ilable at ScienceDirect

Theriogenology 83 (2015) 862–873

Contents lists ava

Theriogenology

journal homepage: www.theriojournal .com

Pifithrin-a ameliorates resveratrol-induced two-cell blockin mouse preimplantation embryos in vitro

Jae-Kyo Jeong a, Min-Hee Kang a, Sangiliyandi Gurunathan a, Ssang-Goo Cho a,Chankyu Park a, Jin-Ki Park b, Jin-Hoi Kim a,*

aDepartment of Animal Biotechnology, KonKuk University, Seoul, Republic of KoreabAnimal Biotechnology Division, National Institute of Animal Science, RDA, Gyeonggi-do, Republic of Korea

a r t i c l e i n f o

Article history:Received 27 July 2014Received in revised form 29 October 2014Accepted 20 November 2014

Keywords:ResveratrolTwo-cell blockApoptosisp53Pifithrin-aPreimplantation embryo

* Corresponding author. Tel.: þ82 2 450 3687; faE-mail address: jhkim541@konkuk.ac.kr (J.-H. Ki

0093-691X/$ – see front matter � 2015 Elsevier Inchttp://dx.doi.org/10.1016/j.theriogenology.2014.11.02

a b s t r a c t

Treatment with resveratrol at concentrations greater than 0.5 mmol/L resulted in the arrestof mouse embryo development at the two-cell stage. Resveratrol-induced cytotoxicity wasinvestigated in embryos by evaluating morphologic features by using the bromodeox-yuridine assay and acridine orange and ethidium bromide double staining. Resveratrol wasfound to significantly increase the expressions of p53, p21, Atf3, smac/Diablo, Bax, Bak1, Bok,and Noxa mRNA in the embryos, whereas Cullin 3 and Cdk1 expressions were decreased.Furthermore, active p53 positive signal in embryos arrested at the two-cell stage waslocalized in the nucleus, whereas no active p53 signal was observed in control embryos.Pretreatment with pifithrin-a, a p53 inhibitor, downregulated active p53 in two-cell em-bryo nuclei and ameliorated approximately 50% of the embryonic developmental defectcaused by resveratrol. The findings of the present study, therefore, suggest that pifithrin-acould be used as an effective cytoprotective agent against a reproductive toxin such asresveratrol.

� 2015 Elsevier Inc. All rights reserved.

1. Introduction

Resveratrol and resveratrol-like compounds play animportant role in drug research owing to their antioxidantactions with allosteric properties on epigenetic drug tar-gets. Recently, polyphenolic compounds such as curcuminand quercetin have become a focus of intense study in anumber of therapeutic areas because of their postulatedantioxidant, anti-inflammatory, and anticancer properties,involving several different mechanisms of action [1–3]. Anumber of in vivo and in vitro studies have shown thatresveratrol and other polyphenols play a protective roleagainst hepatic insults and prevent liver injury becauseof oxidative damage to primary rat hepatocytes [4,5].

x: þ82 2 458 5414.m).

. All rights reserved.3

Additionally, studies have been conducted for evaluatingthe effects of various compounds on embryonic develop-ment: 3-hydroxyflavone [6] has been shown to have abeneficial effect on embryonic development, whereasstudies suggest that flavonoids such as genistein [7], gink-golides [8], and daidzein [9] may be toxic.

Resveratrol also plays a vital role in both innate andadaptive immunity, modulating the function of macro-phages, lymphocytes, and dendritic cells, among others. Incancer cell lines, resveratrol was shown to activate p53 byphosphorylation, which in turn suppresses the prolifera-tion of cancer cells [10–12] and significantly increases theproapoptotic signals such as Bak and p21 genes. Theseantitumor properties may also be associated with theability of resveratrol to cause cell cycle arrest and induceapoptosis, or with its antioxidant activity and the ability toinhibit the activation of cyclooxygenases 1 and 2 [13].

Sirtuin 1 (SIRT1)was proposed to regulate the acetylationof several transcription factors, including p53 [14], Ku70, and

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873 863

FoxOs [15]. Additionally, SIRT1 has an inhibitory effect ontumor suppressors likep53andFoxOs,whereas other studiessuggest that SIRT1 may also have a tumor-suppressivefunction. Treatment with resveratrol, a SIRT1 activator, wasshown to increase adenosine monophosphate-activatedprotein kinase phosphorylation and reduce the biomarkersof oxidative damage during aging in F2 hybrid mice [16].Resveratrolhasbeen identifiedasaSIRT1activatorandsmall-molecule activators of SIRT1 have been developed as thera-peutic agents for the treatment of type 2 diabetes [17].Another important target for SIRT1 is nuclear factor kB (NF-kB), a regulator of a number of key processes, including cellcycle progression, apoptosis, and inflammation. Sirtuin 1 at-tenuates NF-kB–mediated proinflammatory effects bydeacetylating the RelA/p65 subunit of NF-kB [17,18]. Wild-type p53 expression is upregulated in the cell by the exten-sion of its half-life through the inhibition of its degradationand bymodulation of its stability by posttranslational eventssuch as phosphorylation and acetylation. Hsieh et al. [10]have reported that the treatment with resveratrol leads toseveral cellular changes in the bovine pulmonary arteryendothelial cells, notably causing an induction of endothelialnitric oxide synthase, p53, and p21 (cyclin-dependent kinaseinhibitor 1A), and a suppression of cell proliferation.

Resveratrol induces apoptosis and inhibits tumor pro-moter–induced cell transformation by increasing thetransactivation of p53 activity through multiple mecha-nisms, including the phosphorylation at Ser-15, which mayplay a critical role in the stabilization, upregulation, andfunctional activation of p53 [10]. She et al. [11] found thatresveratrol-induced apoptosis depends on the activities ofextracellular signal-regulated kinases/p38 kinases andtheir phosphorylation of p53 at Ser-15. Therefore, theidentification of effective agents that would be protectiveagainst the reproductive toxins is a major scientific chal-lenge in the treatment of human infertility. Generally,pifithrin (2-[2-amino-4,5,6,7-tetrahydrobenzothiol-3-yl]-1-p-tolylethanone-1) (PFT)-a, an inhibitor of p53, is knownto reversely inhibit p53 transcriptional activity [19] and hasbeen used for the characterization of p53 function invarious experimental systems [20–22]. Culmsee et al. [23]reported that the DU145 cells treated with PFT-a exhibi-ted reduced resveratrol-induced activation of p53,decreased p53 binding to DNA, and decreased levels of Bax,a target gene for p53.

Although resveratrol induces cell death in cancer cells, ithas been shown to protect cells from arachidonic acid andiron-induced apoptosis, and to reduce the production ofreactive oxygen species through affecting the AMP-activated protein kinase pathway [24]. Additionally,several researchers have reported that resveratrol protectsthe preimplantation embryos during in vitro culture bysuppressing apoptosis induced by 2-bromopropane [25],methylglyoxal [26], and ethanol [27]. Similarly, anothergroup reported that supplementation of resveratrol intothe culture medium enhances the development of pigembryos in vitro [28,29]. However, the authors of a veryrecent study reported that supplementation of high con-centration of resveratrol into culture medium inhibitedin vitro developmental competency of preimplantationembryos [30]. Until now, this issue has not been thoroughly

studied for in vitro development of both animals andhuman preimplantation embryos. Thus, it is presentlydifficult to make a hypothesis about how supplementationof resveratrol into culture medium might have affectedin vitro developmental competency of preimplantationembryos.

Although resveratrol has been shown to have multiplebiological functions, the precise molecular mechanismsunderlying its actions are currently unknown. Furthermore,there is no information available that would elucidate thepossible relation between the effects of resveratrol on thedevelopment of mouse embryo and its inhibitory effect onpreimplantation mouse embryo development. The mech-anism by which the arrest of mouse embryos at thetwo-cell stage is induced by resveratrol treatment andovercome by PFT-a pretreatment is not known. Therefore,the initial aim of the present study was to evaluate theeffects of resveratrol on embryo proliferation, apoptosis,and blastocyst development. Furthermore, we examinedthe effect of supplementation with PFT-a on apoptosis orresveratrol-triggered arrest in the preimplantation em-bryonic development.

2. Materials and methods

2.1. Animals

Mice B6D2F-1 (C57BL/6J � DBA/2) aged 8 to 10 weekswere obtained from Shizuoka Laboratory Center and OrientBio (Seoul, Korea). Animal studies were performed ac-cording to the Institutional Animal Care and Use Commit-tee of Konkuk University, Seoul, Korea.

2.2. Preparation and procurement of media

All chemicals used in the preparation of media werepurchased from Sigma-Aldrich (St. Louis, MO, USA). Pifi-thrin-a and resveratrol were dissolved in 0.3% DMSO andkept frozen as a stock solution (84 mmol/L) until theaddition to the medium [29]. Embryo culture medium,potassium simplex optimized medium (KSOM) was pur-chased from Specialty Media (Sigma-Aldrich). Amino acidspurchased from Sigma-Aldrich were added to KSOM. Allembryo manipulations outside the incubator were per-formed in modified Chatot-Ziomek-Bavister (CZB) con-taining 20 mmol/L of HEPES, 5 mmol/L of NaHCO3, and0.1 mg/mL of polyvinyl alcohol (PVA), pH 7.4 (CZB-HEPES).

2.3. Embryo collection and PFT-a or resveratrol treatment

Female B6D2F-1 mice (aged 6–8 weeks) were super-ovulated by injection of 5 IU of equine chorionic eCG, fol-lowed 48 hours later by the injection of 5 IU of hCG, andthen mated with male B6D2F-1 mice. The day a vaginalplug was found was defined as Day 0 of gestation. Plug-positive females were separated for experimentation. Zy-gotes were obtained by opening the ampulla 20 hours afterhCG administration using CZB-HEPES medium. For furtherstudies, 120 zygote embryos were incubated in 30 mL ofKSOMmedium containing 10 mmol/L of PFT-a covered withmineral oil. After incubation for 1 hour, the pretreated

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873864

embryos were washed twice in KSOM medium to removePFT-a and transferred into fresh KSOM medium containinga different range of concentrations of resveratrol (0, 0.5, 1,and 2 mmol/L) for a further 24 hours of incubation. Next,each treated embryos were washed with Caþ2- and Mgþ2-free PBS containing 4 mg/mL of BSA and incubated in ahumidified incubator at 37 �C under 5% CO2 in air or sub-jected to each experiment. Unless specified otherwise, allexperiments were carried out following a 24 hours oftreatment with resveratrol after pretreatment with PFT-afor 1 hour. Each experiment was repeated at least threetimes.

2.4. Real-time quantitative reverse transcriptase–polymerasechain reaction

Total RNA was prepared using the RNeasy Mini Kit(Qiagen Inc., Valencia, CA, USA) according to the manu-facturer’s protocol. Reverse transcription was performedusing the QuantiTect Reverse Transcription kit (Qiagen Inc.,Valencia, CA, USA), and quantitative real-time polymerasechain reaction (qRT-PCR) was performed using SYBR GreenqPCR Master Mix (Thermo Scientific Fermentas, Göteborg,Sweden), all according to the manufacturers’ instructions.Triplicate samples were analyzed for each gene, and thehousekeeping gene b-actin was used as a control. Theexpression level was evaluated by 2�OOCt. Primers areshown in Table 1.

For qRT-PCR, 20 embryos from each treated groups werewashed in Caþ2- and Mgþ2-free PBS, snap frozen in liquidN2, and stored at �70 �C. The target complementary DNA(cDNA) synthesis was carried out following the protocol ofthe Transcriptor First Strand cDNA Synthesis Kit (Roche).The primer sequences used in this study are presented inTable 1. The PCRs were performed using real-time PCRequipment (ABI 7800; Applied Biosystems, Foster City, CA,USA), according to the manufacturer’s instructions. Eachwell contained 1 mL of cDNA, 10 mL of 2 � Maxima SYBRGreen/ROX qPCR Master Mix (Thermo Scientific Fermen-tas), 2 mL of each primer, and 7 mL of water. The PCR pro-gram was as follows: denaturation (95 �C for 10 minutes),amplification and quantification repeated 40 times (95 �Cfor 10 seconds, 55 �C–60 �C for 30 seconds, and 72 �C for

Table 1Primer sets used in this study.

Gene name Accession number Primer sequences (forward/reve

h2afz NM_016750 GTGGACTGTATCTCTGTGAA/GGTp53 AB020317 GGAGTATTTGGACGACCG/TCAGp21 BC_002043 ATGTCCAATCCTGGTGATG/CAACCdk1 NM_007659 AATCCAAGCCTTCTAATATC/ACACdk6 NM_009873 CTGGTGTGAGATGTTATCATT/TABax NM_007527 CGAGCTGATCAGAACCATCA/GABak1 NM_007523 TCCACACTAGAGAACTAC/GGTTCBok NM_016778 CTTCTTGCTTAGGCTATT/ATCTCTBcl-2 NM_009741 ACTGAATGTAGATAATGG/TAACTBcl-xl NM_009743 AAGCGTAGACAAGGAGAT/TAGGNoxa NM_021451 TAGTAACCTGAGTTCTTC/ATCACPuma NM_133234 ACAATCTCTTCATGGGACTC/GTGSmac/Diablo NM_023232 GTCTTCCTTCGCTCCCTA/TTCTCTATF3 NM_007498 AGGACTCTGGCTACTGTTA/AGGCCullin 3 NM_016716 CGATTCTTACCAAGTCCAGTTG/T

30 seconds, with a single fluorescent measurement),melting curve analysis (65 �C–95 �C), with a heating rate of0.2 �C/s and continuous fluorescence measurement, andfinal cooling to 12 �C.

2.5. Acridine orange and ethidium bromide double staining

DNA-binding dyes acridine orange (AO) (Sigma-Aldrich)and ethidium bromide (EB) (Sigma-Aldrich) were used forthe morphologic differentiation between viable and deadcells [31]. Acridine orange is taken up by both viable andnonviable cells and emits green fluorescence if intercalatedinto DNA. Conversely, EB is taken up only by nonviable cellsand emits red fluorescence on intercalation into DNA. Aftertreatment with 2 mmol/L of resveratrol for 24 hours, 20embryos arrested at the two-cell stage (n ¼ 20, r ¼ 3) weredetached, washed in PBS, and stained with a mixture of AO(100 mg/mL) and EB (100 mg/mL) at room temperature for30 minutes. The stained embryos were observed using afluorescence microscope at �200 magnifications. Eachexperiment was repeated at least three times.

2.6. Active p53 staining

Approximately 50 embryos arrested at the two-cellstage or control embryos were incubated for 2 hours withlabeling in a mixture of mouse monoclonal anti-p-p53antibody (3 mg/mL; Cell Signaling Technology, Beverly,MA, USA). After the embryos were washed twice in PBS-BSA, they were incubated for 1 hour in a mixture of AlexaFluor 488-labeled goat anti-mouse immunoglobulin (Ig) Gas the conjugated secondary antibody (1: 200 dilution;Invitrogen, Carlsbad, CA, USA). After the embryos werewashed thoroughly, they were mounted on slides usingVectashield mounting medium and observed by confocalfluorescence microscopy. Each experiment was repeated atleast three times.

2.7. Assessment of Oct3/4 and Cdx2 expressions

Tenblastocysts fromeachgroup (n¼10, r¼3)werefixedfor 30 minutes in PBS-PVA with 4% paraformaldehyde. Thefixed embryos were then washed twice in PBS-PVA and

rse) Tm (�C) Amplification length (bp)

TGGTTGGAAGGCTAA 60 89TCTGAGTCAGGCCC 56 350TGCTCACTGTCCAC 54 87CTAATCACCGTCTTA 60 132GTCAGAGCAGGAAGTG 60 85AAAATGCCTTTCCCCTTC 56 283AAGTAATCATAGGT 56 81TGTTCATTGGTC T 60 119GTAACTGATAAGG 60 188TGGTCATTCAGATAGG 60 76AATCCATCCAATA 50 99TAGGCACCTAGTTGG 50 78AGCATGTGCTGAATG 53 94TAGGAATACTGGGATA 55 127GCGATCCTCAGGTGTTC 55 88

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873 865

stored overnight at 4 �C in PBS supplemented with 2% BSA(PBS-BSA; Sigma-Aldrich) and 0.1% triton X-100 (NacalaiTesque Inc., Kyoto, Japan). To stain the trophectoderm (TE)and inner cell mass (ICM), the samples were incubated for90 minutes at room temperature in mouse anti-Cdx2 IgG(1:100; BioGenex), a TE marker, and rabbit anti-Oct3/4 IgG(1:100; POU domain, class 5, transcription factor 1, alsoknown as Oct3/4; Santa Cruz Biotechnology Inc., Santa Cruz,CA, USA), an ICM marker. After the samples were washedtwice in PBS-BSA, they were incubated with Alexa 568-labeled goat anti-mouse IgG and Alexa Fluor 488-labeledchicken anti-rabbit IgG antibody (1:100; Molecular ProbesInc., OR, USA). After threewashes in PBS-BSA for 10minuteseach, the nuclei of blastocyst embryos were counterstainedwith thiazole orange derivative-Pro-3 iodide. After thesamples were washed thoroughly, they were mounted onslides using vector shield mounting medium (Vector Labo-ratories Inc., Burlingame, CA, USA) and observed with anepifluorescencemicroscope. Each experimentwas repeatedat least three times.

2.8. Bromodeoxyuridine incorporation assay

The bromodeoxyuridine (BrdU) assay was performedusing the BrdU Cell Proliferation Assay Kit (RocheDiagnostics GmbH, Mannheim, Germany) according to themanufacturer’s instructions. In brief, 20 embryos (n ¼ 20,r ¼ 3) were cultured in BrdU-labeling KSOM medium(10 mmol/L BrdU concentration) for 1 hour at 37 �C and thentreatedwith resveratrol for 12 hours, with or without PFT-apretreatment for 1 hour. After incubation, treated embryoswere washed three times with 0.1% polyvinylpyrrolidone(PVP; Sigma-Aldrich) in PBS. To remove the zona pellucida,the embryos were incubated with acidic Tyrode’s solution.The embryos were fixed in methanol for 30 minutes andwashed six times with 0.1% PVP-PBS. The embryos weresubsequently incubated in 2% Triton X-100 for 1 hour,washed six times with 0.1% PVP-PBS, and blocked fornonspecific antigen-antibody reactions in 5% BSA/PBS for1 hour. The embryos were incubated with anti-BrdUmousemonoclonal antibodies (diluted 1:10 with incubationbuffer) overnight at room temperature, washed three timeswith blocking solution, and incubated in sheep anti-mouseIg fluorescein (diluted 1:10 with PBS) for 2 minutes at roomtemperature. Embryos were photographed under a fluo-rescence microscope, and embryos with BrdU-positivenuclei were counted. To ensure the validity of the experi-ment, we have performed several control experimentsusing BrdU reagents without cells, BrdU with resveratrol,and BrdU and culture media. Each experiment wasrepeated at least three times.

2.9. Statistical analysis

All data are expressed as the mean � standard error ofthe mean and compared using the Student t test, ANOVA,and Duncan test with Stat View software version 5.0 (SASinstitute Inc., Cary, NC). All experiments were replicated atleast three times. The results were considered significant at*P < 0.05, **P < 0.01.

3. Results

To assess the potential antiproliferative activity of resver-atrol at the level of mouse preimplantation embryos, anevaluation of its dose-dependent effects was performed. Theeffect of resveratrol as a function of the incubation concen-tration on the viability of mouse preimplantation embryos isshown in Figure 1. In the absence of resveratrol, 90.41�0.45%and 90.77 � 1.22% of zygotes in KSOM medium alone andKSOM containing 0.3% DMSO developed to the blastocyststage 72 hours after the initiation of culture, respectively.However, thepercentageof embryos reaching themorula andblastocystdevelopmental stages (4.65�0.55%; *P<0.05)wassignificantly reduced even at relatively low concentrations of0.5 mmol/L of resveratrol (Fig. 1A, B).

Bromodeoxyuridine assay was performed to analyzecell division in resveratrol-treated embryos and confirmthe inhibitory effects of the concentrations used in thedevelopment of mouse preimplantation embryo comparedwith the control embryos. By counting BrdU-positive cells,we detected a significant decrease in proliferation amongembryos at the two-cell stage in response to 0.5 to 2 mmol/Lof resveratrol (Fig. 1C): most of the two-cell embryosshowed very weakly stained BrdU-positive nuclei, whereascontrol-derived two-cell embryos retained strong BrdUstaining in the nuclei for 24 hours, suggesting a significantreduction in cell cycle progression of two-cell embryosafter resveratrol treatment.

To further characterize resveratrol-induced changes atthe molecular level, the mouse zygote-stage embryos werecultured with resveratrol and the expression of genesrelated to apoptosis (p53, p21, Bax, Bcl-2, Bak1, Bok, Bcl-xL,Smac/Diablo, puma, and Noxa), early stress-response gene(ATF3), and cell cycle (Cullin 3, cyclin-depend kinase [Cdk]1and Cdk6) evaluated using real-time qRT-PCR (Fig. 2). Thetumor suppressor p53 is a multifunctional transcriptionfactor that drives the expression of genes involved in theembryonic growth arrest, DNA repair, senescence, andapoptosis [32]. The expression levels of p53, p21, ATF3,Smac/Diablo, Bax, Bak, and Bok mRNA were significantlyincreased after resveratrol treatment in a dose-dependentmanner, whereas the expressions of Bcl-2 and Bcl-xLmRNAwere not altered (Fig. 2). However, Cdk1 and Cullin 3mRNA expressions were significantly decreased comparedwith control. We examined the expression of active p53protein in each group by visualizing p53 protein expressionusing p53 antibody sensitive to active p53 before and afterincubation with resveratrol. Active p53 positive signal inembryos arrested at the two-cell stage was localized in thenucleus after resveratrol incubation, whereas no stainingwas observed in the nuclei of control two-cell embryos(Fig. 3), indicating that expression of active p53 inducedapoptosis-related signals in preimplantation mouse em-bryos because of resveratrol treatment. Taken together,proapoptotic signals arising from the inside of the cell afterresveratrol treatment may result in the activation of thep53 transcription factor, promoting the expression of pro-apoptotic factors and cell cycle-related genes, and sup-pressing antiapoptotic factors (Figs. 2 and 3).

As shown in Figure 4A, treatment with PFT-a, a revers-ible inhibitor of p53-mediated apoptosis, ameliorated

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873866

blastocyst developmental capability of two-cell embryoscompromised by resveratrol treatment. As shown inFigure 4B, PFT-a treatment ameliorates the blastocystdevelopmental ratio by approximately 50% compared withthe resveratrol-treated group. Unlike the cells treated with1 to 2 mmol/L of resveratrol alone, cells treated with acombination of PFT-a and resveratrol showed weak AO/EBdouble staining (Fig. 4C). After PFT-a treatment, theexpression levels of p53, p21, ATF3, Smac/Diablo, Bax, Bak,and BokmRNAwere significantly decreased compared withthe resveratrol-treated group (P < 0.01) and slightly highercompared with the control cells (Fig. 5A). Notably, PFT-atreatment appears to protect the preimplantation embryosfrom resveratrol-triggered apoptosis by suppressing thep53-dependent transcriptional activation mechanism thattakes place downstream of the mitochondria. Takentogether, our observations indicate that PFT-a partiallyameliorates the resveratrol-induced embryonic cell deathand also overcomes the arrest of embryonic developmentat the two-cell stage.

Next, we investigated whether PFT-a treatment canalter the localization of expression of active p53. Mousezygotes were cocultured with resveratrol and PFT-a, andthe localization of active p53 was analyzed by confocalmicroscopy at 24 hours after in vitro culture. Of note, PFT-atreatment resulted in a very weak signal of active p53expression in embryo nuclei compared with theresveratrol-treated group (Fig. 5D), indicating that the two-cell arrest and cytotoxicity were caused by the expressionof active p53 induced by resveratrol treatment, whereasPFT-a treatment ameliorates two-cell embryo damage bydecreasing the expression of active p53 in the nuclei of

Fig. 1. Evidence of mouse embryo arrest at the two-cell stage after treatment withincubation with different doses (0, 0.5, 1, and 2 mmol/L) of resveratrol in the KSOM min control conditions (incubated in KSOM only), in KSOM containing 0.3% DMSO, anresveratrol, respectively. Zy, 2c, 4c, 8c, Mo, and Bl indicate zygote, 2-cell, 4-cell, 8-celthiazole orange derivative-Pro-3 iodide. Res indicate incubation with resveratrol. Imin triplicates; data shown represent the mean of three independent experiments.deoxyuridine; KSOM, potassium simplex optimized medium. (For interpretation of tof this article.)

mouse embryos. Taken together, our data suggest that theinduction of active p53 expression in response to resvera-trol treatment during in vitro culture of mouse preim-plantation embryos could increase p21-mediated celldeath.

As shown in Figure 5B, C, treatment with both resver-atrol and PFT-a elicited a significantly higher green fluo-rescence intensity of BrdU compared with the intensityobserved in cells treated with resveratrol alone. However,the green fluorescence intensity of BrdU is slightlydecreased compared with that observed in control-treatedtwo-cell embryos. This observation suggests that PFT-apartially ameliorates the abnormal embryo cell cyclecaused by resveratrol treatment. To examine the totalnumber of cells in blastocysts, along with the expressionsof Cdx2 and Oct3/4, the blastocysts were fixed and exam-ined with antibodies raised against thiazole orangederivative-Pro-3 iodide, Cdx2, and Oct3/4. The total num-ber of cells, Cdx2- and Oct3/4-positive control cells, amongembryos treated with PFT-a with resveratrol and PFT aloneis shown in Figure 6. The differential staining revealed thatembryos treated with PFT-a or a combination of resveratroland PFT-a had no significant differences in the numbers ofICM, TE, and total nuclei compared with the control group.Additionally, no difference was observed in the ratio of thenumber of ICM to TE nuclei between control and cellstreated with a combination of resveratrol and PFT-a.Although resveratrol treatment elicited complete arrest ofembryos at the two-cell stage, the combination of resver-atrol and PFT-a recovered the cell numbers to the level ofcontrol groups. This observation suggests that PFT-a, a p53inhibitor, can lead to a reduction in resveratrol-induced

resveratrol. (A) Representative embryos arrested at the two-cell stage afteredium, respectively. (B) Relative blastocyst developmental rate from zygote

d in KSOM medium containing 0.5 (Res 0.5), 1 (Res 1), and 2 mmol/L (Res 2) ofl morula and blastocyst, respectively. (C) BrdU assay with nuclei stained withages are presented at �100 magnification. The experiments were performedError bars represent standard error of the mean. **P < 0.01. BrdU, bromo-he references to color in this Figure, the reader is referred to the Web version

Fig. 2. Reverse transcriptase–quantitative polymerase chain reaction (qRT-PCR) analysis. The qRT-PCR analysis of Bax, Bak1, Bok, Bcl-2, Bcl-xL, Bid, Bax/Bcl-2ratio, Puma, and Noxa gene expressions in control conditions, control containing 0.3% DMSO, and in KSOM medium containing 0.5 (Res 0.5), 1 (Res 1), and2 mmol/L (Res 2) of resveratrol, respectively. The experiments were performed in triplicates; data shown represent the mean of three independent experiments.Error bars represent standard error of the mean. *P < 0.05, **P < 0.01. KSOM, potassium simplex optimized medium.

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873 867

cellular injury and ultimately protect or rescue the em-bryonic developmental capability.

4. Discussion

During the past two decades, most of the reportedin vitro data have been obtained after exposing cells to

resveratrol in the micromolar range (up to 200 mmol/L) ofconcentrations [33]. However, dietary doses of resveratrolare very low, and consequently, human physiological con-centrations of this molecule and its metabolites are notusually found greater than 50 nmol/L and 2 mmol/L,respectively [34,35], although exceptionally high plasmaconcentrations of resveratrol and derived metabolites (4.2

Fig. 3. Active p53 staining pattern analysis in control and resveratrol-supplemented groups. (A) More than 50 immunostained embryos were examined in eachgroup and each experiment was repeated at least three times. In the zygotes treated with 1 to 2 mmol/L of resveratrol (Res), active p53 positive staining (observedin 50 of the 50 arrested embryos) was localized in the nuclei of the embryos arrested at the two-cell stage. (B) Approximately 30% showed positive staining in0.5 mmol/L of resveratrol-treated two-cell embryonic nuclei (�). p-p53-fluorescein isothiocyanate indicates active p53 antibody. Images are shown at �200magnification. Ctrl, control; LM, light microscopy; Res, resveratrol. (For interpretation of the references to color in this Figure, the reader is referred to the Webversion of this article.)

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873868

and 18 mmol/L, respectively) have been reported after theingestion of a high micronized resveratrol dose (5 g) [36].Taking into account the literature on resveratrol and aimingto faithfully reproduce the human physiological conditions,we used resveratrol concentrations in the micromolarrange (0, 0.5, 1, and 2.0 mmol/L) in our experimental setup.

Mouse preimplantation embryos exhibit a number ofsignificant advantages as a reproductive toxicologic model.Previous studies have reported that resveratrol protects thepreimplantation embryos during in vitro culture by sup-pressing apoptosis induced by 2-bromopropane [25],methylglyoxal [26], and ethanol [27]. Similarly, anothergroup reported that supplementation of resveratrol into theculture medium enhances the development of pig embryosin vitro [28,29]. In this study, however, we observed cyto-toxic effects after supplementation with resveratrol inmouse preimplantation embryos, in spite of a relative lowdosage: most of the preimplantation embryos treated withresveratrol in the range of 1 to 2 mmol/Lwere arrested at the

two-cell stage (Fig.1B). Of note, noblastocyst-stageembryoswere obtained at these resveratrol concentrations. There-fore, these findings support the concept previously pro-posed by Liu et al. [30], suggesting that the dose ofresveratrol determines the severity of its effect on the pre-implantation mouse embryo development. In examiningthe underlyingmechanism of resveratrol-induced cytotoxiceffects on thepreimplantation embryos,wehave focused onthe expression of active p53. In embryo groups treatedwithresveratrol concentrations greater than 0.5 mmol/L, wedetected a predominance of active p53 positive signal in thetwo-cell embryonic nuclei (Fig. 3). Activation of p53 regu-lates the extrinsic and intrinsic pathways of apoptosis[37,38]. The extrinsic apoptotic pathway involves binding ofthe death ligand to a death receptor, resulting in the acti-vation of a cell death cascade. In contrast, in the intrinsicapoptotic pathway, mitochondrial membrane potential isaltered by a proapoptotic member of the Bcl-2 family, suchas Bax. Bax forms heterodimers with Bcl-2 or Bcl-xL, with

Fig. 4. Pifithrin-a (PFT-a) suppresses resveratrol-induced p53 accumulation in two-cell embryo nuclei and partially ameliorates the developmental defects intwo-cell embryos compromised by the resveratrol treatment. (A) A representative two-cell arrested or ameliorated embryos after supplementation with differentdoses (0, 0.5, 1, and 2 mmol/L) of resveratrol or a combination of PFT-a and resveratrol into KSOM medium, respectively. (B) The relative blastocyst developmentalrate in control conditions (KSOM only), KSOM containing 0.3% DMSO, and KSOM medium containing 1 mmol/L resveratrol and PFT-a (Res 1 þ PFT), 2 mmol/L ofresveratrol and PFT-a (Res 2 þ PFT), 2 mmol/L of resveratrol alone (Res 2), and PFT-a alone (PFT-a), respectively. Zy, 2c, 4c, 8c, Mo, and Bl indicate zygote, 2-cell, 4-cell, 8-cell morula and blastocyst, respectively. Error bars represent standard error of the mean. **P <0.01. (C) Acridine orange and ethidium bromide assay.Acridine orange assay was used for staining the nuclei of viable and nonviable embryos, whereas ethidium bromide assay was used for staining the nuclei ofnonviable embryos. Red color indicates nonviable or dying two-cell embryos. Images are presented at �200 magnification. KSOM, potassium simplex optimizedmedium. (For interpretation of the references to color in this Figure, the reader is referred to the Web version of this article.)

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873 869

these interactions playing a role in the maintenance of abalance between the apoptotic and antiapoptotic factors.TheqRT-PCRanalysis revealedadose-dependent increase inupstream mediators of the intrinsic pathway, such as p53,p21, Bax, and Puma gene expressions after resveratroltreatment (Fig. 2). In contrast, the expression of Bcl-2, aprosurvival molecule, was not significantly changed byresveratrol supplementation, whereas the Bax/Bcl-2expression ratio was significantly altered. Analysis of theexpression of active p53 supported this observation,demonstrating the upregulation of p53 target genes Bax,p21, and Puma, and inhibition of Bcl-2 by resveratrolsilencing in mouse zygote-stage embryos. Additionally,supplementation of zygote embryos with 1 to 2 mmol/L ofresveratrol resulted in two-cell block. Therefore, proapo-ptotic p53 target genes such as p21 and Puma are upregu-lated after cellular damage in a p53-dependent manner,suggesting that two-cell embryos may use the p53 tran-scriptional pathwayas a second line of defense to ensure celldeath in cases in which active p53 fails. Taken together, thefindings of this study illustrate the toxicity of resveratrol andits role in embryonic development.

Furthermore, we extended our study to examine theinvolvement of p53 in resveratrol-induced two-cell embryoarrest and cell death by using PFT-a as a p53 inhibitor.Pifithrin-a suppresses p53 apoptotic signaling by inter-fering with its nuclear translocation and thereby inhibitingthe transcriptional activation of p53-inducible genes[21,39,40]. In this study, the experiments using supple-mentation with a combination of PFT-a and resveratrolrevealed that PFT-a decreases resveratrol-induced

accumulation of active p53 in two-cell embryo nuclei(Fig. 3). Pifithrin-a treatment decreased the expression ofBax, whereas Bcl-2 levels were not decreased, suggestingthat PFT-a decreases the Bax/Bcl-2 ratio and causes theembryos to become nonapoptotic. The decreased Bax/Bcl-2expression ratio observed after PFT-a supplementationsuggests that PFT-a is actively involved in the regulation ofp53-mediated apoptotic processes, whereas resveratrol isthe cause of the two-cell embryo arrest. In this study, wehave shown that active p53 accumulates in the two-cellembryonic nuclei in response to DNA damage induced bytreatment with resveratrol, whereas p53 activation furthertransactivates its target gene p21. In contrast with ourpresent findings, previous in vitro studies have reported arelatively high dose of resveratrol to be cytoprotective inembryos at morula stage, preventing the induction ofapoptosis by two-bromopropane [25], methylglyoxal [26],and ethanol [27]. The difference in the observed resveratroleffects between the studies could reflect different resver-atrol incubation times or the differences at developmentalstages studied, i.e., the two-cell embryos compared withthe morulae.

Late two-cell embryos at 46 hours after eCG treatmentwere used as controls, because the nuclei at this stage areknown to be transcriptionally active [41]. In the controlgroup, approximately 90% of the embryos showed verystrong BrdU-positive staining. However, BrdU staining inmost of the two-cell embryos cultured with resveratrol for24 hours was significantly attenuated or completely absent(Fig. 1C). This observation suggested that the resveratrol-treated embryos lost their proliferation at the two-cell

Fig. 5. Pifithrin-a (PFT-a) supplementation ameliorates the developmental capability of mouse preimplantation embryos compromised by the resveratroltreatment. (A) Real-time qRT-PCR analysis. The qRT-PCR analysis of Bax, Bcl-2, Bax/Bcl-2 ratio, p53, and p21 gene expressions in control, control containing 0.3%

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873870

Fig. 6. Oct3/4 and Cdx2 staining pattern analysis. (A) Differential expressions of Oct3/4 and Cdx2 in blastocyst-stage embryos treated as controls (�), or withresveratrol þ PFT-a (Res þ PFT-a), PFT-a, or resveratrol. Of note, all resveratrol-treated zygote embryos were arrested at the two-cell stage. (B) Blastocystsdifferentially stained for ICM and TE nuclei were counted based on the number of Oct4- or Cdx-positive cells. The experiments were performed in triplicates; datashown represent the mean of three independent experiments. Error bars represent standard error of the mean. (C) Bar graph indicated that the ratio of ICM:TE ineach blastocyst groups. ICM, inner cell mass; PFT-a, pifithrin-a; TE, trophectoderm. (For interpretation of the references to color in this Figure, the reader isreferred to the Web version of this article.)

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873 871

stage. We subsequently investigated whether resveratrol-induced arrest of embryos at the two-cell stage can beameliorated by PFT-a, a reversible inhibitor of p53 tran-scriptional activity. Embryos treated with resveratrol andPFT-a recovered from the blocking: at the late two-cellembryo stage, with approximately 70% of the embryosshowing very strong BrdU-positive staining pattern,whereas 30% of the embryos showed weak BrdU staining(Fig. 5B, C). Interestingly, the cells treated with a combi-nation of PFT-a and resveratrol showed weak AO/EB doublestaining (Fig. 4C). Furthermore, these results are in agree-ment with the observation of the induction of blastocystdevelopment by approximately 50% after coincubationwith both resveratrol and PTF-a in a dose-dependentmanner (Fig. 4B). Because embryonic toxicity associated

:

DMSO, KSOM medium containing 2 mmol/L of resveratrol (R2), 2 mmol/L of resverauptake staining assay and measurement of fluorescence intensity. (D) Active p53mented groups. In resveratrol-supplemented group (Res), active p53 staining was lotreatment with both resveratrol þ PFT-a (PFT-a) was dramatically decreased in twderived two-cell embryos was not observed. Images are presented at �200 magnisent the mean of three independent experiments. Error bars represent standard emicroscopy; KSOM, potassium simplex optimized medium; qRT-PCR, reverse tranreferences to color in this Figure, the reader is referred to the Web version of this

with resveratrol treatment was partially blocked by coin-cubation with PFT-a, we conclude that PFT-a amelioratesdevelopmental defects in mouse preimplantation embryoselicited by resveratrol.

It has been reported in previous studies that p53 latencyin the preimplantation embryos during in vitro culture ismaintained by the phosphatidylinositol 3-kinase andserine and threonine specific protein kinase-mediatedactivation of mouse mutation 2 [42]. Suppression of phos-phatidylinositol 3-kinase–induced serine and threoninespecific protein kinase pathway was shown to result in theaccumulation of p53 and developmental arrest [42–44],indicating that p53 latency is important for normal pre-implantation embryonic development. Although theinvolvement of p53 in the stress response of the

trol þ PFT-a (R2 þ PFT), and PFT-a alone (PFT), respectively. (B and C) BrdUstaining pattern analysis in control, resveratrol, resveratrol þ PFT-a supple-calized in the two-cell embryonic nuclei, whereas active p53 signaling aftero-cell embryonic nuclei. Of note, any active p53 positive signal in control-fication. The experiments were performed in triplicates; data shown repre-rror of the mean. *P < 0.05, **P < 0.01. BrdU, bromodeoxyuridine; LM, lightscriptase–quantitative polymerase chain reaction. (For interpretation of thearticle.)

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873872

preimplantation embryos has been controversial [45,46],the findings of our study indicate that the accumulation ofactive p53 in the two-cell embryo nuclei is involved in thetwo-cell developmental arrest induced by incubation withresveratrol.

Among the several factors suggested tobe involved in theeffect of resveratrol, SIRT1, amember of sirtuin deacetylasesfamily, is oneof themain targets. Recent studies suggest thatmammalian SIRT1 plays an important role in eliciting theadequate cellular response to metabolic stresses such asnutrient deprivation or overload, whereas also protectingthe cells from the detrimental effects of such stress [47,48].Sirtuin1 candeacetylate several lysine residues in the tumorsuppressor p53 [14,15]. The activity of p53 can be regulatedthrough a number of posttranslational modifications,including phosphorylation, acetylation, methylation, andsumoylation [49]. Acetylation is reported to play an impor-tant role in stabilization, nuclear localization, and tran-scriptional activation of p53 [50] and can lead to p53activation independently of its phosphorylation status. Inthis study,weobservedadose-dependentoverexpressionofimmediate early genes such as the stress-response geneATF3 after resveratrol treatment. Additionally, our resultssuggest that resveratrol supplementation in the embryoculture medium suppresses Cullin 3 and Cdk1 gene expres-sions in two-cell arrested embryos. The Cdk1 is known toplayan important role inmitosis andcandrive the Sphase inthe absence of Cdk2. In addition, Cdk1-null embryos wereincapable of further division, suggesting that Cdk1 isessential for cell division in early stage embryos [51]. Cullin3-null embryos showed abnormal regulation of the S phase[52]. Previously published study reported that resveratrolinduces apoptosis by upregulating the expressions of Bax,Bak, Puma, Noxa, Bim, and p53, whereas simultaneouslydownregulating the expressions of Bcl-2, Bcl-xL, Mcl-1, andsurvivin genes. Furthermore, resveratrol causes growth ar-rest at the G1 and G1/S phases of cell cycle by inducing theexpression of Cdk inhibitors p21/WAF1/CIP1 and p27/p27(cyclin-dependent kinase inhibitor 1B). Our findings sup-port the concept proposed by Oltvai et al. [53], suggestingthat the ratio of Bcl-2 to Bax determines whether a cell livesor dies. Resveratrol-treated embryos, therefore, showed notonly lower expressions of cell cycle–associated genes, butalso increased levels of apoptosis-related genes such as p53and p21 genes.

Previous reports suggested that Oct3/4 is essential forthe maintenance of pluripotent cells. Twofold upregulationor downregulation of Oct3/4 in embryonic stem cells cau-ses a differentiation to endoderm and mesoderm or ecto-derm, respectively, indicating that keeping Oct3/4 levelswithin a precise range is critical for maintaining pluripo-tency [54]. The caudal-type homeodomain transcriptionfactor Cdx2 expressed specifically in the developing TE isrequired for the proper development of TE in mice [55]. Inour studies, the treatment of embryos with PFT-a or acombination of resveratrol and PFT-a had no significantimpact on Oct3/4 and Cdx2 levels (Fig. 6) or the ratio be-tween TE and ICM.

The present study showed that a significant number ofembryos treatedwitha lowconcentrationof resveratrolwerearrested at the two-cell stage, whereas supplementation of

the culture mediawith PFT-a or a combination of resveratroland PFT-a reduced the number of embryos arrested at thetwo-cell stage, possibly because of decreased expression ofp53 or increased levels of SIRT1. Resveratrol significantlyincreased the expressions of p53, p21, Atf3, smac/Diablo, Bax,Bak1, Bok, and Noxa genes, whereas Cullin 3 and Cdk1 geneexpressionswere decreased. Resveratrol-induced increase inthe expression of active p53 in embryonic nuclei could bedecreased by the supplementation with PFT-a. These pro-posed studies suggest that supplementation of culturemediawith PFT-a for mouse embryos appears worthy of consider-ation and also provides the knowledge of PFT-a of themechanismspresent in the embryo and its surroundings thatwould help to improve the culture media used to obtainquality embryos under in vitro conditions. Furthermore,assessing the protective effect of PFT-a could help in devel-oping method to improve current reproductive technologiesand even alleviate some unexplained causes of embryodevelopment. However, further studies in humans are war-ranted to provide proof-of-principle data and evaluate theefficacy and safety of resveratrol before the describedapproach can be applied in human embryo culture.

Acknowledgment

This work was supported by Woo Jang-Choon(PJ007849) from the Rural Development Administration(RDA), Republic of Korea.

Competing interests

The authors declare no conflicts of interest.

References

[1] Aggarwal BB, Sundaram C, Malani N, Ichikawa H. Curcumin: theIndian solid gold. Adv Exp Med Biol 2007;595:1–75.

[2] Chirumbolo S. The role of quercetin, flavonols and flavones inmodulating inflammatory cell function. Inflamm Allergy Drug Tar-gets 2010;9:263–85.

[3] Darvesh AS, Aggarwal BB, Bishayee A. Curcumin and liver cancer: areview. Curr Pharm Biotechnol 2012;13:218–28.

[4] Ara C, Kirimlioglu H, Karabulut AB, Coban S, Ay S, Harputluoglu M,et al. Protective effect of resveratrol against oxidative stress incholestasis. J Surg Res 2005;127:112–7.

[5] Cerny D, Canova NK, Martinek J, Horinek A, Kmonickova E, Zidek Z,et al. Effects of resveratrol pretreatment on tert-butylhydroperoxideinduced hepatocyte toxicity in immobilized perifused hepatocytes:involvement of inducible nitric oxide synthase and hemoxygenase-1. Nitric Oxide 2009;20:1–8.

[6] Uhm SJ, Gupta MK, Das ZC, Lim KT, Yang JH, Lee HT. Effect of 3-hydroxyflavone on pig embryos produced by parthenogenesis orsomatic cell nuclear transfer. Reprod Toxicol 2011;31:231–8.

[7] Chan WH. Impact of genistein on maturation of mouse oocytes,fertilization, and fetal development. Reprod Toxicol 2009;28:52–8.

[8] ChanWH. Ginkgolides induce apoptosis and decrease cell numbers inmouse blastocysts. BiochemBiophysRes Commun2005;338:1263–7.

[9] Wu Z, Yang Y, Chen Y, Xia G, Zhang R. Effects of subcutaneousadministration of daidzein on blastocyst implantation in rats. FoodChem Toxicol 2005;43:167–72.

[10] Hsieh TC, Juan G, Darzynkiewicz Z, Wu JM. Resveratrol increasesnitric oxide synthase, induces accumulation of p53 and p21(WAF1/CIP1), and suppresses cultured bovine pulmonary artery endothelialcell proliferation by perturbing progression through S and G2.Cancer Res 1999;59:2596–601.

[11] She QB, Bode AM, Ma WY, Chen NY, Dong Z. Resveratrol-inducedactivation of p53 and apoptosis is mediated by extracellular-signal-regulated protein kinases and p38 kinase. Cancer Res 2001;61:1604–10.

J.-K. Jeong et al. / Theriogenology 83 (2015) 862–873 873

[12] Narayanan BA, Narayanan NK, Re GG, Nixon DW. Differentialexpression of genes induced by resveratrol in LNCaP cells: P53-mediated molecular targets. Int J Cancer 2003;104:204–12.

[13] ByunHS, Song JK, Kim YR, Piao L,WonM, Park KA, et al. Caspase-8 hasan essential role in resveratrol-induced apoptosis of rheumatoidfibroblast-like synoviocytes. Rheumatology (Oxford) 2008;47:301–8.

[14] Luo J, Nikolaev AY, Imai S, Chen D, Su F, Shiloh A, et al. Negativecontrol of p53 by Sir2alpha promotes cell survival under stress. Cell2001;107:137–48.

[15] Brooks CL, Gu W. Ubiquitination, phosphorylation and acetylation:the molecular basis for p53 regulation. Curr Opin Cell Biol 2003;15:164–71.

[16] Wong YT, Gruber J, Jenner AM, Ng MP, Ruan R, Tay FE. Elevation ofoxidative-damage biomarkers during aging in F2 hybrid mice:protection by chronic oral intake of resveratrol. Free Radic Biol Med2009;46:799–809.

[17] Milne JC, Lambert PD, Schenk S, Carney DP, Smith JJ, Gagne DJ, et al.Small molecule activators of SIRT1 as therapeutics for the treatmentof type 2 diabetes. Nature 2007;450:712–6.

[18] Yang SR, Wright J, Bauter M, Seweryniak K, Kode A, Rahman I. Sir-tuin regulates cigarette smoke-induced proinflammatory mediatorrelease via RelA/p65 NF-kappaB in macrophages in vitro and in ratlungs in vivo: implications for chronic inflammation and aging. Am JPhysiol Lung Cell Mol Physiol 2007;292:L567–76.

[19] Lei XH, Zhao D, Li YL, Li XF, Sun X, Du WZ, et al. Pifithrin-alphaenhances the survival of transplanted neural stem cells in strokerats by inhibiting p53 nuclear translocation. CNS Neurosci Ther2013;19:109–16.

[20] Nie L, Sasaki M, Maki CG. Regulation of p53 nuclear export throughsequential changes in conformation and ubiquitination. J Biol Chem2007;282:14616–25.

[21] Murphy PJ, Galigniana MD, Morishima Y, Harrell JM, Kwok RP,Ljungman M, et al. Pifithrin-alpha inhibits p53 signaling afterinteraction of the tumor suppressor protein with hsp90 and itsnuclear translocation. J Biol Chem 2004;279:30195–201.

[22] Misra UK, Pizzo SV. PFT-alpha inhibits antibody-induced activationof p53 and pro-apoptotic signaling in 1-LN prostate cancer cells.Biochem Biophys Res Commun 2010;391:272–6.

[23] Culmsee C, Zhu X, Yu QS, Chan SL, Camandola S, Guo Z, et al. Asynthetic inhibitor of p53 protects neurons against death inducedby ischemic and excitotoxic insults, and amyloid beta-peptide. JNeurochem 2001;77:220–8.

[24] Shin SM, Cho IJ, Kim SG. Resveratrol protects mitochondria againstoxidative stress through AMP-activated protein kinase-mediatedglycogen synthase kinase-3beta inhibition downstream ofpoly(ADP-ribose)polymerase-LKB1 pathway. Mol Pharmacol 2009;76:884–95.

[25] Chan WH. Resveratrol protects against 2-bromopropane-inducedapoptosis and disruption of embryonic development in blastocysts.Int J Mol Sci 2011;12:4991–5010.

[26] Huang FJ, Chin TY, Chan WH. Resveratrol protects againstmethylglyoxal-induced apoptosis and disruption of embryonicdevelopment inmouse blastocysts. Environ Toxicol 2013;28:431–41.

[27] Huang LH, Shiao NH, Hsuuw YD, Chan WH. Protective effects ofresveratrol on ethanol-induced apoptosis in embryonic stem cellsand disruption of embryonic development in mouse blastocysts.Toxicology 2007;242:109–22.

[28] Lee K, Wang C, Chaille JM, Machaty Z. Effect of resveratrol on thedevelopment of porcine embryos produced in vitro. J Reprod Dev2010;56:330–5.

[29] Kwak SS, Cheong SA, Jeon Y, Lee E, Choi KC, Jeung EB, et al. Theeffects of resveratrol on porcine oocyte in vitro maturation andsubsequent embryonic development after parthenogenetic activa-tion and in vitro fertilization. Theriogenology 2012;78:86–101.

[30] Liu M, Yin Y, Ye X, Zeng M, Zhao Q, Keefe DL, et al. Resveratrolprotects against age-associated infertility in mice. Hum Reprod2013;28:707–17.

[31] Carrizzo A, Forte M, Damato A, Trimarco V, Salzano F, Bartolo M,et al. Antioxidant effects of resveratrol in cardiovascular, cerebraland metabolic diseases. Food Chem Toxicol 2013;61:215–26.

[32] Oren M. Decision making by p53: life, death and cancer. Cell DeathDiffer 2003;10:431–42.

[33] Tome-Carneiro J, Larrosa M, Gonzalez-Sarrias A, Tomas-Barberan FA, Garcia-Conesa MT, Espin JC. Resveratrol and clinicaltrials: the crossroad from in vitro studies to human evidence. CurrPharm Des 2013;19:6064–93.

[34] Goldberg DM, Yan J, Soleas GJ. Absorption of three wine-relatedpolyphenols in three different matrices by healthy subjects. ClinBiochem 2003;36:79–87.

[35] Walle T, Hsieh F, DeLegge MH, Oatis Jr JE, Walle UK. High absorptionbut very low bioavailability of oral resveratrol in humans. DrugMetab Dispos 2004;32:1377–82.

[36] Brown VA, Patel KR, Viskaduraki M, Crowell JA, Perloff M, Booth TD,et al. Repeat dose study of the cancer chemopreventive agentresveratrol in healthy volunteers: safety, pharmacokinetics, andeffect on the insulin-like growth factor axis. Cancer Res 2010;70:9003–11.

[37] Ashkenazi A, Dixit VM. Death receptors: signaling and modulation.Science 1998;281:1305–8.

[38] Adams JM, Cory S. Bcl-2-regulated apoptosis: mechanism andtherapeutic potential. Curr Opin Immunol 2007;19:488–96.

[39] Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K,Coon JS, Chernov MV, et al. A chemical inhibitor of p53 that protectsmice from the side effects of cancer therapy. Science 1999;285:1733–7.

[40] Komarova EA, Gudkov AV. Chemoprotection from p53-dependentapoptosis: potential clinical applications of the p53 inhibitors. Bio-chem Pharmacol 2001;62:657–67.

[41] Minami N, Suzuki T, Tsukamoto S. Zygotic gene activation andmaternal factors in mammals. J Reprod Dev 2007;53:707–15.

[42] Jin XL, Chandrakanthan V, Morgan HD, O’Neill C. Preimplantationembryo development in the mouse requires the latency ofTRP53 expression, which is induced by a ligand-activated PI3kinase/AKT/MDM2-mediated signaling pathway. Biol Reprod2009;81:234–42.

[43] Jones SN, Roe AE, Donehower LA, Bradley A. Rescue of embryoniclethality in Mdm2-deficient mice by absence of p53. Nature 1995;378:206–8.

[44] Montes de Oca Luna R, Wagner DS, Lozano G. Rescue of early em-bryonic lethality in mdm2-deficient mice by deletion of p53. Nature1995;378:203–6.

[45] Favetta LA, Robert C, St John EJ, Betts DH, King WA. p66shc, but notp53, is involved in early arrest of in vitro-produced bovine embryos.Mol Hum Reprod 2004;10:383–92.

[46] Velez-Pardo C, Morales AT, Del Rio MJ, Olivera-Angel M. Endoge-nously generated hydrogen peroxide induces apoptosis via mito-chondrial damage independent of NF-kappaB and p53 activation inbovine embryos. Theriogenology 2007;67:1285–96.

[47] Chaudhary N, Pfluger PT. Metabolic benefits from Sirt1 and Sirt1activators. Curr Opin Clin Nutr Metab Care 2009;12:431–7.

[48] Feige JN, Lagouge M, Canto C, Strehle A, Houten SM, Milne JC, et al.Specific SIRT1 activation mimics low energy levels and protectsagainst diet-induced metabolic disorders by enhancing fat oxida-tion. Cell Metab 2008;8:347–58.

[49] Vousden KH, Lane DP. p53 in health and disease. Nat Rev Mol CellBiol 2007;8:275–83.

[50] Prives C, Manley JL. Why is p53 acetylated? Cell 2001;107:815–8.[51] Diril MK, Ratnacaram CK, Padmakumar VC, Du T, Wasser M,

Coppola V, et al. Cyclin-dependent kinase 1 (Cdk1) is essential forcell division and suppression of DNA re-replication but not for liverregeneration. Proc Natl Acad Sci U S A 2012;109:3826–31.

[52] Singer JD, Gurian-West M, Clurman B, Roberts JM. Cullin-3 targetscyclin E for ubiquitination and controls S phase in mammalian cells.Genes Dev 1999;13:2375–87.

[53] Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivowith a conserved homolog, Bax, that accelerates programmed celldeath. Cell 1993;74:609–19.

[54] Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R,et al. Interaction between Oct3/4 and Cdx2 determines trophecto-derm differentiation. Cell 2005;123:917–29.

[55] Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K,Beck F, et al. Cdx2 is required for correct cell fate specification anddifferentiation of trophectoderm in the mouse blastocyst. Devel-opment 2005;132:2093–102.