European Journal of Pharmacology 591 (2008) 66–72

Contents lists available at ScienceDirect

European Journal of Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /e jphar

Resveratrol protects primary rat hepatocytes against oxidative stress damage:Activation of the Nrf2 transcription factor and augmented activities ofantioxidant enzymes

Juan Andrés Rubiolo a, Gilles Mithieux b, Félix Victor Vega a,⁎a Departamento de Fisiología, Facultad de Veterinaria Universidad de Santiago de Compostela, 27002, Lugo, Spainb Inserm U855/UCBL, Faculté de Médecine Laennec, Rue G. Paradin, 69372, LYON cedex 08, France

⁎ Corresponding author. Tel./fax: +34 982 252231x22E-mail address: fevega@lugo.usc.es (F.V. Vega).

0014-2999/$ – see front matter © 2008 Elsevier B.V. Aldoi:10.1016/j.ejphar.2008.06.067

A B S T R A C T

A R T I C L E I N F O

Article history:

Oxidative stress is recogniz Received 25 January 2008Received in revised form 23 April 2008Accepted 8 June 2008Available online 22 June 2008

Keywords:Primary rat hepatocyteResveratrolOxidative stressCytoprotectionAntioxidant enzyme

ed as an important factor in the development of liver pathologies. The reactiveoxygen species endogenously generated or as a consequence of xenobiotic metabolism are eliminated byenzymatic and nonenzymatic cellular systems. Besides endogen defences, the antioxidant consumption inthe diet has an important role in the protection against the development of diseases product of oxidativedamage. Resveratrol is a naturally occurring compound which is part of the human diet. This molecule hasbeen shown to have many biological properties, including antioxidant activity. We decided to test ifresveratrol could protect primary hepatocytes in culture from oxidative stress damage and if so, to determineif this compound affects the cellular detoxifying systems and their regulation through the Nrf2 transcriptionfactor that regulates the expression of antioxidant and phase II detoxifying enzymes. Cell death by necrosiswas detected by measuring the activity of lactate dehydrogenase liberated to the medium. The activities ofantioxidant and phase II enzymes were measured using previously described methods. Activation of the Nrf2transcription factor was studied by confocal microscopy and the Nrf2 and its coding mRNA levels weredetermined by western blot and quantitative PCR respectively. Resveratrol pre-treatment effectivelyprotected hepatocytes in culture exposed to oxidative stress, increasing the activities of catalase, superoxidedismutase, glutathione peroxidase, NADPH quinone oxidoreductase and glutathione-S-transferase. Resver-atrol increases the level of Nrf2 and induces its translocation to the nucleus. Also, it increases theconcentration of the coding mRNA for Nrf2. In this work we show that resveratrol could be a useful drug forthe protection of liver cells from oxidative stress induced damage.

© 2008 Elsevier B.V. All rights reserved.

1. Introduction

Oxidative stress has recently been recognized as a fundamentalfactor in the pathologic changes observed in various liver diseases(Cortez-Pinto, 2001; Lai, 2002). Antioxidant and drug metabolizingenzymes represent twomajor defencemechanisms against xenobiotictoxicity. Electrophiles, radicals, and reactive oxygen species (ROS) areoften generated as intermediates or by-products of xenobioticmetabolism. These molecules, if not properly eliminated, can producelipid peroxidation and oxidation of DNA and other cellular compo-nents, which result in various acute and chronic tissue injuries,carcinogenesis, and aging (Halliwell et al., 1995a,b; Martin et al., 1996;Slaga, 1995). The accumulation of these harmful oxidants in the cell isprevented through the actions of small molecules such as glutathioneand vitamins, as well as through antioxidant and xenobiotic metabo-

217.

l rights reserved.

lizing enzymes (Rautalahti and Huttunen, 1994). The transcriptionfactor Nrf2 regulates the expression of many detoxifying genes such ascatalase, superoxide dismutase (SOD), UDP-glucuronosyltransferase,andγ-glutamylcysteine synthetase (Chan and Kwong, 2000), NAD(P)Hquinone oxidoreductase (NQO1), glutathione-S-transferase (GST) (Itohet al., 1997) and heme oxygenase 1 (Alam et al., 1999).

The activation of these genes is controlled through the antioxidantresponse element (ARE), to which Nrf2 binds after migration to thenucleus. The transcription factor Nrf2 is regulated negatively by itsinhibitor Keap1. This protein is located in the cytoplasm and bindsNrf2 preventing its migration to the nucleus (Itoh et al., 1999).

Nrf2 plays a role in protecting liver, as evidenced by increasedsensitivity to acetaminophen-induced centrilobular hepatocellularnecrosis and hepatotoxicity (Chan et al., 2001; Enomoto et al., 2001)as well as increased levels of lipid peroxidation and DNA damage inNrf2−/− livers (Li et al., 2004).

Besides the endogen defences, the antioxidant consumption in thediet has an important role in the protection against the development ofdiseases product of oxidative damage, like cardiovascular conditions,cancer, inflammation and brain dysfunction (Lopez-Velez et al., 2003).

67J.A. Rubiolo et al. / European Journal of Pharmacology 591 (2008) 66–72

Resveratrol (trans-3, 5, 4′-trihidroxystilbene) is a nonflavonoidpolyphenolic compound that is found in a great variety of plant species,some of which are part of the human diet. These include peanuts,grapes and red wines. It exists in the cis and trans conformation. Thetrans to cis isomerisation is facilitated by UV light (Leiro et al., 2004).

Many in vitro studies describe the different effects of resveratrol.These include antioxidant, anti-inflammatory and estrogenic effects.Also it has been reported to have quimiopreventive and antic-ancerigen activities (Bhat et al., 2001; Fremont, 2000).

The effects of resveratrol on the progression of the cell cycle dependon the experimental system, and are highly variable. It inhibits cellproliferation and induces apoptosis in various human tumour cell linesin a dose dependent manner having a specific action against malignantcells (Clementet al.,1998; Joe et al., 2002; Park et al., 2001; Ragioneet al.,1998; Schneider et al., 2000). On the other hand it has been shown toinduce cell proliferation on other cell types (Gehm et al., 1997).

There is evidence that resveratrol has an intrinsic antioxidantcapacity which depends on the redox properties of its hydroxylphenolic groups and on the potential for the delocalization ofelectrons through the chemical structure (Lopez-Velez et al., 2003).It has also been shown in some systems that this compound increasesthe activity of certain antioxidant and cytoprotective enzymes (Caoand Li, 2004; Soleas et al., 1997).

The chemical induction of endogenous antioxidant and phase IIenzymes varies among different types of tissues (Trush et al., 1996;Zhu et al., 1995). In cardiomiocytes it has been shown that resveratrolincreases the activities of various antioxidant and phase II enzymeswhich account for a marked cytoprotection against oxidative andelectrophlilic injury (Cao and Li, 2004).

In rats as in humans resveratrol is rapidly absorbed, metabolized toglucuronides or sulphate conjugates and distributed to various organs,being the primary targets the liver, heart and kidneys. Particularly theliver is responsible for a high accumulation of resveratrol afteringestion (Yu et al., 2002). Taking into account all these facts, wedecided to test if resveratrol could protect primary rat hepatocytesfrom oxidative damage and determine if this compound affects theactivity of antioxidant and phase II enzymes, and their regulation.

2. Materials and methods

2.1. Primary rat hepatocytes isolation and culture

All of the experimental protocols conformed to the ethics guide-lines of the Santiago de Compostela University. Primary rat hepato-cytes were obtained from 200–300 g Sprague–Dawley male rats, fedad libitum. The Seglen perfusion method was followed withmodifications (Berry and Friend, 1969; Seglen, 1976). Rats wereanesthetized with a ketamine:xylacine mix (42.5%:20%, Ketolar®50 mg, Parke Davis; Rompun® 2%, Bayer) in physiological solution.After perfusion, the liver was extracted and the cells were dispersed inLeibovitz medium. The cells were filtered and allowed to decant for15 min. The cell pellet was washed twice with the same medium andcell viability was determined by trypan blue exclusion. Preparationswith less than 80% of viability were discarded. The cells wereresuspended in attachment medium [199:E-MEM 1:4 (Sigma), 5 mg/l insulin (Sigma), 26.2 mM HCO3Na, 100 µg/ml streptomycin (Sigma),100 UI/ml penicillin (Calbiochem), 1.2 µM dexamethasone (Sigma),1 g/l BSA, 10% fetal bovine serum (Gibco)]. The cells were plated at adensity of 7.2.104 cells/cm2 on cell culture treated dishes (Nunclon™)and incubated at 37 °C and 5% CO2 for 5 h. After this period themedium was changed to post-attachment medium [199:E-MEM 1:4(Sigma), 5 mg/l insulin (Sigma), 26.2 mM HCO3Na, 100 µg/mlstreptomycin (Sigma), 100 UI/ml penicillin (Calbiochem), 0.6 mMhydroxycortisone (Sigma), 1 g/l BSA, 10% fetal bovine serum (Gibco)].Cells weremaintained in this medium at 37 °C and 5% CO2 for differenttime periods depending on the experiment.

2.2. Necrosis determination

Liberation of lactate dehydrogenase (LDH) to themediumwas usedto determine necrosis. Primary rat hepatocyte cultures were treatedwith resveratrol or vehicle for 24 h, at 37 °C and 5% CO2. After thisincubation period, the medium was replaced with medium withoutresveratrol and with 500 µM tert-butyl hydroperoxide (tBHP) exceptfor control cells which received new medium without tBHP. The cellswere incubated in this condition for another 24 h, at 37 °C and 5% CO2.The enzymatic activity was determined spectrophotometrically inculture medium and cell extracts of tBHP, resveratrol+tBHP treatedand control cells, measuring NADH oxidation. To 900 µl of reactionmix (50mMphosphate buffer, 0.25mMNADH and 0.75mMpyruvate)at 30 °C, 5–20 µl of medium or cell extracts was added and absorbancewas measured at 340 nm for 3 min. The % of LDH released to themedium was plotted as a measure of necrosis.

2.3. Enzymatic activities determination

Preparation of cell extracts: primary rat hepatocytes were grown on60 mmwell plates. After 48 h in culture and changing of the medium,resveratrol at concentrations of 25, 50 and 75 µM was added. The cellswere incubated in the presence of resveratrol for 24 and 48h.After thesetime periods, the cells were harvested in PBS and lysed by sonication.The sonicated cells were centrifuged and enzymatic activity and totalproteinweredetermined in the supernatant. Total protein concentrationwas determined by the method of Bradford (1976).

Catalase activity was determined by themethod of Aebi (1984). Thereaction mixture consisting of 950 µl of 50 mM potassium phosphatebuffer with 30 µM H2O2 at 25 °C was placed into a quartz cuvette. Thereactionwas started by adding 50 µl of sample solution to the reactionmixture and the H2O2 decomposition was measured at 240 nm for3 min at 25 °C. Catalase activity is expressed as micromoles of H2O2

consumed per minute per mg protein.Superoxide dismutase (SOD) activity was determined by themethod

of Spitz and Oberley (1989) with modifications. A reaction mixturecontaining 50 mM potassium phosphate buffer pH 7.5, 1.33 mMdiethylenetriamine-pentaacetic acid, 1 U/ml catalase, 70 µM nitrobluetetrazolium and 0.2 mM xanthine was prepared. To 0.8 ml of thismixture, 100 µl of the supernatant of cell extracts was added, and thereaction was started by adding 100 µl of a xanthine oxidase solution(0.05 U/ml). The formazan blue formation was determined at 560 nmfor 3 min at 25 °C. Total SOD activity was calculated with a SOD(SIGMA) standard curve that was generated togetherwith the samplesand is expressed as units of SOD per mg of protein.

Glutathione peroxidase (GPx) activity was determined by themethodof Flohe and Gunzler (1984). To the reactionmixture containing 600 µlof 50 mM potassium phosphate buffer, 1 mM EDTA and 1 mM GSH;100 µl of 2.4 U/ml GSSG reductase, 100 µl of sample and 100 µl of1.5 mM NADPH were added. The cuvette was incubated for 3 min at37 °C. After the addition of 100 µl of 2 mM H2O2 the NADPH oxidationat 340 nm was measured. This accounted for the total NADPHconsumption. The nonenzymatic oxidation of NADPH at 340 nm wasmeasured adding PBS instead of the sample. The enzymatic consump-tion of NADPH was obtained by subtracting the nonenzymaticconsumption of NADPH to the total one. The GPx activity wasexpressed as nmol of NADPH consumed per min per mg of protein.

Glutathione reductase (GRH) activity was measured by the methodof Wheeler et al. (1990). To a cuvette containing 800 µl of 50 mMpotassium phosphate buffer pH 7.0, 1 mM EDTA and 2 mM GSSG at37 °C; 100 µl of sample was added and the reaction was started with100 µl of 1.5 mM NADPH. The consumption of NADPH was measuredfor 3 min at 37 °C. The activity of GRH was expressed as nmol ofNADPH consumed per min per mg of protein.

Glutathione-S-transferase (GST) was measured by the method ofHabig et al. (1974). The reaction mixture contained 1 mM GSH, 1 mM

Fig. 1. (A) measurement of the LDH liberation to the medium in primary hepatocytes inculture. Cells were pre-incubated for 24 h with 25, 50 and 75 µM resveratrol. Control cellsand cells to be treated only with 500 µM tBHP were pre-incubated with vehicle (DMSO).After pre-incubation, the medium was replaced with fresh medium (control) or freshmedium containing 500 µM tBHP. Control (●), 500 µM tBHP (▼), resveratrol 25, 50 and75 µM+500 µM tBHP (■)(♦)(▲) respectively. ⁎Significative differences with respect tocontrol Pb0.01 (n=3). ⁎⁎Significative differenceswith respect to cells treatedwith R+tBHP,Pb0.01 (n=3). (B) Microscopical images (200× magnification) of the treated hepatocytecultures before being lysed for necrosis determination. Cell blebbing is present in cellstreated only with tBHP (solid arrows), also in these cultures there is extensive cellularvacuolization and less biliarycanaliculi type structures (dashed arrows, in the control) thanin cells treated with tBHP plus resveratrol and control cells.

68 J.A. Rubiolo et al. / European Journal of Pharmacology 591 (2008) 66–72

CDNB, and 1 mg/ml BSA in 100 mM potassium phosphate buffer pH7.5. To each cuvette 975 µl of reaction mixture was added and thereactionwas started by adding 25 µl of sample. The reduction of CDNBwas measured for 3 min at 25 °C. The molar extinction coefficient9.6 mM−1 cm−1 for CDNBwas used to calculate the GST activity, which

Table 1Enzymatic activities observed in primary rat hepatocytes treated with 25, 50 and 75 µM Re

Primary rat hepatocytes Catalase (1) SOD (2) G

24 h Control (DMSO) 177.1±1.4 5.4±0.2 8R 25 µM 194.6±1.3a 5.3±0.3 9R 50 µM 209.1±3.4a 6.1±0.2b 8R 75 µM 296.8±2.2a 6.8±0.2a 7

48 h Control (DMSO) 115.3±6.0 5.8±0.4 8R 25 µM 137.6±6.0a 6.4±0.1 9R 50 µM 169.7±6.4a 7.3±0.1a 9R 75 µM 216.7±2.5a 6.3±0.3 7

Three experiments for each enzyme activity with similar results, representative values are(1) µmol H2O2/min/mg protein.(2) U/ml.(3) nmol NADPH/min/mg protein.(4) nmol DCIP/min/mg protein.(5) nmol GS-DNB/min/mg protein.

a Significative differences with respect to control cells. Pb0.01 (n=3).b Significative differences with respect to control cells. Pb0.05 (n=3).

was expressed as nmol of GS-DNB conjugate formed per minute permg of protein.

NAD(P)H:quinone oxidoreductase 1 (NQO1) was determined by themethod of Benson et al. (1980). The reaction mixture contained50 mM Tris–HCl pH 7.5, 0.08% Triton X-100, 0.25 mM NADPH, and80 µM 2,6-dichloroindophenol (DCIP) with or without 60 µMdicumarol. The reaction was started by adding 5 µl of sample to695 µl of the reaction mixture and the OD was recorded for 3 min at25 °C. The activity was determined using the 21 mM−1 cm−1 molarextinction coefficient for DCIP after subtracting the absorbancevariation when dicumarol was added in the reaction to the variationobserved in the absence of dicumarol for each sample. The activitywas expressed as nmol of DCIP reduced per min per mg of protein.

2.4. Western blot

Primary rat hepatocyte cultures in 60 mm plates were treated with50 and 75 µM resveratrol for 6, 24 and 48 h. After incubation, cellswere harvested in PBS, lysed by sonication and centrifuged. Theprotein concentration in the cleared lysates was determined by themethod of Bradford (Bradford, 1976). Equal amount of protein for eachtreatment was loaded into 12% polyacrylamide gels and afterelectrophoresis the proteins were transferred to nylon membranes.A 1:3000 goat polyclonal anti-Nrf2 (Santa Cruz Biotechnology) wasused to detect Nrf2. A rabbit anti-goat secondary antibody was used at1:12,000. Antibodies were diluted in PBS containing 0.5% BSA.Samples were analyzed in duplicate or triplicate in each gel and atleast three experiments for each resveratrol concentration testedweremade. The intensity of the bands was determined by densitometrywith the system VersaDoc™ (BIORAD), and analyzed using thesoftware Quantity One® (BIORAD).

2.5. Quantitative PCR

Primary rat hepatocytes grown in 60mmplateswere treatedwith 50and 75 µM resveratrol for 24 h. After treatment total RNA was purifiedusing a commercial kit (RNeasy® Mini Kit, QIAGEN). RNA concentrationand purity were determined spectrophotometrically and its integrity wasassessed by formaldehyde agarose electrophoresis. After reverse tran-scription of the samples with oligo dT, the RTs were diluted 1/50 andanalyzed by quantitative PCR using a commercial kit (Roche AppliedSciene) and the Roche 1.5 LightCycler® coupled to the Roche 3.5.3 Light-Cycler® software. The primers used were, for Nrf2 mRNA: 5′ GCAACTC-CAGAAGGAACAGG 3′ and 5′GGAATGTCTCTGCCAAAAGC 3′ and forcyclophilin mRNA: 5′ CTGCACTGCCAAGACTGAATG 3′ and 5′TTGCCATTCCTGGACCCAAA 3′. Each condition was analyzed by triplicateand three experiments were performed.

sv or DMSO (vehicle) for 24 or 48 h

R (3) GPx (3) NQO1 (4) GST (5)

3.7±3.6 365.1±32.0 2034.5±240.4 605.8±52.94.0±1.8 372.7±19.0 3475.7±203.7b 987.7±184.1a

8.9±1.5 426.0±15.1 3651.0±572.1a 1113.6±75.0a

6.9±4.1 406.3±32.9 3514.2±790.3a 1104.4±196.5a

5.1±0.7 352.3±9.6 2589.4±212.4 619.8±48.75.1±2.7a 397.9±34.1 3342.4±34.0a 723.5±37.3b

7.7±2.4a 568.2±67.2a 3869.4±40.6a 980.0±100.9a

6.1±5.1 625.0±66.6a 3872.5±264.1a 961.3±14.6a

presented in this table.

Fig. 2. Primary rat hepatocytes grown on cover slips were treated with 50 and 75 µMresveratrol or vehicle (DMSO). After 6 or 24 h of treatment they were analyzed byimmunocytochemistry. It can be observed that in resveratrol treated cells Nrf2 can bedetected in the nucleus (arrows indicate representative positive nuclei) and in thecytoplasm, while it is only detected in the cytoplasm of control cells. Higherfluorescence intensity is also seen in resveratrol treated cells, at both time periods,when compared to control cells. The bright round cells with similar fluorescenceintensity are dead cells.

Fig. 3. Primary rat hepatocytes were treated with 50 and 75 µM resveratrol for 6, 24 and48 h, or vehicle (DMSO) as control. After treatment the cells were lysed and total proteincontent was analyzed by western blot. Total protein concentrationwas determined by theBradford method before loading the samples, and equal amounts of protein were loadedin each well. Experiments for resveratrol treatment at different times (1, 2; n=2) or for24 h (3; n=3) are shown with the plots of the densitometrical values obtained.Differences between treated and control cells were considered significative when Pb0.05.

69J.A. Rubiolo et al. / European Journal of Pharmacology 591 (2008) 66–72

2.6. Immunocytochemistry

Primary hepatocytes were grown on cover slips. After 24 h ofculture, 50 and 75 µM resveratrol were added. The cells wereincubated in the presence of this compound for 5 or 24 h. Aftertreatment cells were fixed with 4% paraformaldehyde and incubatedwith anti-Nrf2 (Santa Cruz Biotechnology) for 3 h. After washing withPBS the cover slips were incubated with a fluorescent anti-goatantibody for 1 h. Finally they were mounted on slides using 90%glycerol in PBS as mounting medium and analyzed by confocalmicroscopy using an immersion 60× objective (Nikon) and a Bioradconfocal system and software. Photos along the z axis of each fieldanalyzed were taken to rule out the possibility that the differencesobserved between control and treated cells were due to a differentialfocal plane. Representative photos for each treatment and controls arepresented in this work.

2.7. Statistical analysis

The results were analyzed using the software programs SIGMA-PLOT and SIGMASTAT. One way ANOVAwas employed for comparisonof significant differences among groups. Comparisons between groupswere made by the Holm–Sidak multiple range test. Values arepresented as the mean±S.D. A Pb0.05 (n≥2) value was consideredsignificant.

3. Results

3.1. Inhibition of necrosis by resveratrol

Cells were treated with 25, 50 and 75 µM resveratrol for 24 h. Thenthe medium was changed for medium without resveratrol and with500 µM tBHP, to induce oxidative stress, and the incubation continuedfor 24 h. Samples of culture mediumwere collected at 3 and 24 h afterthe addition of tBHP. After 24 h the cells were harvested and lysed.LDH activity was determined in the cell culturemedium and in the celllysates. Fig. 1A shows that resveratrol partially inhibits necrosisinduced by oxidative stress. The three concentrations of resveratroltested inhibited necrosis up to 24 h in cultures treated with tBHP plusresveratrol with respect to cultures treated only with tBHP. The bestlevel of cytoprotection was achieved when resveratrol was used at a50 µM concentration. In this case there was only a 10% of necrosiscompared to control cells after 24 h of oxidative stress. There was animportant increase in the LDH liberation in the first 3 h of exposure totBHP except for control cells. After this period only cells with tBHPshowed an additional increase in the LDH liberation up to 24 h.

When the cells were analyzed under the microscope, extensivedamage was observed in the tBHP treated cultures, these include lost ofcellular integrity, cell blebbing and vacuolization. On the other hand this

70 J.A. Rubiolo et al. / European Journal of Pharmacology 591 (2008) 66–72

damage was not present in cells pre-treated with resveratrol beforebeing exposed to tBHP (Fig. 1B). Also, biliary canaliculi type structuresare scarce in the cells treated with tBHP compared with those observedin cells treated with tBHP plus resveratrol and control cells.

Apoptosis, measured by caspase 3 activity, was not observed whencells were treated with 25, 50 and 75 µM resveratrol for 24 h, or whenthey were pre-incubated for 24 h with resveratrol at the sameconcentrations and exposed to 500 µM tBHP for 24 h (data not shown).

3.2. Enzymatic activities

In Table 1 the activities of the assayed enzymes are shown. Theactivity of catalase was increased in a dose dependent manner incultures treated with resveratrol at all the concentrations and timeperiods tested. In the case of SOD, only hepatocytes exposed to 50 and75 µM resveratrol for 24 h or 50 µM for 48 h, had a higher enzymaticactivity than control cells. There was an increase in GR activity whenprimary rat hepatocytes were exposed to 25 and 50 µM resveratrol for48 h with respect to control cells, but there was no effect at 24 h. Also,GPx activity was augmented when hepatocytes were exposed to 50and 75 µM resveratrol for 48 h, while no difference was observed at24 h. A high increase in the activity of NQO1 and GST was observed incells treated with 25, 50 and 75 µM resveratrol at both time periodstested. In the case of NQO1 therewas a 1.7, 1.8 and 1.7 fold increase, forcells treated for 24 h with 25, 50 and 75 µM resveratrol respectively;and a 1.3, 1.5 and 1.5 fold increase for cells treated for 48 h with 25, 50and 75 µM resveratrol respectively. GST showed a 1.6, 1.8 and 1.8 foldincrease for 25, 50 and 75 µM resveratrol at 24 h respectively and a 1.2,1.6 and 1.6 fold increase, for 25, 50 and 75 µM resveratrol at 48 hrespectively.

3.3. Synthesis and induction of Nrf2

Since we observed that resveratrol produced an increase in theactivities of antioxidant and phase II enzymes, we decided todetermine if the transcription factor Nrf2 which is known to regulatethe expression of these enzymes, was activated and if its concentra-tion and that of the mRNA coding for this factor were altered. Thelevels of Nrf2 detected by immunofluorescencewere increased in cellstreated with 50 or 75 µM resveratrol compared with control cells(Fig. 2). The transcription factor was detected in the nucleus and thecytoplasm of cells treated for 6 or 24 h with 50 and 75 µM resveratrol.In untreated cells, in the same conditions of assay, Nrf2 was onlyobserved in the cytoplasm (Fig. 2).

As shown in Fig. 3, primary rat hepatocytes treated with 50 µMresveratrol had a higher Nrf2 protein level than untreated cells. Thisincrease in the transcription factor was seen after 6 h of treatment,peaked at 24 h and it was maintained up to 48 h without a further

Fig. 4. Primary rat hepatocyte cultures were treated with 50 and 75 µM resveratrol orvehicle (DMSO). After 24 h the cellular RNA was extracted, reverse transcribed, andanalyzed by quantitative PCR. Significative differences in the cellular Nrf2 coding mRNAcontent Pb0.05 (n=3) can be observed between control and resveratrol treated cells.

increment. In the case of cells treatedwith 75 µM resveratrol, Nrf2wasalso increased after 6 or 24 h of treatment while no significativechange in its concentration was observed after 48 h of treatment. Thiscould be due to the fact that resveratrol at this concentration is slightlycytotoxic for primary rat hepatocytes after 48 h of treatment (resultsnot shown).

A 1.4 and a 2.4 fold increase in the copy number of the mRNAcoding for Nrf2 was detected in primary rat hepatocytes treated with50 and 75 µM resveratrol for 24 h respectively when compared tocontrol untreated cells (Fig. 4).

4. Discussion

In this work we show that resveratrol protects primary rathepatocytes from necrosis induced by oxidative stress. The cytopro-tective effect was observed when cells were exposed to oxidativestress after pre-incubation with resveratrol. This indicates that theantioxidant action of resveratrol depends on its capacity to inducecellular cytoprotective mechanisms. A higher activity of the celldefence enzymes could account for a higher resistance againstchemical lipid, protein and DNA damage. The DNA damage inhibitionis of particular importance in cancer chemoprevention. The inductionof cytoprotective enzymes is to be noted because their activitiesprotect cells during a longer period and more effectively thanchemical antioxidant action. This indicates that short exposures toresveratrol could induce a longer cytoprotective response through theinduction of antioxidant enzymes. In our system resveratrol showed acytoprotective action at all the concentrations tested. The highercytoprotective effect was observed when it was used at a 50 µMconcentration. We have observed that 75 µM resveratrol is slightlycytotoxic for primary hepatocytes in vitro (results not shown) duringlong incubation periods (N24 h), which could explain why thisconcentration exerts a lower cytoprotective action than resveratrol50 µM. Even this, when cells were pre-incubated with 75 µMresveratrol, the necrosis observed after exposure to the tBHP oxidativeactionwas significatively lower than the one observed in the cells thatwere only exposed to the oxidant, indicating that even when 75 µMresveratrol can induce a certain degree of necrosis in these cultures, atthe same time exerts a cytoprotective action through the induction ofantioxidant enzymatic systems thereby protecting the cells fromoxidative damage.

The augmented activities of catalase, SOD, GPx, GR, NQO1 and GST,that we detected in hepatocytes exposed to resveratrol, could beresponsible for the increased resistance to oxidative stress observed incells treated with this compound. The higher activity of SOD andcatalase couldmake the cells capable of tolerating higher H2O2 and O2

U−

concentrations. The enzyme NQO1, which catalyzes the two electronreduction of electrophilic quinone compounds, thus limiting theformation of semiquinone radicals through one electron reductionthat enter redox cycles with molecular oxygen generating activeoxygen species and oxidative stress (Riley and Workman, 1992; Thoret al., 1982), can also maintain the cellular levels of ubiquinol andreduced vitamin E. These are important biological antioxidantsinvolved in the detoxification of ROS (Ross et al., 2000). It has alsobeen demonstrated that NQO1 is able to scavenge O2

U− (Siegel et al.,2004). The other phase II enzymatic activity studied, GST, was alsoincreased in cells treated with resveratrol. This enzyme, that catalyzesthe nucleophilic attack by reduced glutathione on nonpolar com-pounds that contain an electrophilic carbon, nitrogen, or sulphur(Hayes et al., 2005), is important in the cell protection against oxidativestress. It catalyzes the decomposition of lipid hydroperoxidesgenerated by oxidative damage of cellular lipid molecules (Hayeset al., 2005; Xie et al., 2001; Yang et al., 2001). In vivo experimentscould be very important to determine if effective resveratrolconcentrations can be reached in the liver that could increase theactivities of antioxidant and phase II enzymes through the activation of

71J.A. Rubiolo et al. / European Journal of Pharmacology 591 (2008) 66–72

Nrf2. Recently it has been informed that resveratrol is capable ofavoiding the diminution in the activities of catalase, SOD, GR and GPxin livers of rats treated with ethanol (Kasdallah-Grissa et al., 2007).

Because it has been demonstrated that Nrf2 is a key transcriptionfactor for both the inducible and constitutive expression of phase IIenzymes, we studied how the cellular levels of this factor are affectedwhen cells are exposed to resveratrol as well as its subcellularlocalization. We observed an increase of the Nrf2 transcription factorin cells treated with resveratrol compared to control cells. Thisincrease was observed for all the time periods tested when resveratrolwas used at 50 µM and after 6 and 24 h of incubation with 75 µMresveratrol. As previously explained, 75 µM resveratrol is slightlycytotoxic after 48 h for primary hepatocytes, this could explain thelack of significance in the increase of the transcription factor in thislast case. This factor was detected in the nucleus of the resveratroltreated cells for 6 and 24 h, indicating that resveratrol activated it. Onthe other hand it was only detected in the cytoplasm of control cells.The fluorescence intensity was higher in resveratrol treated cellsindicating that Nrf2 concentration was increased in these cells. Thisresult is in agreement with those observed in the western blots thatshow an increase in Nrf2 in resveratrol treated cells compared tocontrols. Also a higher concentration of the mRNA coding for Nrf2 wasobserved 24 h after resveratrol was added to the cultures indicatingthat the Nrf2 mRNA inducing effect is prolonged. It has been reportedthat resveratrol increases Nrf2 in some cases by protein stabilization(Ishii et al., 2000; Nguyen et al., 2003; Stewart et al., 2003) while inothers the induction of the gene for Nrf2 was detected (Kwak et al.,2002). Apparently in primary rat hepatocytes there is an induction ofthe Nrf2 gene which could account for the higher concentration ofNrf2 observed in hepatocytes treated with resveratrol. On the otherhand, both processes could be involved, the induction of the genecoding for Nrf2 and protein stabilization of this transcription factor byposttranslational modifications. In human hepatoblastoma cells(HepG2), treated with the polyphenol quercetin, the downregulationof the Nrf2 inhibitor Keap1 has been observed (Tanigawa et al., 2007).This has to be taken into account when interpreting the resultsobtained in this work because resveratrol is also a polyphenol andcould be responsible for the same type of action in primary rathepatocytes in culture.

The increase in Nrf2 concentration and its activation is consistentwith a higher activity of the antioxidant and phase II enzymesobserved in the cells after treatment with resveratrol that wouldcorrespond to a higher expression of the phase II enzyme genes.

Because resveratrol activates Nrf2 with the consequent inductionof antioxidant and phase II enzymes in primary rat hepatocytes, thiscompound could be useful in chemoprevention for liver. The fact thatliver is one of the primary targets for resveratrol (Gusman et al., 2001;Yu et al., 2002) is another important factor that is in favour of the useof this compound as a chemopreventive agent. It should be noted thatin humans the NQO1 concentration in hepatic cells is very low, whilethere is a high concentration of NQO2 (Jaiswal, 1994). As NQO1, NQO2coding gene has the ARE sequence so it can be induced by Nrf2.According to this if resveratrol could activate Nrf2 in humanhepatocytes then it could increase the transcription of NQO2 in thehuman liver. It could also affect the transcription of the NQO1 geneincreasing its transcription and thus the enzymatic activity. Thefindings of this work are in agreement with the idea of usingresveratrol as a protection against oxidative stress in liver.

Acknowledgments

This work was supported by a predoctoral grant from Vice-rrectorado de Relaciones Exteriores, Universidad de Santiago deCompostela (J. A. R.), and by the Xunta de Galicia PGIDT99PX126103.

We thank Dr. Fabienne Rajas and Dr. Ana P. Vega for criticallyreading this manuscript.

References

Aebi, H., 1984. Catalase in vitro. Methods Enzymol. 105, 121–127.Alam, J., Stewart, D., Touchard, C., Boinapally, S., Choi, A.M., Cook, J.L., 1999. Nrf2, a

Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1gene. J. Biol. Chem. 274, 26071–26078.

Benson, A.M., Hunkeler, M.J., Talalay, P., 1980. Increase of NAD(P)H:quinone reductase bydietary antioxidants: possible role in protection against carcinogenesis and toxicity.Proc. Natl. Acad. Sci. U. S. A. 77, 5216–5220.

Berry, M., Friend, D., 1969. High-yield preparation of isolated rat liver parenchymal cells.J. Cell Biol. 43, 506–520.

Bhat, K.P.L., Kosmeder II, J.W., Pezzuto, J.M., 2001. Biological effects of resveratrol.Antioxid. Redox Signal. 3, 1041–1064.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgramquantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248–254.

Cao, Z., Li, Y., 2004. Potent induction of cellular antioxidants and phase 2 enzymes byresveratrol in cardiomyocytes: protection against oxidative and electrophilic injury.Eur. J. Pharmacol. 489, 39–48.

Chan, J.Y., Kwong, M., 2000. Impaired expression of glutathione synthetic enzyme genesin mice with targeted deletion of the Nrf2 basic-leucine zipper protein. Biochim.Biophys. Acta 1517, 19–26.

Chan, K., Han, X.D., Kan, Y.W., 2001. An important function of Nrf2 in combatingoxidative stress: detoxification of acetaminophen. Proc. Natl. Acad. Sci. U. S. A. 98,4611–4616.

Clement, M.V., Hirpara, J.L., Chawdhury, S.H., Pervaiz, S., 1998. Chemopreventive agentresveratrol, a natural product derived from grapes, triggers CD95 signaling-dependent apoptosis in human tumor cells. Blood 92, 996–1002.

Cortez-Pinto, H., 2001. Oxidative stress in alcoholic and nonalcoholic liver disease. In:Leuscher, U., James, O., Dancygier, M. (Eds.), Falk Symposium 121. Steatohepatitis(NASH and ASH). Kluwer Academic Publishers, Dordrecht, pp. 54–61.

Enomoto, A., Itoh, K., Nagayoshi, E., Haruta, J., Kimura, T., O'Connor, T., Harada, T.,Yamamoto, M., 2001. High sensitivity of Nrf2 knockout mice to acetaminophenhepatotoxicity associated with decreased expression of ARE-regulated drugmetabolizing enzymes and antioxidant genes. Toxicol. Sci. 59, 169–177.

Flohe, L., Gunzler, W.A., 1984. Assays of glutathione peroxidase. Methods Enzymol. 105,114–121.

Fremont, L., 2000. Biological effects of resveratrol. Life Sci. 66, 663–673.Gehm, B.D., McAndrews, J.M., Chien, P.Y., Jameson, J.L., 1997. Resveratrol, a polyphenolic

compound found in grapes and wine, is an agonist for the estrogen receptor. Proc.Natl. Acad. Sci. U. S. A. 94, 14138–14143.

Gusman, J., Malonne, H., Atassi, G., 2001. A reappraisal of the potential chemopreventiveand chemotherapeutic properties of resveratrol. Carcinogenesis 22, 1111–1117.

Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases. The firstenzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139.

Halliwell, B., Aeschbach, R., Loliger, J., Aruoma, O.I., 1995a. The characterization ofantioxidants. Food Chem. Toxicol. 33, 601–617.

Halliwell, B., Murcia, M.A., Chirico, S., Aruoma,O.I.,1995b. Free radicals and antioxidants infood and in vivo: what they do and how they work. Crit. Rev. Food Sci. Nutr. 35, 7–20.

Hayes, J.D., Flanagan, J.U., Jowsey, I.R., 2005. Glutathione transferases. Annu. Rev.Pharmacol. Toxicol. 45, 51–88.

Ishii, T., Itoh, K., Takahashi, S., Sato, H., Yanagawa, T., Katoh, Y., Bannai, S., Yamamoto, M.,2000. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J. Biol. Chem. 275, 16023–16029.

Itoh, K., Chiba, T., Takahashi, S., Ishii, T., Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N.,Satoh, K., Hatayama, I., Yamamoto, M., Nabeshima, Y., 1997. An Nrf2/small Mafheterodimer mediates the induction of phase II detoxifying enzyme genes throughantioxidant response elements. Biochem. Biophys. Res. Commun. 236, 313–322.

Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Igarashi, K., Engel, J.D., Yamamoto, M., 1999.Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2through binding to the amino-terminal Neh2 domain. Genes Dev. 13, 76–86.

Jaiswal, A.K., 1994. Human NAD(P)H:quinone oxidoreductase2. Gene structure, activity,and tissue-specific expression. J. Biol. Chem. 269, 14502–14508.

Joe, A.K., Liu, H., Suzui, M., Vural, M.E., Xiao, D., Weinstein, I.B., 2002. Resveratrol inducesgrowth inhibition, S-phase arrest, apoptosis, and changes in biomarker expressionin several human cancer cell lines. Clin. Cancer Res. 8, 893–903.

Kasdallah-Grissa, A., Mornagui, B., Aouani, E., Hammami, M., El May, M., Gharbi, N.,Kamoun, A., El-Fazaa, S., 2007. Resveratrol, a red wine polyphenol, attenuatesethanol-induced oxidative stress in rat liver. Life Sci. 80, 1033–1039.

Kwak, M.K., Itoh, K., Yamamoto, M., Kensler, T.W., 2002. Enhanced expression of thetranscription factor Nrf2 by cancer chemopreventive agents: role of antioxidantresponse element-like sequences in the nrf2 promoter. Mol. Cell. Biol. 22,2883–2892.

Lai, M.M., 2002. Hepatitis C virus proteins: direct link to hepatic oxidative stress,steatosis, carcinogenesis and more. Gastroenterology 122, 568–571.

Leiro, J., Alvarez, E., Arranz, J.A., Laguna, R., Uriarte, E., Orallo, F., 2004. Effects of cis-resveratrol on inflammatory murine macrophages: antioxidant activity and down-regulation of inflammatory genes. J. Leukoc. Biol. 75, 1156–1165.

Li, J., Stein, T.D., Johnson, J.A., 2004. Genetic dissection of systemic autoimmune diseasein Nrf2-deficient mice. Physiol. Genomics 18, 261–272.

Lopez-Velez, M., Martinez-Martinez, F., Del Valle-Ribes, C., 2003. The study of phenoliccompounds as natural antioxidants in wine. Crit. Rev. Food Sci. Nutr. 43, 233–244.

Martin, G.M., Austad, S.N., Johnson, T.E., 1996. Genetic analysis of ageing: role ofoxidative damage and environmental stresses. Nat. Genet. 13, 25–34.

Nguyen, T., Sherratt, P.J., Huang, H.C., Yang, C.S., Pickett, C.B., 2003. Increased proteinstability as a mechanism that enhances Nrf2-mediated transcriptional activation of

72 J.A. Rubiolo et al. / European Journal of Pharmacology 591 (2008) 66–72

the antioxidant response element. Degradation of Nrf2 by the 26 S proteasome. J.Biol. Chem. 278, 4536–4541.

Park, J.W., Choi, Y.J., Jang, M.A., Lee, Y.S., Jun, D.Y., Suh, S.I., Baek, W.K., Suh, M.H., Jin, I.N.,Kwon, T.K., 2001. Chemopreventive agent resveratrol, a natural product derivedfrom grapes, reversibly inhibits progression through S and G2 phases of the cellcycle in U937 cells. Cancer Lett. 163, 43–49.

Ragione, F.D., Cucciolla, V., Borriello, A., Pietra, V.D., Racioppi, L., Soldati, G., Manna, C.,Galletti, P., Zappia, V., 1998. Resveratrol arrests the cell division cycle at S/G2 phasetransition. Biochem. Biophys. Res. Commun. 250, 53–58.

Rautalahti, M., Huttunen, J., 1994. Antioxidants and carcinogenesis. Ann. Med. 26,435–441.

Riley, R.J., Workman, P., 1992. DT-diaphorase and cancer chemotherapy. Biochem.Pharmacol. 43, 1657–1669.

Ross, D., Kepa, J.K., Winski, S.L., Beall, H.D., Anwar, A., Siegel, D., 2000. NAD(P)H:quinoneoxidoreductase 1 (NQO1): chemoprotection, bioactivation, gene regulation andgenetic polymorphisms. Chem. Biol. Interact. 129, 77–97.

Schneider, Y., Vincent, F., Duranton, B., Badolo, L., Gosse, F., Bergmann, C., Seiler, N., Raul,F., 2000. Anti-proliferative effect of resveratrol, a natural component of grapes andwine, on human colonic cancer cells. Cancer Lett. 158, 85–91.

Seglen, P.O., 1976. Preparation of isolated rat liver cells. Methods Cell Biol. 13, 29–83.Siegel, D., Gustafson, D.L., Dehn, D.L., Han, J.Y., Boonchoong, P., Berliner, L.J., Ross, D.,

2004. NAD(P)H:quinone oxidoreductase 1: role as a superoxide scavenger. Mol.Pharmacol. 65, 1238–1247.

Slaga, T.J., 1995. Inhibition of the induction of cancer by antioxidants. Adv. Exp. Med.Biol. 369, 167–174.

Soleas, G.J., Diamandis, E.P., Goldberg, D.M., 1997. Wine as a biological fluid: history,production, and role in disease prevention. J. Clin. Lab. Anal. 11, 287–313.

Spitz, D.R., Oberley, L.W., 1989. An assay for superoxide dismutase activity inmammalian tissue homogenates. Anal. Biochem. 179, 8–18.

Stewart, D., Killeen, E., Naquin, R., Alam, S., Alam, J., 2003. Degradation of transcriptionfactor Nrf2 via the ubiquitin–proteasome pathway and stabilization by cadmium. J.Biol. Chem. 278, 2396–2402.

Tanigawa, S., Fujii, M., Hou, D.X., 2007. Action of Nrf2 and Keap1 in ARE-mediated NQO1expression by quercetin. Free Radic. Biol. Med. 42, 1690–1703.

Thor, H., Smith, M.T., Hartzell, P., Bellomo, G., Jewell, S.A., Orrenius, S., 1982. Themetabolism of menadione (2-methyl-1,4-naphthoquinone) by isolated hepato-cytes. A study of the implications of oxidative stress in intact cells. J. Biol. Chem. 257,12419–12425.

Trush, M.A., Twerdok, L.E., Rembish, S.J., Zhu, H., Li, Y., 1996. Analysis of target cellsusceptibility as a basis for the development of a chemoprotective strategy againstbenzene-induced hematotoxicities. Environ. Health Perspect. 104 (Suppl 6),1227–1234.

Wheeler, C.R., Salzman, J.A., Elsayed, N.M., Omaye, S.T., Korte Jr., D.W., 1990. Automatedassays for superoxide dismutase, catalase, glutathione peroxidase, and glutathionereductase activity. Anal. Biochem. 184, 193–199.

Xie, C., Lovell, M.A., Xiong, S., Kindy, M.S., Guo, J., Xie, J., Amaranth, V., Montine, T.J.,Markesbery, W.R., 2001. Expression of glutathione-S-transferase isozyme in theSY5Y neuroblastoma cell line increases resistance to oxidative stress. Free Radic.Biol. Med. 31, 73–81.

Yang, Y., Cheng, J.Z., Singhal, S.S., Saini, M., Pandya, U., Awasthi, S., Awasthi, Y.C., 2001.Role of glutathione S-transferases in protection against lipid peroxidation. Over-expression of hGSTA2-2 in K562 cells protects against hydrogen peroxide-inducedapoptosis and inhibits JNK and caspase 3 activation. J. Biol. Chem. 276,19220–19230.

Yu, C., Shin, Y.G., Chow, A., Li, Y., Kosmeder, J.W., Lee, Y.S., Hirschelman,W.H., Pezzuto, J.M.,Mehta, R.G., van Breemen, R.B., 2002. Human, rat, and mouse metabolism ofresveratrol. Pharm. Res. 19, 1907–1914.

Zhu, H., Li, Y., Trush, M.A., 1995. Differences in xenobiotic detoxifying activities betweenbone marrow stromal cells from mice and rats: implications for benzene-inducedhematotoxicity. J. Toxicol. Environ. Health 46, 183–201.