal cyclooxygenase-2-dependent delayed prostaglandin E2 generation

in rat 3Y1 fibroblasts J Biol Chem 273 1733-1740 1998

27 Langenbach R Loftin CD Lee C and Tiano H Cyclooxygenase-deficient

mice A summary of their characteristics and susceptibilities to inflammation and

carcinogenesis Ann N Y Acad Sci 889 52-61 1999

28 Langenbach R Morham SG Tiano HF Loftin CD Ghanayem BI Chulada

PC Mahler JF Lee CA Goulding EH Kluckman KD Kim HS and Smithies O

Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced

inflammation and indomethacin-induced gastric ulceration Cell 83 483-492 1995

23

Page 23 of 37

29 Lefkowith JB Rogers M Lennartz MR and Brown EJ Essential fatty acid

deficiency impairs macrophage spreading and adherence Role of arachidonate in cell

adhesion J Biol Chem 266 1071-1076 1991

30 Leslie CC Properties and regulation of cytosolic phospholipase A2 J Biol Chem

272 16709-16712 1997

31 Livak KJ and Schmittgen TD Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 25 402-408

2001

32 Mikuni-Takagaki Y Mechanical responses and signal transduction pathways in

stretched osteocytes J Bone Miner Metab 17 57-60 1999

33 Morteau O Morham SG Sellon R Dieleman LA Langenbach R Smithies

O and Sartor RB Impaired mucosal defense to acute colonic injury in mice lacking

cyclooxygenase-1 or cyclooxygenase-2 J Clin Invest 105 469-478 2000

34 Oike M Droogmans G and Nilius B Mechanosensitive Ca2+ transients in

endothelial cells from human umbilical vein Proc Natl Acad Sci U S A 91 2940-2944

1994

35 Oudin S and Pugin J Role of MAP kinase activation in interleukin-8 production

by human BEAS-2B bronchial epithelial cells submitted to cyclic stretch Am J Respir

Cell Mol Biol 27 107-114 2002

36 Rozen S and Skaletsky H Primer3 on the WWW for general users and for

biologist programmers Methods Mol Biol 132 365-386 2000

37 Savla U Sporn PH and Waters CM Cyclic stretch of airway epithelium

inhibits prostanoid synthesis Am J Physiol 273 L1013-1019 1997

24

Page 24 of 37

38 Schalkwijk CG van der Heijden MA Bunt G Maas R Tertoolen LG van

Bergen en Henegouwen PM Verkleij AJ van den Bosch H and Boonstra J

Maximal epidermal growth-factor-induced cytosolic phospholipase A2 activation in vivo

requires phosphorylation followed by an increased intracellular calcium concentration

Biochem J 313 ( Pt 1) 91-96 1996

39 Scher JU and Pillinger MH 15d-PGJ2 the anti-inflammatory prostaglandin

Clin Immunol 114 100-109 2005

40 Schuster DP Stephenson AH Holmberg S and Sandiford P Effect of

eicosanoid inhibition on the development of pulmonary edema after acute lung injury J

Appl Physiol 80 915-923 1996

41 Simmons DL Botting RM and Hla T Cyclooxygenase isozymes the biology

of prostaglandin synthesis and inhibition Pharmacol Rev 56 387-437 2004

42 Skinner SJ Somervell CE and Olson DM The effects of mechanical stretching

on fetal rat lung cell prostacyclin production Prostaglandins 43 413-433 1992

43 Sooranna SR Lee Y Kim LU Mohan AR Bennett PR and Johnson MR

Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription

factor in human myometrial cells Mol Hum Reprod 10 109-113 2004

44 Spagnuolo PJ Ellner JJ Hassid A and Dunn MJ Thromboxane A2 mediates

augmented polymorphonuclear leukocyte adhesiveness J Clin Invest 66 406-414 1980

45 Szekeres CK Trikha M and Honn KV 12(S)-HETE pleiotropic functions

multiple signaling pathways Adv Exp Med Biol 507 509-515 2002

46 Tai HH Ensor CM Tong M Zhou H and Yan F Prostaglandin catabolizing

enzymes Prostaglandins Other Lipid Mediat 68-69 483-493 2002

25

Page 25 of 37

47 Tilley SL Coffman TM and Koller BH Mixed messages modulation of

inflammation and immune responses by prostaglandins and thromboxanes J Clin Invest

108 15-23 2001

48 Tremblay L Valenza F Ribeiro SP Li J and Slutsky AS Injurious

ventilatory strategies increase cytokines and c-fos m-RNA expression in an isolated rat

lung model J Clin Invest 99 944-952 1997

49 Tschumperlin DJ and Margulies SS Alveolar epithelial surface area-volume

relationship in isolated rat lungs J Appl Physiol 86 2026-2033 1999

50 Tschumperlin DJ and Margulies SS Equibiaxial deformation-induced injury of

alveolar epithelial cells in vitro Am J Physiol 275 L1173-1183 1998

51 Vandenburgh HH Shansky J Karlisch P and Solerssi RL Mechanical

stimulation of skeletal muscle generates lipid-related second messengers by

phospholipase activation J Cell Physiol 155 63-71 1993

52 Verbrugge SJ Uhlig S Neggers SJ Martin C Held HD Haitsma JJ and

Lachmann B Different ventilation strategies affect lung function but do not increase

tumor necrosis factor-alpha and prostacyclin production in lavaged rat lungs in vivo

Anesthesiology 91 1834-1843 1999

53 von Bethmann AN Brasch F Nusing R Vogt K Volk HD Muller KM

Wendel A and Uhlig S Hyperventilation induces release of cytokines from perfused

mouse lung Am J Respir Crit Care Med 157 263-272 1998

54 Wallace JL Bak A McKnight W Asfaha S Sharkey KA and MacNaughton

WK Cyclooxygenase 1 contributes to inflammatory responses in rats and mice

implications for gastrointestinal toxicity Gastroenterology 115 101-109 1998

26

Page 26 of 37

55 Webb HH and Tierney DF Experimental pulmonary edema due to intermittent

positive pressure ventilation with high inflation pressures Protection by positive end-

expiratory pressure Am Rev Respir Dis 110 556-565 1974

56 Wirtz HR and Dobbs LG Calcium mobilization and exocytosis after one

mechanical stretch of lung epithelial cells Science 250 1266-1269 1990

57 Yoshikawa S Miyahara T Reynolds SD Stripp BR Anghelescu M Eyal FG

and Parker JC Clara cell secretory protein and phospholipase A2 activity modulate

acute ventilator-induced lung injury in mice J Appl Physiol 98 1264-1271 2005

58 Zhu X Sano H Kim KP Sano A Boetticher E Munoz NM Cho W and Leff

AR Role of mitogen-activated protein kinase-mediated cytosolic phospholipase A2

activation in arachidonic acid metabolism in human eosinophils J Immunol 167 461-

468 2001

59 Zwissler B Kemming G Habler O Kleen M Merkel M Haller M Briegel J

Welte M Peter K Inhaled prostacyclin (PGI2) versus inhaled nitric oxide in adult

respiratory distress syndrome Am J Respir Crit Care Med 1541671-1677 1996

27

Page 27 of 37

23 Imai Y Parodo J Kajikawa O de Perrot M Fischer S Edwards V Cutz E

Liu M Keshavjee S Martin TR Marshall JC Ranieri VM and Slutsky AS

Injurious mechanical ventilation and end-organ epithelial cell apoptosis and organ

dysfunction in an experimental model of acute respiratory distress syndrome Jama 289

2104-2112 2003

24 Johnson AR Human pulmonary endothelial cells in culture Activities of cells

from arteries and cells from veins J Clin Invest 65 841-850 1980

25 Korita D Sagawa N Itoh H Yura S Yoshida M Kakui K Takemura M

Yokoyama C Tanabe T and Fujii S Cyclic mechanical stretch augments prostacyclin

production in cultured human uterine myometrial cells from pregnant women possible

involvement of up-regulation of prostacyclin synthase expression J Clin Endocrinol

Metab 87 5209-5219 2002

26 Kuwata H Nakatani Y Murakami M and Kudo I Cytosolic phospholipase

A2 is required for cytokine-induced expression of type IIA secretory phospholipase A2

that mediates optimal cyclooxygenase-2-dependent delayed prostaglandin E2 generation

in rat 3Y1 fibroblasts J Biol Chem 273 1733-1740 1998

27 Langenbach R Loftin CD Lee C and Tiano H Cyclooxygenase-deficient

mice A summary of their characteristics and susceptibilities to inflammation and

carcinogenesis Ann N Y Acad Sci 889 52-61 1999

28 Langenbach R Morham SG Tiano HF Loftin CD Ghanayem BI Chulada

PC Mahler JF Lee CA Goulding EH Kluckman KD Kim HS and Smithies O

Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced

inflammation and indomethacin-induced gastric ulceration Cell 83 483-492 1995

23

Page 23 of 37

29 Lefkowith JB Rogers M Lennartz MR and Brown EJ Essential fatty acid

deficiency impairs macrophage spreading and adherence Role of arachidonate in cell

adhesion J Biol Chem 266 1071-1076 1991

30 Leslie CC Properties and regulation of cytosolic phospholipase A2 J Biol Chem

272 16709-16712 1997

31 Livak KJ and Schmittgen TD Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 25 402-408

2001

32 Mikuni-Takagaki Y Mechanical responses and signal transduction pathways in

stretched osteocytes J Bone Miner Metab 17 57-60 1999

33 Morteau O Morham SG Sellon R Dieleman LA Langenbach R Smithies

O and Sartor RB Impaired mucosal defense to acute colonic injury in mice lacking

cyclooxygenase-1 or cyclooxygenase-2 J Clin Invest 105 469-478 2000

34 Oike M Droogmans G and Nilius B Mechanosensitive Ca2+ transients in

endothelial cells from human umbilical vein Proc Natl Acad Sci U S A 91 2940-2944

1994

35 Oudin S and Pugin J Role of MAP kinase activation in interleukin-8 production

by human BEAS-2B bronchial epithelial cells submitted to cyclic stretch Am J Respir

Cell Mol Biol 27 107-114 2002

36 Rozen S and Skaletsky H Primer3 on the WWW for general users and for

biologist programmers Methods Mol Biol 132 365-386 2000

37 Savla U Sporn PH and Waters CM Cyclic stretch of airway epithelium

inhibits prostanoid synthesis Am J Physiol 273 L1013-1019 1997

24

Page 24 of 37

38 Schalkwijk CG van der Heijden MA Bunt G Maas R Tertoolen LG van

Bergen en Henegouwen PM Verkleij AJ van den Bosch H and Boonstra J

Maximal epidermal growth-factor-induced cytosolic phospholipase A2 activation in vivo

requires phosphorylation followed by an increased intracellular calcium concentration

Biochem J 313 ( Pt 1) 91-96 1996

39 Scher JU and Pillinger MH 15d-PGJ2 the anti-inflammatory prostaglandin

Clin Immunol 114 100-109 2005

40 Schuster DP Stephenson AH Holmberg S and Sandiford P Effect of

eicosanoid inhibition on the development of pulmonary edema after acute lung injury J

Appl Physiol 80 915-923 1996

41 Simmons DL Botting RM and Hla T Cyclooxygenase isozymes the biology

of prostaglandin synthesis and inhibition Pharmacol Rev 56 387-437 2004

42 Skinner SJ Somervell CE and Olson DM The effects of mechanical stretching

on fetal rat lung cell prostacyclin production Prostaglandins 43 413-433 1992

43 Sooranna SR Lee Y Kim LU Mohan AR Bennett PR and Johnson MR

Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription

factor in human myometrial cells Mol Hum Reprod 10 109-113 2004

44 Spagnuolo PJ Ellner JJ Hassid A and Dunn MJ Thromboxane A2 mediates

augmented polymorphonuclear leukocyte adhesiveness J Clin Invest 66 406-414 1980

45 Szekeres CK Trikha M and Honn KV 12(S)-HETE pleiotropic functions

multiple signaling pathways Adv Exp Med Biol 507 509-515 2002

46 Tai HH Ensor CM Tong M Zhou H and Yan F Prostaglandin catabolizing

enzymes Prostaglandins Other Lipid Mediat 68-69 483-493 2002

25

Page 25 of 37

47 Tilley SL Coffman TM and Koller BH Mixed messages modulation of

inflammation and immune responses by prostaglandins and thromboxanes J Clin Invest

108 15-23 2001

48 Tremblay L Valenza F Ribeiro SP Li J and Slutsky AS Injurious

ventilatory strategies increase cytokines and c-fos m-RNA expression in an isolated rat

lung model J Clin Invest 99 944-952 1997

49 Tschumperlin DJ and Margulies SS Alveolar epithelial surface area-volume

relationship in isolated rat lungs J Appl Physiol 86 2026-2033 1999

50 Tschumperlin DJ and Margulies SS Equibiaxial deformation-induced injury of

alveolar epithelial cells in vitro Am J Physiol 275 L1173-1183 1998

51 Vandenburgh HH Shansky J Karlisch P and Solerssi RL Mechanical

stimulation of skeletal muscle generates lipid-related second messengers by

phospholipase activation J Cell Physiol 155 63-71 1993

52 Verbrugge SJ Uhlig S Neggers SJ Martin C Held HD Haitsma JJ and

Lachmann B Different ventilation strategies affect lung function but do not increase

tumor necrosis factor-alpha and prostacyclin production in lavaged rat lungs in vivo

Anesthesiology 91 1834-1843 1999

53 von Bethmann AN Brasch F Nusing R Vogt K Volk HD Muller KM

Wendel A and Uhlig S Hyperventilation induces release of cytokines from perfused

mouse lung Am J Respir Crit Care Med 157 263-272 1998

54 Wallace JL Bak A McKnight W Asfaha S Sharkey KA and MacNaughton

WK Cyclooxygenase 1 contributes to inflammatory responses in rats and mice

implications for gastrointestinal toxicity Gastroenterology 115 101-109 1998

26

Page 26 of 37

55 Webb HH and Tierney DF Experimental pulmonary edema due to intermittent

positive pressure ventilation with high inflation pressures Protection by positive end-

expiratory pressure Am Rev Respir Dis 110 556-565 1974

56 Wirtz HR and Dobbs LG Calcium mobilization and exocytosis after one

mechanical stretch of lung epithelial cells Science 250 1266-1269 1990

57 Yoshikawa S Miyahara T Reynolds SD Stripp BR Anghelescu M Eyal FG

and Parker JC Clara cell secretory protein and phospholipase A2 activity modulate

acute ventilator-induced lung injury in mice J Appl Physiol 98 1264-1271 2005

58 Zhu X Sano H Kim KP Sano A Boetticher E Munoz NM Cho W and Leff

AR Role of mitogen-activated protein kinase-mediated cytosolic phospholipase A2

activation in arachidonic acid metabolism in human eosinophils J Immunol 167 461-

468 2001

59 Zwissler B Kemming G Habler O Kleen M Merkel M Haller M Briegel J

Welte M Peter K Inhaled prostacyclin (PGI2) versus inhaled nitric oxide in adult

respiratory distress syndrome Am J Respir Crit Care Med 1541671-1677 1996

27

Page 27 of 37

29 Lefkowith JB Rogers M Lennartz MR and Brown EJ Essential fatty acid

deficiency impairs macrophage spreading and adherence Role of arachidonate in cell

adhesion J Biol Chem 266 1071-1076 1991

30 Leslie CC Properties and regulation of cytosolic phospholipase A2 J Biol Chem

272 16709-16712 1997

31 Livak KJ and Schmittgen TD Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 25 402-408

2001

32 Mikuni-Takagaki Y Mechanical responses and signal transduction pathways in

stretched osteocytes J Bone Miner Metab 17 57-60 1999

33 Morteau O Morham SG Sellon R Dieleman LA Langenbach R Smithies

O and Sartor RB Impaired mucosal defense to acute colonic injury in mice lacking

cyclooxygenase-1 or cyclooxygenase-2 J Clin Invest 105 469-478 2000

34 Oike M Droogmans G and Nilius B Mechanosensitive Ca2+ transients in

endothelial cells from human umbilical vein Proc Natl Acad Sci U S A 91 2940-2944

1994

35 Oudin S and Pugin J Role of MAP kinase activation in interleukin-8 production

by human BEAS-2B bronchial epithelial cells submitted to cyclic stretch Am J Respir

Cell Mol Biol 27 107-114 2002

36 Rozen S and Skaletsky H Primer3 on the WWW for general users and for

biologist programmers Methods Mol Biol 132 365-386 2000

37 Savla U Sporn PH and Waters CM Cyclic stretch of airway epithelium

inhibits prostanoid synthesis Am J Physiol 273 L1013-1019 1997

24

Page 24 of 37

38 Schalkwijk CG van der Heijden MA Bunt G Maas R Tertoolen LG van

Bergen en Henegouwen PM Verkleij AJ van den Bosch H and Boonstra J

Maximal epidermal growth-factor-induced cytosolic phospholipase A2 activation in vivo

requires phosphorylation followed by an increased intracellular calcium concentration

Biochem J 313 ( Pt 1) 91-96 1996

39 Scher JU and Pillinger MH 15d-PGJ2 the anti-inflammatory prostaglandin

Clin Immunol 114 100-109 2005

40 Schuster DP Stephenson AH Holmberg S and Sandiford P Effect of

eicosanoid inhibition on the development of pulmonary edema after acute lung injury J

Appl Physiol 80 915-923 1996

41 Simmons DL Botting RM and Hla T Cyclooxygenase isozymes the biology

of prostaglandin synthesis and inhibition Pharmacol Rev 56 387-437 2004

42 Skinner SJ Somervell CE and Olson DM The effects of mechanical stretching

on fetal rat lung cell prostacyclin production Prostaglandins 43 413-433 1992

43 Sooranna SR Lee Y Kim LU Mohan AR Bennett PR and Johnson MR

Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription

factor in human myometrial cells Mol Hum Reprod 10 109-113 2004

44 Spagnuolo PJ Ellner JJ Hassid A and Dunn MJ Thromboxane A2 mediates

augmented polymorphonuclear leukocyte adhesiveness J Clin Invest 66 406-414 1980

45 Szekeres CK Trikha M and Honn KV 12(S)-HETE pleiotropic functions

multiple signaling pathways Adv Exp Med Biol 507 509-515 2002

46 Tai HH Ensor CM Tong M Zhou H and Yan F Prostaglandin catabolizing

enzymes Prostaglandins Other Lipid Mediat 68-69 483-493 2002

25

Page 25 of 37

47 Tilley SL Coffman TM and Koller BH Mixed messages modulation of

inflammation and immune responses by prostaglandins and thromboxanes J Clin Invest

108 15-23 2001

48 Tremblay L Valenza F Ribeiro SP Li J and Slutsky AS Injurious

ventilatory strategies increase cytokines and c-fos m-RNA expression in an isolated rat

lung model J Clin Invest 99 944-952 1997

49 Tschumperlin DJ and Margulies SS Alveolar epithelial surface area-volume

relationship in isolated rat lungs J Appl Physiol 86 2026-2033 1999

50 Tschumperlin DJ and Margulies SS Equibiaxial deformation-induced injury of

alveolar epithelial cells in vitro Am J Physiol 275 L1173-1183 1998

51 Vandenburgh HH Shansky J Karlisch P and Solerssi RL Mechanical

stimulation of skeletal muscle generates lipid-related second messengers by

phospholipase activation J Cell Physiol 155 63-71 1993

52 Verbrugge SJ Uhlig S Neggers SJ Martin C Held HD Haitsma JJ and

Lachmann B Different ventilation strategies affect lung function but do not increase

tumor necrosis factor-alpha and prostacyclin production in lavaged rat lungs in vivo

Anesthesiology 91 1834-1843 1999

53 von Bethmann AN Brasch F Nusing R Vogt K Volk HD Muller KM

Wendel A and Uhlig S Hyperventilation induces release of cytokines from perfused

mouse lung Am J Respir Crit Care Med 157 263-272 1998

54 Wallace JL Bak A McKnight W Asfaha S Sharkey KA and MacNaughton

WK Cyclooxygenase 1 contributes to inflammatory responses in rats and mice

implications for gastrointestinal toxicity Gastroenterology 115 101-109 1998

26

Page 26 of 37

55 Webb HH and Tierney DF Experimental pulmonary edema due to intermittent

positive pressure ventilation with high inflation pressures Protection by positive end-

expiratory pressure Am Rev Respir Dis 110 556-565 1974

56 Wirtz HR and Dobbs LG Calcium mobilization and exocytosis after one

mechanical stretch of lung epithelial cells Science 250 1266-1269 1990

57 Yoshikawa S Miyahara T Reynolds SD Stripp BR Anghelescu M Eyal FG

and Parker JC Clara cell secretory protein and phospholipase A2 activity modulate

acute ventilator-induced lung injury in mice J Appl Physiol 98 1264-1271 2005

58 Zhu X Sano H Kim KP Sano A Boetticher E Munoz NM Cho W and Leff

AR Role of mitogen-activated protein kinase-mediated cytosolic phospholipase A2

activation in arachidonic acid metabolism in human eosinophils J Immunol 167 461-

468 2001

59 Zwissler B Kemming G Habler O Kleen M Merkel M Haller M Briegel J

Welte M Peter K Inhaled prostacyclin (PGI2) versus inhaled nitric oxide in adult

respiratory distress syndrome Am J Respir Crit Care Med 1541671-1677 1996

27

Page 27 of 37

38 Schalkwijk CG van der Heijden MA Bunt G Maas R Tertoolen LG van

Bergen en Henegouwen PM Verkleij AJ van den Bosch H and Boonstra J

Maximal epidermal growth-factor-induced cytosolic phospholipase A2 activation in vivo

requires phosphorylation followed by an increased intracellular calcium concentration

Biochem J 313 ( Pt 1) 91-96 1996

39 Scher JU and Pillinger MH 15d-PGJ2 the anti-inflammatory prostaglandin

Clin Immunol 114 100-109 2005

40 Schuster DP Stephenson AH Holmberg S and Sandiford P Effect of

eicosanoid inhibition on the development of pulmonary edema after acute lung injury J

Appl Physiol 80 915-923 1996

41 Simmons DL Botting RM and Hla T Cyclooxygenase isozymes the biology

of prostaglandin synthesis and inhibition Pharmacol Rev 56 387-437 2004

42 Skinner SJ Somervell CE and Olson DM The effects of mechanical stretching

on fetal rat lung cell prostacyclin production Prostaglandins 43 413-433 1992

43 Sooranna SR Lee Y Kim LU Mohan AR Bennett PR and Johnson MR

Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription

factor in human myometrial cells Mol Hum Reprod 10 109-113 2004

44 Spagnuolo PJ Ellner JJ Hassid A and Dunn MJ Thromboxane A2 mediates

augmented polymorphonuclear leukocyte adhesiveness J Clin Invest 66 406-414 1980

45 Szekeres CK Trikha M and Honn KV 12(S)-HETE pleiotropic functions

multiple signaling pathways Adv Exp Med Biol 507 509-515 2002

46 Tai HH Ensor CM Tong M Zhou H and Yan F Prostaglandin catabolizing

enzymes Prostaglandins Other Lipid Mediat 68-69 483-493 2002

25

Page 25 of 37

47 Tilley SL Coffman TM and Koller BH Mixed messages modulation of

inflammation and immune responses by prostaglandins and thromboxanes J Clin Invest

108 15-23 2001

48 Tremblay L Valenza F Ribeiro SP Li J and Slutsky AS Injurious

ventilatory strategies increase cytokines and c-fos m-RNA expression in an isolated rat

lung model J Clin Invest 99 944-952 1997

49 Tschumperlin DJ and Margulies SS Alveolar epithelial surface area-volume

relationship in isolated rat lungs J Appl Physiol 86 2026-2033 1999

50 Tschumperlin DJ and Margulies SS Equibiaxial deformation-induced injury of

alveolar epithelial cells in vitro Am J Physiol 275 L1173-1183 1998

51 Vandenburgh HH Shansky J Karlisch P and Solerssi RL Mechanical

stimulation of skeletal muscle generates lipid-related second messengers by

phospholipase activation J Cell Physiol 155 63-71 1993

52 Verbrugge SJ Uhlig S Neggers SJ Martin C Held HD Haitsma JJ and

Lachmann B Different ventilation strategies affect lung function but do not increase

tumor necrosis factor-alpha and prostacyclin production in lavaged rat lungs in vivo

Anesthesiology 91 1834-1843 1999

53 von Bethmann AN Brasch F Nusing R Vogt K Volk HD Muller KM

Wendel A and Uhlig S Hyperventilation induces release of cytokines from perfused

mouse lung Am J Respir Crit Care Med 157 263-272 1998

54 Wallace JL Bak A McKnight W Asfaha S Sharkey KA and MacNaughton

WK Cyclooxygenase 1 contributes to inflammatory responses in rats and mice

implications for gastrointestinal toxicity Gastroenterology 115 101-109 1998

26

Page 26 of 37

55 Webb HH and Tierney DF Experimental pulmonary edema due to intermittent

positive pressure ventilation with high inflation pressures Protection by positive end-

expiratory pressure Am Rev Respir Dis 110 556-565 1974

56 Wirtz HR and Dobbs LG Calcium mobilization and exocytosis after one

mechanical stretch of lung epithelial cells Science 250 1266-1269 1990

57 Yoshikawa S Miyahara T Reynolds SD Stripp BR Anghelescu M Eyal FG

and Parker JC Clara cell secretory protein and phospholipase A2 activity modulate

acute ventilator-induced lung injury in mice J Appl Physiol 98 1264-1271 2005

58 Zhu X Sano H Kim KP Sano A Boetticher E Munoz NM Cho W and Leff

AR Role of mitogen-activated protein kinase-mediated cytosolic phospholipase A2

activation in arachidonic acid metabolism in human eosinophils J Immunol 167 461-

468 2001

59 Zwissler B Kemming G Habler O Kleen M Merkel M Haller M Briegel J

Welte M Peter K Inhaled prostacyclin (PGI2) versus inhaled nitric oxide in adult

respiratory distress syndrome Am J Respir Crit Care Med 1541671-1677 1996

27

Page 27 of 37

47 Tilley SL Coffman TM and Koller BH Mixed messages modulation of

inflammation and immune responses by prostaglandins and thromboxanes J Clin Invest

108 15-23 2001

48 Tremblay L Valenza F Ribeiro SP Li J and Slutsky AS Injurious

ventilatory strategies increase cytokines and c-fos m-RNA expression in an isolated rat

lung model J Clin Invest 99 944-952 1997

49 Tschumperlin DJ and Margulies SS Alveolar epithelial surface area-volume

relationship in isolated rat lungs J Appl Physiol 86 2026-2033 1999

50 Tschumperlin DJ and Margulies SS Equibiaxial deformation-induced injury of

alveolar epithelial cells in vitro Am J Physiol 275 L1173-1183 1998

51 Vandenburgh HH Shansky J Karlisch P and Solerssi RL Mechanical

stimulation of skeletal muscle generates lipid-related second messengers by

phospholipase activation J Cell Physiol 155 63-71 1993

52 Verbrugge SJ Uhlig S Neggers SJ Martin C Held HD Haitsma JJ and

Lachmann B Different ventilation strategies affect lung function but do not increase

tumor necrosis factor-alpha and prostacyclin production in lavaged rat lungs in vivo

Anesthesiology 91 1834-1843 1999

53 von Bethmann AN Brasch F Nusing R Vogt K Volk HD Muller KM

Wendel A and Uhlig S Hyperventilation induces release of cytokines from perfused

mouse lung Am J Respir Crit Care Med 157 263-272 1998

54 Wallace JL Bak A McKnight W Asfaha S Sharkey KA and MacNaughton

WK Cyclooxygenase 1 contributes to inflammatory responses in rats and mice

implications for gastrointestinal toxicity Gastroenterology 115 101-109 1998

26

Page 26 of 37

55 Webb HH and Tierney DF Experimental pulmonary edema due to intermittent

positive pressure ventilation with high inflation pressures Protection by positive end-

expiratory pressure Am Rev Respir Dis 110 556-565 1974

56 Wirtz HR and Dobbs LG Calcium mobilization and exocytosis after one

mechanical stretch of lung epithelial cells Science 250 1266-1269 1990

57 Yoshikawa S Miyahara T Reynolds SD Stripp BR Anghelescu M Eyal FG

and Parker JC Clara cell secretory protein and phospholipase A2 activity modulate

acute ventilator-induced lung injury in mice J Appl Physiol 98 1264-1271 2005

58 Zhu X Sano H Kim KP Sano A Boetticher E Munoz NM Cho W and Leff

AR Role of mitogen-activated protein kinase-mediated cytosolic phospholipase A2

activation in arachidonic acid metabolism in human eosinophils J Immunol 167 461-

468 2001

59 Zwissler B Kemming G Habler O Kleen M Merkel M Haller M Briegel J

Welte M Peter K Inhaled prostacyclin (PGI2) versus inhaled nitric oxide in adult

respiratory distress syndrome Am J Respir Crit Care Med 1541671-1677 1996

27

Page 27 of 37

55 Webb HH and Tierney DF Experimental pulmonary edema due to intermittent

positive pressure ventilation with high inflation pressures Protection by positive end-

expiratory pressure Am Rev Respir Dis 110 556-565 1974

56 Wirtz HR and Dobbs LG Calcium mobilization and exocytosis after one

mechanical stretch of lung epithelial cells Science 250 1266-1269 1990

57 Yoshikawa S Miyahara T Reynolds SD Stripp BR Anghelescu M Eyal FG

and Parker JC Clara cell secretory protein and phospholipase A2 activity modulate

acute ventilator-induced lung injury in mice J Appl Physiol 98 1264-1271 2005

58 Zhu X Sano H Kim KP Sano A Boetticher E Munoz NM Cho W and Leff

AR Role of mitogen-activated protein kinase-mediated cytosolic phospholipase A2

activation in arachidonic acid metabolism in human eosinophils J Immunol 167 461-

468 2001

59 Zwissler B Kemming G Habler O Kleen M Merkel M Haller M Briegel J

Welte M Peter K Inhaled prostacyclin (PGI2) versus inhaled nitric oxide in adult

respiratory distress syndrome Am J Respir Crit Care Med 1541671-1677 1996

27

Page 27 of 37

FIGURE LEGENDS

Figure 1 Eicosanoids produced as a consequence of arachidonic acid metabolism

(PLA2 phospholipase A2 PG prostaglandin TXA2 thromboxane A2 LT leukotrienes

Hete hydroxyeicosatetraenoic acid)

Figure 2 Effect of cyclic stretch on eicosanoid content in the media of fetal lung

epithelial cells and fibroblasts Lung epithelial cells (a) and fibroblasts (b) were

subjected to cyclic stretch (17 change in surface area) for 30 to 180 minutes and

eicosanoid content was measured in media by multiplex mass spectrometry All

graphs are presented as mean fold change plusmn SEM (n=5 individual experiments)

Plt005 vs static controls Plt005 vs 30rsquo stretch and static controls

Figure 3 Effect of duration and amplitude of cyclic stretch on media PG content

of fetal lung epithelial cells (a) Lung epithelial cells were subjected to cyclic

stretch (17 change in surface area) for 10 20 and 30 min and AA and eicosanoid

content were measured in media by multiplex mass spectrometry (b) Lung

epithelial cells were subjected to cyclic stretch of 5-17 elongation for 30 min

and AA acid and eicosanoid content in the media were measured All graphs are

presented as mean fold change plusmn SEM (n=5 individual experiments) Plt005 vs

static controls Plt005 vs all other groups

28

Page 28 of 37

Figure 4 Inhibition of calcium-dependent cPLA2 activity abolishes cyclic stretch-

induced PG increases in the media of fetal lung epithelial cells Lung epithelial

cells pre-incubated for 1 hour with various inhibitors were subjected to cyclic

stretch (17 change in surface area) for 30 min and AA and eicosanoid content

were measured in media by multiplex mass spectrometry (a) AACOF3 (10 microM) a

calcium-dependent cPLA2 inhibitor but not HELSS (50 μM) a calcium-

independent cPLA2 inhibitor reduced the stretch-induced increase of PG (b)

Removal of extracellular calcium using EGTA (1 mM) completely abolished the

stretch-induced PG increase Also the intracellular calcium chelator BAPTAAM

(10 μM) significantly reduced the stretch-induced increase in PG while

gadolinium (Gd3+ 15 μM) a mechanosensitive calcium channel blocker had no

effect (c) Pre-incubation with EGTA completely abolished the cyclic stretch-

triggered increase in free arachidonic acid BAPTAAM partially reduced the

cyclic stretch increase in AA while gadolinium did not have any effect All graphs

are presented as mean fold change plusmn SEM (n=5 individual experiments) Plt005

vs static untreated controls Plt005 vs all other groups

Figure 5 Inhibition of p4442MAPK reduces cyclic stretch-induced PG increases

in the media of fetal lung epithelial cells Lung epithelial cells pre-incubated for 1

hour with inhibitors specific either to p4442MAPK (UO126) or p38MAPK

(SB203580) were subjected to cyclic stretch (17 change in surface area) for 30

min and AA acid and eicosanoid content were measured in media by multiplex

mass spectrometry (a) Pre-incubation with UO126 (10 μM) significantly reduced

29

Page 29 of 37

the cyclic stretch-induced increase of PG in the media which was not observed

when cells were pre-incubated with SB203580 (10 μM) (b) The increase in free

arachidonic acid levels due to cyclic stretch was also significantly reduced with

UO126 but not with SB203580 All graphs are presented as mean fold change plusmn

SEM (n= 4 individual experiments) Plt005 vs static untreated controls

Plt005 vs all other groups

Figure 6 Cyclic stretch-induced increase of PGs in the media of fetal lung

epithelial cells is mediated via COX-2 Lung epithelial cells pre-incubated for 1

hour with either non-specific (Ibuprofen) or specific inhibitors for either COX-1

(SC-560) or COX-2 (NS-398) were subjected to cyclic stretch (17 change in

surface area) for 30 min and AA and eicosanoid content were measured in media

by multiplex mass spectrometry (a) Ibuprofen (IB) significantly decreased (5 M)

or completely abolished (50 μM) the cyclic stretch increases in PG (b) Inhibition

of COX-2 (10 μM) but not COX-1 (1 μM) activity abolished stretch-induced

increase of PG in the media (c) Cyclic stretch increased COX-2 mRNA levels

whereas Cox-1 mRNA levels were slightly decreased by stretch All graphs are

presented as mean fold change plusmn SEM (n=5 individual experiments carried out in

triplicate) Plt005 vs static untreated control ^ Plt005 vs static untreated

control

30

Page 30 of 37

Table 1 Basal Eicosanoids Levels in Primary Fetal Lung Cell Culture Media (pgmL)

Eicosanoid Epithelial cells Fibroblasts

PGI2 34 plusmn10 57 plusmn 9 TBX2 87plusmn14 18 plusmn 2 PGF2α 12plusmn 2 25 plusmn 7 PGE2 64plusmn10 164 plusmn 9 PGD2 17plusmn 2 24 plusmn 1 LTB4 38plusmn 7 52 plusmn 9 12-HETE 474plusmn 27 520 plusmn 73

Within 24 hours of isolation fetal lung fibroblast and epithelial cells (purity gt90) were

separately inoculated at a density of 106 cellswell onto 6-well type-1 collagen-coated

BioFlex plates and maintained for 24 hours in MEM + 10 (vv) FBS The following

day the medium was changed to MEM + 05 (vv) FBS After 4 hours the medium

was replaced with fresh MEM + 05 (vv) FBS and following 3 hours of incubation the

media was collected for measurement of basal eicosanoid levels by mass spectrometry

Data are mean plusmn SEM of 5 individual experiments

31

Page 31 of 37

Figure 1

Cell membrane phospholipids

Arachidonic Acid

cyclooygenase 5-lipoxygenase 12-lipoxygenase 15-lipoxygenase

PGG2 LTA4

PGH2

LTB4

PLA2

PGI2

PGE2 PGF2α

TXA2

PGD2

PGJ2

12-Hete 15-Hete

TBX2

Lipoxins

6-keto PGF1α

Isoprostanes

32

Page 32 of 37

Figure 2

33

Page 33 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 4 Inhibition of calcium-dependent cPLA2 activity abolishes cyclic stretch-

induced PG increases in the media of fetal lung epithelial cells Lung epithelial

cells pre-incubated for 1 hour with various inhibitors were subjected to cyclic

stretch (17 change in surface area) for 30 min and AA and eicosanoid content

were measured in media by multiplex mass spectrometry (a) AACOF3 (10 microM) a

calcium-dependent cPLA2 inhibitor but not HELSS (50 μM) a calcium-

independent cPLA2 inhibitor reduced the stretch-induced increase of PG (b)

Removal of extracellular calcium using EGTA (1 mM) completely abolished the

stretch-induced PG increase Also the intracellular calcium chelator BAPTAAM

(10 μM) significantly reduced the stretch-induced increase in PG while

gadolinium (Gd3+ 15 μM) a mechanosensitive calcium channel blocker had no

effect (c) Pre-incubation with EGTA completely abolished the cyclic stretch-

triggered increase in free arachidonic acid BAPTAAM partially reduced the

cyclic stretch increase in AA while gadolinium did not have any effect All graphs

are presented as mean fold change plusmn SEM (n=5 individual experiments) Plt005

vs static untreated controls Plt005 vs all other groups

Figure 5 Inhibition of p4442MAPK reduces cyclic stretch-induced PG increases

in the media of fetal lung epithelial cells Lung epithelial cells pre-incubated for 1

hour with inhibitors specific either to p4442MAPK (UO126) or p38MAPK

(SB203580) were subjected to cyclic stretch (17 change in surface area) for 30

min and AA acid and eicosanoid content were measured in media by multiplex

mass spectrometry (a) Pre-incubation with UO126 (10 μM) significantly reduced

29

Page 29 of 37

the cyclic stretch-induced increase of PG in the media which was not observed

when cells were pre-incubated with SB203580 (10 μM) (b) The increase in free

arachidonic acid levels due to cyclic stretch was also significantly reduced with

UO126 but not with SB203580 All graphs are presented as mean fold change plusmn

SEM (n= 4 individual experiments) Plt005 vs static untreated controls

Plt005 vs all other groups

Figure 6 Cyclic stretch-induced increase of PGs in the media of fetal lung

epithelial cells is mediated via COX-2 Lung epithelial cells pre-incubated for 1

hour with either non-specific (Ibuprofen) or specific inhibitors for either COX-1

(SC-560) or COX-2 (NS-398) were subjected to cyclic stretch (17 change in

surface area) for 30 min and AA and eicosanoid content were measured in media

by multiplex mass spectrometry (a) Ibuprofen (IB) significantly decreased (5 M)

or completely abolished (50 μM) the cyclic stretch increases in PG (b) Inhibition

of COX-2 (10 μM) but not COX-1 (1 μM) activity abolished stretch-induced

increase of PG in the media (c) Cyclic stretch increased COX-2 mRNA levels

whereas Cox-1 mRNA levels were slightly decreased by stretch All graphs are

presented as mean fold change plusmn SEM (n=5 individual experiments carried out in

triplicate) Plt005 vs static untreated control ^ Plt005 vs static untreated

control

30

Page 30 of 37

Table 1 Basal Eicosanoids Levels in Primary Fetal Lung Cell Culture Media (pgmL)

Eicosanoid Epithelial cells Fibroblasts

PGI2 34 plusmn10 57 plusmn 9 TBX2 87plusmn14 18 plusmn 2 PGF2α 12plusmn 2 25 plusmn 7 PGE2 64plusmn10 164 plusmn 9 PGD2 17plusmn 2 24 plusmn 1 LTB4 38plusmn 7 52 plusmn 9 12-HETE 474plusmn 27 520 plusmn 73

Within 24 hours of isolation fetal lung fibroblast and epithelial cells (purity gt90) were

separately inoculated at a density of 106 cellswell onto 6-well type-1 collagen-coated

BioFlex plates and maintained for 24 hours in MEM + 10 (vv) FBS The following

day the medium was changed to MEM + 05 (vv) FBS After 4 hours the medium

was replaced with fresh MEM + 05 (vv) FBS and following 3 hours of incubation the

media was collected for measurement of basal eicosanoid levels by mass spectrometry

Data are mean plusmn SEM of 5 individual experiments

31

Page 31 of 37

Figure 1

Cell membrane phospholipids

Arachidonic Acid

cyclooygenase 5-lipoxygenase 12-lipoxygenase 15-lipoxygenase

PGG2 LTA4

PGH2

LTB4

PLA2

PGI2

PGE2 PGF2α

TXA2

PGD2

PGJ2

12-Hete 15-Hete

TBX2

Lipoxins

6-keto PGF1α

Isoprostanes

32

Page 32 of 37

Figure 2

33

Page 33 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

the cyclic stretch-induced increase of PG in the media which was not observed

when cells were pre-incubated with SB203580 (10 μM) (b) The increase in free

arachidonic acid levels due to cyclic stretch was also significantly reduced with

UO126 but not with SB203580 All graphs are presented as mean fold change plusmn

SEM (n= 4 individual experiments) Plt005 vs static untreated controls

Plt005 vs all other groups

Figure 6 Cyclic stretch-induced increase of PGs in the media of fetal lung

epithelial cells is mediated via COX-2 Lung epithelial cells pre-incubated for 1

hour with either non-specific (Ibuprofen) or specific inhibitors for either COX-1

(SC-560) or COX-2 (NS-398) were subjected to cyclic stretch (17 change in

surface area) for 30 min and AA and eicosanoid content were measured in media

by multiplex mass spectrometry (a) Ibuprofen (IB) significantly decreased (5 M)

or completely abolished (50 μM) the cyclic stretch increases in PG (b) Inhibition

of COX-2 (10 μM) but not COX-1 (1 μM) activity abolished stretch-induced

increase of PG in the media (c) Cyclic stretch increased COX-2 mRNA levels

whereas Cox-1 mRNA levels were slightly decreased by stretch All graphs are

presented as mean fold change plusmn SEM (n=5 individual experiments carried out in

triplicate) Plt005 vs static untreated control ^ Plt005 vs static untreated

control

30

Page 30 of 37

Table 1 Basal Eicosanoids Levels in Primary Fetal Lung Cell Culture Media (pgmL)

Eicosanoid Epithelial cells Fibroblasts

PGI2 34 plusmn10 57 plusmn 9 TBX2 87plusmn14 18 plusmn 2 PGF2α 12plusmn 2 25 plusmn 7 PGE2 64plusmn10 164 plusmn 9 PGD2 17plusmn 2 24 plusmn 1 LTB4 38plusmn 7 52 plusmn 9 12-HETE 474plusmn 27 520 plusmn 73

Within 24 hours of isolation fetal lung fibroblast and epithelial cells (purity gt90) were

separately inoculated at a density of 106 cellswell onto 6-well type-1 collagen-coated

BioFlex plates and maintained for 24 hours in MEM + 10 (vv) FBS The following

day the medium was changed to MEM + 05 (vv) FBS After 4 hours the medium

was replaced with fresh MEM + 05 (vv) FBS and following 3 hours of incubation the

media was collected for measurement of basal eicosanoid levels by mass spectrometry

Data are mean plusmn SEM of 5 individual experiments

31

Page 31 of 37

Figure 1

Cell membrane phospholipids

Arachidonic Acid

cyclooygenase 5-lipoxygenase 12-lipoxygenase 15-lipoxygenase

PGG2 LTA4

PGH2

LTB4

PLA2

PGI2

PGE2 PGF2α

TXA2

PGD2

PGJ2

12-Hete 15-Hete

TBX2

Lipoxins

6-keto PGF1α

Isoprostanes

32

Page 32 of 37

Figure 2

33

Page 33 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Table 1 Basal Eicosanoids Levels in Primary Fetal Lung Cell Culture Media (pgmL)

Eicosanoid Epithelial cells Fibroblasts

PGI2 34 plusmn10 57 plusmn 9 TBX2 87plusmn14 18 plusmn 2 PGF2α 12plusmn 2 25 plusmn 7 PGE2 64plusmn10 164 plusmn 9 PGD2 17plusmn 2 24 plusmn 1 LTB4 38plusmn 7 52 plusmn 9 12-HETE 474plusmn 27 520 plusmn 73

Within 24 hours of isolation fetal lung fibroblast and epithelial cells (purity gt90) were

separately inoculated at a density of 106 cellswell onto 6-well type-1 collagen-coated

BioFlex plates and maintained for 24 hours in MEM + 10 (vv) FBS The following

day the medium was changed to MEM + 05 (vv) FBS After 4 hours the medium

was replaced with fresh MEM + 05 (vv) FBS and following 3 hours of incubation the

media was collected for measurement of basal eicosanoid levels by mass spectrometry

Data are mean plusmn SEM of 5 individual experiments

31

Page 31 of 37

Figure 1

Cell membrane phospholipids

Arachidonic Acid

cyclooygenase 5-lipoxygenase 12-lipoxygenase 15-lipoxygenase

PGG2 LTA4

PGH2

LTB4

PLA2

PGI2

PGE2 PGF2α

TXA2

PGD2

PGJ2

12-Hete 15-Hete

TBX2

Lipoxins

6-keto PGF1α

Isoprostanes

32

Page 32 of 37

Figure 2

33

Page 33 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 1

Cell membrane phospholipids

Arachidonic Acid

cyclooygenase 5-lipoxygenase 12-lipoxygenase 15-lipoxygenase

PGG2 LTA4

PGH2

LTB4

PLA2

PGI2

PGE2 PGF2α

TXA2

PGD2

PGJ2

12-Hete 15-Hete

TBX2

Lipoxins

6-keto PGF1α

Isoprostanes

32

Page 32 of 37

Figure 2

33

Page 33 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 2

33

Page 33 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 3

34

Page 34 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 4

35

Page 35 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 5

36

Page 36 of 37

Figure 6

37

Page 37 of 37

Figure 6

37

Page 37 of 37