Role of Pex19p in the targeting of PMP70 to peroxisome

elseviercomlocatebba

Biochimica et Biophysica Acta

Role of Pex19p in the targeting of PMP70 to peroxisome

Yoshinori Kashiwayama a Kota Asahina a Hiroyuki Shibata b Masashi Morita a Ania C Muntau c

Adelbert A Roscher c Ronald JA Wanders d Nobuyuki Shimozawa e

Masao Sakaguchi f Hiroaki Kato bg Tsuneo Imanaka a

a Department of Biological Chemistry Faculty of Pharmaceutical Sciences Toyama Medical and Pharmaceutical University

2630 Sugitani Toyama 930-0194 Japanb Kinetic Crystallography Research Team Membrane Dynamics Research Group RIKEN Harima Institute at SPring-8 1-1-1 Kouto

Mikazuki-cho Sayo-gun Hyogo 679-5148 Japanc Department of Clinical Chemistry and Biochemical Genetics Dr v Hauner Childrenrsquos Hospital Ludwig-Maximilians-University

Lindwurmstrasse 4 80337 Munich Germanyd Department of Pediatrics Academic Medical Centre University of Amsterdam P O Box 22700 1100DE Amsterdam The Netherlands

e Division of Genomic Research Life Science Research Center Gifu University Yanagidou 1-1 Gifu 500-8076 Japanf Graduate School of Life Science University of Hyogo Ako Hyogo 678-1297 Japan

g Department of Structural Biology Graduate School of Pharmaceutical Sciences Kyoto University 46-29 Yoshida Shimoadachi-cho

Sakyo-ku Kyoto 606-8501 Japan

Received 25 February 2005 received in revised form 12 October 2005 accepted 13 October 2005

Available online 14 November 2005

Abstract

Pex19p is a protein required for the peroxisomal membrane synthesis The 70-kDa peroxisomal membrane protein (PMP70) is synthesized on

free cytosolic ribosomes and then inserted posttranslationally into peroxisomal membranes Pex19p has been shown to play an important role in

this process Using an in vitro translation system we investigated the role of Pex19p as a chaperone and identified the regions of PMP70 required

for the interaction with Pex19p When PMP70 was translated in the presence of purified Pex19p a large part of PMP70 existed as soluble form

and was co-immunoprecipitated with Pex19p However in the absence of Pex19p PMP70 formed aggregates during translation To identify the

regions that interact with Pex19p various truncated PMP70 were translated in the presence of Pex19p and subjected to co-immunoprecipitation

The interaction was markedly reduced by the deletion of the NH2-terminal 61 amino acids or the region around TMD6 Further we expressed

these deletion constructs of PMP70 in fusion with the green fluorescent protein in CHO cells Fusion proteins lacking these Pex19p binding sites

did not display any peroxisomal localization These results suggest that Pex19p binds to PMP70 co-translationally and keeps PMP70 as a proper

conformation for the localization to peroxisome

D 2005 Elsevier BV All rights reserved

Keywords Peroxisome Pex19p Peroxisome membrane protein ABC protein PMP70

1 Introduction

Peroxisomes are organelles bound by a single membrane

which are present in almost all eukaryotic cells Peroxisomes

are involved in a variety of metabolic processes including

peroxide-based respiration oxidative degradation of fatty acids

and purines and synthesis of plasmalogen and bile acids [1]

Therefore the defect in peroxisomal biogenesis causes multiple

0167-4889$ - see front matter D 2005 Elsevier BV All rights reserved

doi101016jbbamcr200510006

Corresponding author Tel 81 76 434 7545 fax +81 76 434 4656

E-mail address imanakamstoyama-mpuacjp (T Imanaka)

metabolic dysfunctions such as Zellweger syndrome [23] The

biogenesis of peroxisomes is a complex process requiring

multiple proteins encoded by PEX genes [4ndash7] with as many

as 32 PEX genes having so far been identified [8] Almost all

peroxisomal proteins are encoded by nuclear genes synthe-

sized on free polysomes and posttranslationally imported into

pre-existing peroxisomes [9] The majority of matrix proteins

contain either of two peroxisome targeting signals (PTS) PTS1

or PTS2 [10ndash12] Proteins containing these signals are

recognized by specific cytosolic receptors Pex5p and Pex7p

[1314] and are then imported into the peroxisome matrix by

an ATP-dependent pathway [1516]

1746 (2005) 116 ndash 128

httpwww

Y Kashiwayama et al Biochimica et Biophysica Acta 1746 (2005) 116ndash128 117

Much less is known regarding the targeting and assembly of

peroxisomal membrane proteins (PMPs) They do not contain a

recognizable PTS1 or PTS2 sequence [17] and their import is

independent of PTS1 or PTS2 receptors [1819] Therefore

PMPs seem to be imported into peroxisomes by a distinct

mechanism by which peroxisomal matrix proteins are

imported Most PEX genes are required for importing of

peroxisomal matrix proteins but not for peroxisomal membrane

biogenesis Only cells harboring the mutant genes of PEX3

PEX16 and PEX19 lack detectable peroxisomal structures

[20ndash22] indicating that these gene products are involved in the

synthesis of the peroxisomal membrane or the import of PMPs

Pex19p the PEX19 gene product is mainly located in the

cytosol and can also associate with the peroxisomal membrane

[23] Pex19p has been shown to bind multiple PMPs [23ndash26]

and the defect of this protein results in degradation andor

mislocalization of PMPs [19] Moreover the mislocalization of

Pex19p to the nucleus leads to the accumulation of PMPs in the

nucleoplasm [23] From these observations it is suggested that

Pex19p is able to act as a chaperone for PMPs

PMP70 is one of the major components of the mammalian

peroxisomal membranes and belongs to the ATP-binding

cassette protein superfamily [2728] It consists of 659 amino

acid residues and the putative topology of PMP70 predicts six

transmembrane segments with NH2- and COOH-terminus

facing the cytoplasm In the PEX19 mutant cell PMP70

mostly remained in the cytosol and was degraded rapidly [29]

This finding was interpreted to suggest that the interaction

between Pex19p and PMP70 was important for the targeting of

PMP70 To better understand the role of Pex19p in the

targeting process of PMP70 we have characterized the binding

of Pex19p to various regions of PMP70 using an in vitro

Table 1

Oligonucleotide primer sequences used for construction of plasmids

Conctruct name Oligonucleotide Primer (5VY3V)

PMP70(AA1-659) TTTAAACTCGAGCCGCCATGGCGGCCTT AT

PMP70(AA62-659) AATTATATTATACTCGAGATGGTGTTTTTCTC

PMP70(AA175-659) AATTATATTATACTCGAGATGGGGAATCTGG

PMP70(AA224-659) AATTATATTATACTCGAGATGGCAATTGGAG

PMP70(AA263-659) AATTATATTATACTCGAGATGGGAGAATATA

PMP70(AA314-659) AATTATATTATACTCGAGATGGGCTTCATTG

PMP70(AA341-659) AATTATATTATACTCGAGATGTCTCATCCTCG

PMP70(AA1-347) TTTAAACTCGAGCCGCCATGGCGGCCTT A






AATTATATTATAAGCGGCCGCCTACCGAGAA

ABC-me ATATTATAACTCGAGATGCGCGCCCCTTCTG

PMP70(AA1-659)-GFP TTTAAACTCGAGCCGCCATGGCGGCCTT A


PMP70(AA62-659)-GFP AAATTTCTGCAGGCCATGGTGTTTTTCTCA

PMP70(AA1-271)-GFP TTTAAACTCGAGCCGCCATGGCGGCCTT AT


PMP70(AA1-144)-GFP TTTAAACTCGAGCCGCCATGGCGGCCTT TT


Restriction sites used for directional cloning are underlined (XhoI or PstI in forwa

truncated mutants anneals to downstream of PMP70cDNA and the PCR product w

translation system and examined the role of the regions in the

targeting of PMP70 to peroxisomes

2 Materials and methods

21 Materials

PRO-MIXi L-[35S] in vitro cell labeling mix (70 L-[35S]methionine

and 30 L-[35S]cysteine gt37 TBqmmol) was purchased from Amersham

Biosciences (Piscataway NJ) PROTEIOSi a wheat germ cell-free protein

synthesis core kit was obtained from TOYOBO (Osaka Japan) Nucleotides

such as ATP CTP UTP and GTP for mRNA synthesis were obtained from

Promega (Madison WI) The protein G-agarose and molecular weight marker

were from Sigma (St Louis MO) pQE30 pEU3-NII and pEGFP-N1 were

obtained from Qiagen (Valencia CA) TOYOBO (Osaka Japan) and Clontech

(Palo Alto CA) respectively The mouse anti-His G antibody was from

Invitrogen (Carlsbad CA) Preparation of the antibody against the COOH-

terminal 15 amino acids of rat PMP70 was described in [30] The anti-rat liver

catalase antibodies were raised in guinea pigs [31]

22 Plasmid constructions

The plasmid pcDNA3PEX19 which contains the human cDNA sequence

encoding Pex19p was described in [32] From this cDNA the full-length

Pex19p was excised with BamHI and HindIII and recloned into pQE30 vector

at the corresponding sites to obtain pQE30PEX19 Different cDNA fragments

of PMP70 were amplified using a full-length human PMP70 cDNA [33] as a

template The PCR-generated fragment with XhoI and PstI or NotI and BamHI

restriction sites was subcloned in frame into either pEU3-NII or pEGFP-NI

expression vector respectively The full-length cDNA of mouse ABC-me with

XhoI and NotI sites was generated by PCR using the ABC-me cDNA in pRc

CMV vector [34] as a template The obtained fragment with XhoI and NotI

sites was ligated with pEU3-NII vector The identity of all subclones was

confirmed by semiautomated sequencing on an ABI 310 DNA sequencer

(Perkin Elmer Life Science Wellesley MA) The oligonucleotide primers used

for construction of plasmids are listed in Table 1

GGCTGGCAACTAGAAGGC

AAGGCTCATAC ATGGCTGGCAACTAGAAGGC

ACAACAGAATAGC ATGGCTGGCAACTAGAAGGC

CTCAGGG ATGGCTGGCAACTAGAAGGC

GATATGTTAATTCTCGG ATGGCTGGCAACTAGAAGGC

ATAGTATTATTGCC ATGGCTGGCAACTAGAAGGC

ACATCTCAAGAAG ATGGCTGGCAACTAGAAGGC

ATTATATTATAAGCGGCCGCCTACTTGAGATGTCGAGGATGAGA

ATTATATTATAAGCGGCCGCCTAGGCAATAATACTATCAATGAAGCC

ATTATATTATAAGCGGCCGCCTACCGAGAATTAACATATCTATATTCTCC

ATTATATTATAAGCGGCCGCCTAGCCCTGAGCTCCAATTGC

ATTATATTATAAGCGGCCGCCTAAGCTATTCTGTTGTCCAGATTCCC

AAGGCTCATAC

TTAACATATCTATATTCTCC

CT ATATTATAAGCGGCCGCCTACGCCCGTGCAGGTTCCA

AATTTGGATCCGAGCCGAACTCAACTGTGT

AATTTGGATCCTTGAGATGTCGAGGATGAGAC

AGGCTCATAC AAATTTGGATCCGAGCCGAACTCAACTGTGT

ATTTAGGATCCCGAGAATTAACATATCTATATTCTCCTTC

AATTTGGATCCGCTATTCTGTTGTCCAGATTCC

TAAAGGATCCTTCAAGAAGTTATTAACCAGAGAG

AATTTGGATCCAAATCTTTCCTGCTACGACCAATG

rd primers NotI orBamHI for reverse primers) Reverse primer for N-terminal

as digested at NotI site originally existed in the vector sequence

Fig 1 Overexpression and purification of His-Pex19p His-Pex19p was

expressed and purified as described under Materials and methods Lane 1 total

bacterial proteins before IPTG induction Lane 2 total bacterial proteins after

IPTG induction Lane 3 soluble proteins after sonication Lane 4 fusion

proteins (20 Ag) purified by TALON Metal affinity resin

Y Kashiwayama et al Biochimica et Biophysica Acta 1746 (2005) 116ndash128118

23 Purification of His-Pex19p

The plasmid pQE30PEX19 was transfected to competent M15 pREP4 E

coli cells (Qiagen Valencia CA) according to standard procedures The E coli

cells harboring pQE30PEX19 were grown at 37 -C in LB media containing 01

mgml ampicillin At a cell density of 05 (OD600) protein expression was

induced with 1 mM isopropyl-1-thio-h-d-galactopyranoside (IPTG) for 5 h at

37 -C The cells were harvested by centrifugation at 4000g for 20 min

resuspended in 35 ml of the lysis buffer (50 mM TrisndashHCl pH 75 03 M

NaCl 5 mM imidazole 01 mM phenylmethylsulfonylfluoride (PMSF)) and

disrupted 20 times for 20 s in an ice bath by Astrason XL-2020 ultrasonic

processor (Misonix inc Farmingdale NY) The lysate was centrifuged at

20000g for 30 min and NH2-terminal His6 tagged human Pex19p (His-

Pex19p) in the supernatant was immediately applied to 10 ml of TALON Metal

affinity resin (Clontech Palo Alto CA) equilibrated with the lysis buffer After

extensive washing the His-Pex19p was eluted with the lysis buffer containing

250 mM imidazole The eluted fractions containing His-Pex19p were dialyzed

against 50 mM TrisndashHCl pH 80 50 mM NaCl and 10 mM DTT and stored at

80 -C

24 In vitro transcription and translation

The plasmids encoded full-length and truncated PMP70 and ABC-me were

transcribed in vitro using T7 RNA polymerase and the mRNAs synthesized

were isolated by MicroSpin G-25 column (Amersham Biosciences Piscataway

NJ) Using the purified mRNA cell free translation was performed according to

the bilayer method using PROTEIOSi a wheat germ cell-free protein

synthesis core kit according to the manufacturerrsquos procedure In a typical

experiment mRNAs synthesized above were translated for 24 h at 26 -C in a

300 Al of wheat germ cell-free protein synthesis system containing 50 ACi of[35S] methionine in the presence or absence of 100 Ag of His-Pex19p After

translation the reaction mixture was centrifuged for 20 min at 17000g and

the supernatant was used for co-immunoprecipitation

25 Co-immunoprecipitation

Translation products (50 Al) were precleaned with an appropriate amount of

protein G-agarose in 200 Al of the binding buffer (20 mM HEPESndashKOH pH

75 110 mM potassium acetate 5 mM sodium acetate 2 mM magnesium

acetate 1 mM EDTA 02 Triton X-100 10 mM DTT) After this step the

supernatant was removed and incubated with protein G-agarose beads saturated

with anti-His G antibody After incubation of the suspensions for 2 h at 4 -C

the beads were collected by centrifugation and washed five times with 250 Al ofthe binding buffer Immunoprecipitated proteins were analyzed on a 7ndash15

SDS-polyacrylamide gradient gel The gels were dried and the radioactivity

level in the band corresponding to PMP70 was quantified by Fuji BAS 5000

imaging analyzer (Fuji Film Tokyo Japan)

26 Sucrose density gradient analysis

Translation products (250 Al) were centrifuged at 100000g for 1 h at 4

-C The resultant supernatant was mixed with equal amounts of the 2 binding

buffer without 02 Triton X-100 and subjected to equilibrium density

centrifugation in a 10 ml linear sucrose gradient (5ndash30 (wv)) in a NVT65

rotor (Beckman Fullerton CA) The gradient rested on 05 ml of 50 (wv)

sucrose All solutions contained 20 mM HEPESndashKOH pH 75 110 mM

potassium acetate 5 mM sodium acetate 2 mM magnesium acetate 1 mM

EDTA 10 mM DTT Centrifugation was carried out at 165000g for 4 h at 4

-C Fractions of approximately 10 ml were collected from the bottom of the

tube and the density of each fraction was determined by refractometry

27 Cell culture and transient transfection

CHO-K1 cells were cultured in F12K medium (ICN Aurora OH) with

10 fetal bovine serum at 37 -C and 5 CO2 48 h before transfection 5103

cells were seeded on a Lab-Teki Chamber Slidei System that mounted

8 chambers on a glass slide (Nalge Nunc Rochester NY) All transfections

were performed using Effecten Transfection Reagent (Qiagen Valencia CA)

according to the manufacturerrsquos instructions Two days after transfection the

cells were washed 3 times with phosphate buffered saline (PBS) and fixed for

10 min in 5 paraformaldehyde in PBS for indirect immunofluorescence

28 Indirect immunofluorescence

Immunostaining was performed by essentially the same procedure as

described in [11] The fixed cells were permeabilized in 01 (wv) Triton X-

100 in PBS for 10 min washed 3 times with PBS and incubated with the

primary antibodies for 1 h at room temperature Primary antibodies used in this

study were rabbit antibody against the COOH-terminal 15 amino acids of rat

PMP70 (1200) or guinea pig antibody against rat catalase (1200) Cy3-

conjugated goat anti-rabbit or anti-guinea pig antibody (Amersham Bios-

ciences Piscataway NJ) was used to decorate the first antibody The cells were

mounted in 90 glycerol in 100 mM TrisndashHCl (pH 80) and the samples were

examined by confocal microscopy (Carl Zeiss LSM510 Jena Germany)

29 Other methods

Protein was assayed as described previously [28] Western blot analysis was

done using primary antibodies and a secondary antibody donkey anti-rabbit

IgG antibody conjugated to horseradish peroxidase (Amersham Biosciences

Piscataway NJ) Antigenndashantibody complex was visualized with ECL + Plus

Western blotting detection reagent (Amersham Biosciences Piscataway NJ)

3 Results

31 Overexpression and purification of His-Pex19p

NH2-terminal His6 tagged Pex19p was expressed in E coli

and purified as described under Materials and Methods As

shown in Fig 1 the fusion protein was expressed upon IPTG

induction as a major protein and was exclusively recovered in

a soluble form His-Pex19p purified from the soluble fraction

was gt90 pure as judged by SDS-PAGE (lane 4)

Fig 3 Co-translational interaction between PMP70 and Pex19p (A) 35S-

labeled PMP70 translated in the presence of 100 Ag of His-Pex19p (lanes 1ndash3)

was separated into the soluble and insoluble fractions by the centrifugation of

17000g for 20 min at 4 -C In the case that PMP70 was translated in the

absence of His-Pex19p (lanes 4ndash6) after translation synthesized PMP70 was


32 In vitro translation of PMP70 mRNA

In this study we used wheat germ lysate instead of

reticulocyte lysate for the in vitro protein synthesis system

since wheat germ does not seem to contain functional Pex19p

in mammalian cells First we synthesized mRNA of human

PMP70 and translated it in a wheat germ cell-free protein

synthesis system As shown in Fig 2 a polypeptide with

molecular mass of 70 kDa was detected in the translation

product (lane 2) The polypeptide was confirmed as a

translation product derived from PMP70 mRNA by the

immunoblot analysis with antibody against the COOH-terminal

15 amino acids of PMP70 (lane 4) Densitometric analysis

using bovine serum albumin (BSA) as a standard allowed us to

estimate that uml5 Ag of PMP70 was expressed in a 300 Al oftranslation products during 24 h at 26 -C incubation (data not

shown)

33 Co-translational interaction between PMP70 and Pex19p

To study the interaction between PMP70 and Pex19p we

added purified His-Pex19p in the translation system before or

after translation of PMP70 mRNA and examined the interac-

tion of Pex19p with PMP70 by co-immunoprecipitation using

anti-His G antibody Addition of His-Pex19p showed no effect

on the translation of PMP70 mRNA in this translation system

When PMP70 was translated in the presence of His-Pex19p

about 75 of PMP70 was recovered in the supernatant fraction

after centrifugation at 17000g for 20 min and most of the

PMP70 in the supernatant fraction was co-precipitated with

Pex19p (Fig 3A lanes 1ndash3) In contrast when we added His-

Fig 2 In vitro synthesis of PMP70 PMP70 (AA1ndash659) was synthesized from

a cDNA by in vitro transcription and translation in a wheat germ cell-free

protein synthesis system as described in Materials and methods Lanes 1 and 2

Coomassie Brilliant Blue staining Lanes 3 and 4 immunoblot with anti-

PMP70 COOH-terminal antibody The samples are as followed translation

product in the absence (lanes 1 and 3) or presence (lanes 2 and 4) of PMP70

mRNA

incubated with 100 Ag of His-Pex19p for 2 h at 26 -C followed by separation

into the soluble and insoluble fractions Equivalent portions of the total (lanes 1

and 4) and the soluble (lanes 2 and 5) fractions were separated by SDS-PAGE

Equivalent portions of the soluble fractions were further subjected to co-

immunoprecipitation with anti-His G antibody (lanes 3 and 6) (B) A portion of

each fraction obtained in A was separated by SDS-PAGE and subjected to

immunoblot analysis with anti-His G antibody

Pex19p after translation of PMP70 only 25 of PMP70 was

recovered in the supernatant fraction and only a small amount

of PMP70 in the fraction was co-precipitated with Pex19p

(lanes 4ndash6) Under the same experimental conditions His-

Pex19p itself existed in the supernatant fractions (Fig 3B)

These results suggest that Pex19p interacts with PMP70 co-

translationally and keeps PMP70 in a soluble form

34 Solubilization of in vitro translated PMP70 with Pex19p

In the absence of Pex19p about 75 of in vitro translated

PMP70 was recovered in insoluble fraction suggesting that

PMP70 can aggregate Therefore we examined the effect of

Pex19p to solubilize PMP70 using different concentration of

Pex19p As shown in Fig 4 Pex19p improved the recovery of

PMP70 in the supernatant fraction dose-dependently In the

presence of 100 Ag of Pex19p about 75 of PMP70 was

detected in the supernatant fraction The PMP70 still remained

at the supernatant fraction after centrifugation at 100000g for

Fig 4 Solubilization of PMP70 with Pex19p (A) PMP70 was translated in

vitro in the presence of [35S] methionine and various amounts of Pex19p These

translation products (T) were separated into the soluble (S) and pellet (P)

fractions by the centrifugation of 17000g for 20 min at 4 -C Equivalent

portions of these fractions were analyzed by SDS-PAGE followed by

autoradiography (B) The amount of soluble and insoluble PMP70 in panel A

were quantified by Fuji BAS 5000 imaging analyzer and the relative ratio of

soluble and insoluble PMP70 was calculated The open circles show the

amount of PMP70 in soluble fraction and the closed circles show the amount in

insoluble fraction

Fig 5 Specificity of Pex19p for PMP70 (A) ABC-me was translated and

labeled with [35S] methionine in the absence (lanes 1ndash3) or presence (lanes 4ndash

6) of 100 Ag of His-Pex19p These translation products (T) were separated into

the soluble (S) and pellet (P) fractions by the centrifugation of 17000g for 20

min at 4 -C Equivalent portions of these fractions were separated by SDS

PAGE followed by autoradiography The soluble fraction obtained in the

presence of Pex19p was further subjected to co-immunoprecipitation with anti

His G antibody (lanes 7 and 8) (B) ABC-me and PMP70 were co-translated in

the absence (lanes 1ndash3) or presence (lanes 4ndash6) of 100 Ag of His-Pex19p

Equivalent portions of the soluble (S) and pellet (P) fractions prepared as

described in A were analyzed by SDS-PAGE (5ndash10 acrylamide gels instead

of usual 7ndash15 gels) The soluble fraction obtained in the presence of Pex19p

was further analyzed by the co-immunoprecipitation with anti-His G antibody

(lanes 7 and 8) (C) The relative ratio of soluble ABC-me (open bars) and

PMP70 (closed bars) in B was calculated by Fuji BAS 5000 imaging analyzer


1 h (data not shown) indicating that PMP70 exists as a soluble

form in conjugation with Pex19p

To examine the specificity of Pex19p for PMP70 ABC-

me a mitochondrial ABC protein which possesses 6

transmembrane domains (TMDs) like PMP70 was translated

in the absence or presence of 100 Ag of Pex19p In the

absence of Pex19p only 10 of ABC-me was recovered in

the soluble fraction Even in the presence of Pex19p ABC-me

was not solubilized efficiently and only 15 of ABC-me was

recovered in the soluble fraction (Fig 5A) The amount was

less than that of PMP70 in the absence of Pex19p and ABC-

me in the soluble fraction was not co-immunoprecipitated

with Pex19p Furthermore when ABC-me and PMP70

mRNAs were co-translated either in the absence or presence

of Pex19p almost the same amount of ABC-me and PMP70

was expressed in each condition Under the conditions

PMP70 was preferentially solubilized by Pex19p and only

PMP70 was co-immunoprecipitated with Pex19p from the

soluble fraction (Fig 5B and C) The solubility of PMP70 in

the presence of Pex19p was decreased by the co-expression

with ABC-me (Fig 4 vs Fig 5B) PMP70 might be

associated with the aggregation of ABC-me under the

condition In addition BSA instead of Pex19p was added to

the translation system of PMP70 since BSA is well known to

solubilize hydrophobic polypeptides Some improvement of

the solubilization was observed 30 40 and 45 of PMP70

was recovered in the soluble fraction in the presence of 20

50 and 100 Ag of BSA respectively However PMP70 was

not co-immunoprecipitated with anti-BSA antibody and both

in the presence or absence of BSA almost the same amount

of PMP70 was solubilized by Pex19p and the amount of

-

-


PMP70 co-immunoprecipitated with anti-His G antibody was

not interfered by the presence of BSA (date not shown) These

data strongly suggest that Pex19p preferentially interacts with

PMP70 and solubilizes it efficiently

35 Stoichiometry for the binding of PMP70 to Pex19p

To analyze the stoichiometry of Pex19p to PMP70 in the

complex we translated PMP70 in the presence of 100 Ag of

His-Pex19p and the molecular mass of the complex in the

soluble fraction was examined by the sucrose density gradient

centrifugation As shown in Fig 6A PMP70 was recovered in

the fractions 1ndash2 and 7 which corresponded to an approximate

molecular mass of gt400 kDa and 100 kDa respectively His-

Pex19p was recovered mainly in the fractions 9ndash11 which

corresponded to a monomeric form of His-Pex19p (34 kDa)

The different distribution between Pex19p and PMP70 seems

to be reasonable since excess amount of His-Pex19p (uml40

times as much as PMP70) was included in the translation

product of PMP70 However a small part of Pex19p was

detected in the fraction 7 Under longer exposure Pex19p was

Fig 6 Sucrose gradient centrifugation of PMP70ndashPex19p complex (A)

Translation product was centrifuged at 100000g for 1h at 4 -C The resultant

supernatant was loaded on the sucrose gradient (See Materials and methods)

After centrifugation 11 fractions were collected from the bottom of the tube

Aliquots of each fraction were subjected to SDS-PAGE and immunoblot

analysis was performed using anti-PMP70 COOH-terminal antibody (upper

panel) and anti-His G antibody (lower panel) The molecular mass of PMP70ndash

Pex19p complex was calculated by referring to the molecular weights of

standard proteins carbonic anhydrase (29 kDa) bovine serum albumin (66

kDa) alcohol dehydrogenase (150 kDa) h-amylase (200 kDa) and apoferritin

(443 kDa) respectively Lane T PMP70 or His-Pex19p in the soluble fraction

after centrifugation at 100000g for 1h at 4 -C (B) Fractions 1 and 7 in A

were subjected to immunoprecipitation with anti-His G antibody The

immunoprecipitated proteins were then analyzed by immunoblotting using

anti-PMP70 COOH-terminal antibody (upper panel) and anti-His G antibody

(lower panel)

also detected in fraction 6 (data not shown) Indeed Pex19p

was immunoprecipitated from fraction 7 and PMP70 was co-

purified with Pex19p (Fig 6B) Considering the molecular

mass of PMP70 (70 kDa) and Pex19p (34 kDa) one molecule

of Pex19p seems to associate with one molecule of PMP70 in

the fractions On the other hand Pex19p was not precipitated

from fraction 1 As a control experiment PMP70 translated

without His-Pex19p was sedimented in fraction 1 under the

same condition (data not shown) These results suggest that

PMP70 in the fractions 1 and 2 exist as a large aggregate

without Pex19p

36 Identification of Pex19p interaction sites of PMP70

To identify the regions of PMP70 that are required for the

interaction with Pex19p we constructed various NH2-terminal

or COOH-terminal truncated PMP70s as shown in Figs 7A

and 8A based on putative topology of PMP70 [35] First the

PMP70 cDNAs encoding full-length and NH2-terminal trun-

cated PMP70 were transcribed with T7 RNA polymerase and

the transcripts were translated in vitro in a wheat germ protein

synthesis system in the presence of [35S] methionine and His-

Pex19p and soluble fractions were prepared by the centrifu-

gation 35S-labeled polypeptides with expected molecular

masses and several smaller polypeptides were detected (Fig

7B) Taking the intensity of the labeled band and the number of

methionine and cysteine residues of each deletion construct

into consideration we estimated that the amount of the major

translation product from each construct was almost the same

They were immunoprecipitated with antibody against COOH-

terminal 15 amino acids of PMP70 (data not shown) Assuming

the band corresponding to the highest molecular size of PMP70

in each lane is a translation product from the first methionine

residue some major translation products PMP70 (AA224ndash

659 263ndash659 314ndash659 and 341ndash659) seem to be slightly

proteolytically processed in the NH2-terminal regions or

translated from internal methionine residues in the PMP70

cDNAs (Fig 7B)

Using these translation products the PMP70s were co-

immunoprecipitated using anti-His G antibody 35S-labeled

PMP70 (AA1ndash659) was precipitated with the antibody In

same cases 35S-labeled PMP70 (AA1ndash659) existed as very

close doublet bands (Figs 7B and 8B) but they were

immunoprecipitated with almost the same efficiency PMP70

(AA62ndash659) was also immunoprecipitated but the amount of

immunoprecipitable PMP70 was reduced and the efficiency

decreased to uml40 compared with that of full-length PMP70

(Fig 7C) Similar reduced efficiency was obtained in the cases

of PMP70 (AA175ndash659 224ndash659 and 263ndash659) In PMP70

(AA314ndash659) and PMP70 (AA341ndash659) the efficiency

further decreased to less than 10 and 5 of full-length

PMP70 respectively These results suggest that NH2-terminal

61 amino acids and the region around TMD5 are required for

efficient interaction of PMP70 and Pex19p but COOH-terminal

half of PMP70 including TMD6 (AA314ndash659) is not

In the translation products of COOH-terminal truncations of

PMP70 each PMP70 showed clearly two bands (Fig 8B) The

Fig 8 Binding of Pex19p to COOH-terminal truncated PMP70 (A) Schematic

drawing of the COOH-terminal truncated PMP70 constructs Black boxes

represent the position of the six putative TMDs (B) COOH-terminal truncated

PMP70s were translated and labeled with [35S]methionine in the presence o

His-Pex19p After centrifugation at 17000g for 20 min at 4 -C PMP70s in

the supernatant fraction were subjected to immunoprecipitation using anti-His

G antibody Co-purified PMP70s were analyzed by SDS-PAGE followed by

autoradiography (C) The relative bound percentage was expressed as a ratio o

the bound percentage of each mutant with that of full-length PMP70

Fig 7 Binding of Pex19p to NH2-terminal truncated PMP70 (A) Schematic

drawing of the NH2-terminal truncated PMP70 constructs Black boxes

represent the position of the six putative TMDs (B) NH2-terminal truncated

PMP70s were translated and labeled with [35S] methionine in the presence of


the supernatant fractions were subjected to immunoprecipitation using anti-His


autoradiography (C) The radioactivity of co-purified PMP70s shown in B was

measured by Fuji BAS 5000 imaging analyzer and the relative bound

percentage was expressed as a ratio of the bound percentage of each mutant

with that of full-length PMP70


difference of the molecular mass of the two polypeptides in

each lane was almost the same (approximately 2ndash3 kDa)

suggesting the lower band is a polypeptide truncated about 20ndash

30 amino acids from NH2-terminal of PMP70 Full-length of

PMP70 also showed two bands Two polypeptides of PMP70

(AA1ndash347) lacking COOH-terminal half of PMP70 were co-

immunoprecipitated essentially at the same efficiency and the

immunoprecipitable efficiency of the polypeptides were

reduced by only 20 of full-length PMP70 (Fig 8C) In

contrast the deletion of amino acid 322ndash659 including TMD6

decreased the efficiency to 40 compared with full-length

PMP70 Additional deletion of TMD5 and TMD4 PMP70

(AA1ndash271 and 1ndash229) did not decrease the efficiency and

the deletion of TMD3 PMP70 (AA1ndash183) slightly decreased

the efficiency compared to PMP70 (AA1ndash347) These results

also suggest that TMD6 but not COOH-terminal half of

PMP70 is required for efficient interaction between PMP70

and Pex19p

To confirm that the regions around the NH2-terminal 61

amino acids and TMD5 and 6 of PMP70 are important for the

interaction with Pex19p we translated various constructs

containing these regions in fusion with E coli dihydrofolate

f

f

Fig 10 Binding of Pex19p to PMP70 lacking NH2-terminal 61 amino acids

and TMD 5 and 6 (A) Full-length and truncated PMP70s were translated and

labeled with [35S] methionine in the presence of His-Pex19p After

centrifugation at 17000g for 20 min at 4 -C the PMP70s in the supernatant

fraction were subjected to immunoprecipitation using anti-His G antibody Co-

purified PMP70s were analyzed by SDS-PAGE followed by autoradiography

(B) The relative bound percentage was expressed as a ratio of the bound

percentage of each mutant with that of full-length PMP70

Fig 9 Binding of Pex19p to PMP70DHFR chimera (A) E coli DHFR or its

fusion proteins with either or both of NH2-terminal 61 amino acids or TMD5

and 6 of PMP70 were translated and labeled with [35S] methionine in the

presence of His-Pex19p After centrifugation at 17000g for 20 min at 4 -C

soluble proteins were subjected to immunoprecipitation using anti-His G

antibody Co-purified proteins were analyzed by SDS-PAGE followed by

autoradiography (B) The relative bound percentage was expressed as a ratio of

the bound percentage of each fusion protein with that of full-length PMP70


reductase (DHFR) and performed co-immunoprecipitation

(Fig 9) DHFR did not interact with Pex19p at all However

chimeric proteins containing the NH2-terminal first 61 amino

acids or TMD5 and 6 of PMP70 showed the interaction with

Pex19p Furthermore the fusion protein containing the both

regions (NH2-terminal first 61 amino acids and COOH-

terminal TMD5 and 6) increased the efficiency of the

interaction On the other hand to examine whether TMD1ndash4

is important for the efficient interaction of PMP70 and Pex19p

PMP70 (AA62ndash271) lacking both NH2-terminal 61 amino

acids and TMD5 and 6 was translated and examined the

interaction with Pex19p As shown in Fig 10 PMP70

(AA62ndash271) was immunoprecipitated with anti-His G anti-

body but the efficiency was uml40 of full-length PMP70 and

was comparable to that of PMP70 (AA62ndash659) and PMP70

(AA1ndash321) Therefore the TMD1ndash4 still has the ability to

bind Pex19p but both NH2-terminal 61 amino acids as well as

TMD5 and 6 are required for the efficient binding to Pex19p


Fig 11 Intracellular localization of PMP70ndashGFP fusion proteins (A) Constructs of PMP70 truncation mutants and their peroxisomal localization The ellipse shows

the position of GFP black boxes represent the position of the six putative TMDs (B C) GFP GFP-SKL and PMP70ndashGFP fusion proteins were expressed in CHO

cells The cellular distribution of the fusion proteins except for PMP70 (AA1ndash659)-GFP and PMP70 (AA62ndash659)-GFP was compared with the localization of the

endogenous PMP70 detected by immunofluorescence staining with anti-PMP70 COOH-terminal antibody In the case of PMP70 (AA1ndash659)-GFP and PMP70

(AA62ndash659)-GFP their intracellular localization was compared with the peroxisomal marker enzyme catalase detected by immunofluorescence staining with anti-

catalase antibody Peroxisomal staining pattern was shown on the left EGFP fluorescence in the center and superimposition of both stains on the right


37 Role of the regions of PMP70 that interact with Pex19p in

the targeting process of PMP70 to peroxisome

To determine the role of Pex19p we expressed various

deletion constructs of PMP70 in fusion with the NH2-terminus

of green fluorescent protein (GFP) in CHO cells and examined

their intracellular localization by immunofluorescence (Fig

11A) GFP was found in the cytosol and did not display any

peroxisomal localization However GFP-SKL that contained

PTS1 was directed to peroxisomes (Fig 11B) Also PMP70

(AA1ndash659)-GFP and PMP70 (AA1ndash347)-GFPwere localized

to peroxisomes However fusion proteins lacking the Pex19p

interaction sites corresponding to the NH2-terminal first 61

amino acids or TMD5 and 6 as in PMP70 (AA62ndash659)-GFP

and PMP70 (AA1ndash271)-GFP were exclusively mislocalized in

the cytosol These results suggest that the regions interacting

with Pex19p are important for proper targeting of PMP70

Concerning the candidate region(s) responsible for the

targeting of PMP70 to the peroxisomal membranes we

constructed further COOH-terminal deletions of PMP70-GFP

(Fig 11C) The truncated fusion proteins PMP70 (AA1ndash

183)-GFP and PMP70 (AA1ndash144)-GFP reappeared the

peroxisomal localization (see Discussion) However PMP70

(AA1ndash122)-GFP was diffused to the cytosol and was not

localized to peroxisomes These results suggest that the

putative peroxisomal targeting signal of PMP70 is just around

TMD2 and does not overlap the Pex19p interaction site at

NH2-terminal 61 amino acids Around TMD2 there is the

positively charged basic amino acid cluster which is suggested

to be the peroxisomal targeting motif of other PMPs

4 Discussion

Pex19p is essential for the early steps of peroxisome

biogenesis and most likely involved in peroxisomal membrane

synthesis Although its precise function is still unknown it

seems to act as a chaperone-like protein for peroxisomal

targeting and insertion of various PMPs [21ndash25] To better

understand the role of Pex19p in the targeting process of PMPs

we expressed human PMP70 and its truncated mutants in

wheat germ in vitro protein synthesis systems and investigated

the interaction between PMP70 and Pex19p

First in this study we found that Pex19p bound to PMP70

co-translationally and improved its solubility (Figs 3 and 4)

The interaction of Pex19p and PMP70 showed specificity and

Pex19p did not interact with ABC-me a mitochondrial

membrane protein (Fig 5) The complex of Pex19p and

PMP70 showed the molecular mass of uml100 kDa (Fig 6)

suggesting that one molecule of Pex19p binds to one molecule

of PMP70 As PMP70 is a hydrophobic integral membrane

protein PMP70 must require Pex19p to keep it in a soluble

form In addition newly synthesized PMP70 is known to stay

in the cytosol and be rapidly degraded in CHO cells harboring

mutant PEX19 gene [29] Very recently PMP34 has also

shown to be degraded rapidly in Pex19p deficient human

fibroblast [36] Therefore the interaction of PMP70 with

Pex19p is also required for the proper conformation of PMP70

to target it to peroxisomes PMP70 might be misfolded

without Pex19p in the cytosol and degraded by proteasomes

which participate in the degradation of many misfolded

proteins [3738]


Pex19p is mainly located in the cytosol but it can also

associate with peroxisomal membranes therefore the cellular

site where Pex19p functions is complicated Snyder et al [24]

assumed Pex19p interacts with preexisting PMPs on the

peroxisomal membrane Gould and coworkers [2336] how-

ever concluded Pex19p interacts with newly synthesized PMPs

in cytosol Our data is consistent with the latter case because

our co-immunoprecipitation experiments were performed with

lysate which lacks peroxisomal membranes The solubilization

effect of Pex19p strongly suggests its chaperone-like function

in the targeting process of PMPs Further the complex of

PMP70 or other PMPs with Pex19p seems to be kept in import

competent state We previously showed PMP70 translated in a

rabbit reticulocyte lysate was recovered in the soluble fractions

and was inserted into isolated peroxisomal membranes by

cytosolic factor dependent manner [30] We also found the

solubilized PMP70 complex with Pex19p retained the perox-

isomal insertion ability PMP70 but not Pex19p in the complex

was inserted in rat liver peroxisomes in vitro (data not shown)

Previous observations have shown that 70ndash80 of PMP22

synthesized by in vitro translation are soluble in a rabbit

reticulocyte lysate and detailed analysis revealed that PMP22

bound to either TCP1 ring complex (TRiC) the eukaryotic

homolog of GroEL or a single 40 kDa polypeptide [3940]

PMP22 bound to this 40 kDa protein was efficiently inserted

into peroxisomes [40] The 40 kDa protein could be Pex19p

since we recently found Pex19p also efficiently associated with

PMP22 in our in vitro protein synthesis system [41]

Second we tried to determine which regions of PMP70

were required to interact with Pex19p We have demonstrated

that the NH2-terminal 61 amino acids (possibly NH2-terminal

2030ndash61 amino acids) and regions of TMD5 and 6 were

required for the efficient binding to Pex19p from the following

observations (1) The interaction of PMP70 with Pex19p was

markedly decreased by the truncation of the NH2-terminal 61

amino acids of PMP70 (Fig 7) (2) COOH-terminal truncation

of TMD6 also reduced the interaction but further deletion of

TMD3ndash5 did not show additional reduction (Fig 8) (3) The

chimera proteins that the NH2-terminal 61 amino acids as well

as TMD5 and 6 were fused with E coli DHFR associated with

Pex19p (Fig 9) (4) Molecular sizes of PMP70 translated in

our in vitro translation system suggest that some PMP70s could

be processed NH2-terminal 20ndash30 amino acids (Figs 7B and

8B) This truncation did not affect our conclusion Further

under our experimental conditions a single Pex19p bound to a

single PMP70 therefore Pex19p would bind at these two

points and the lack of either region leads to a decrease in the

interaction

Recently Rottensteiner et al deduced amino acid sequence

xxx[CFILTVW]xx[ACFILQVWY][CILV]xx[ACFILV-

WY][ILQRV]xxx as the common Pex19p binding motif in

PMPs They also suggested that the Pex19p binding sites of

Pex13p and Pex11p are an essential part of the mPTS and the

Pex19p binding sites in conjunction with one or more adjacent

TMDs are sufficient for peroxisomal targeting and insertion of

Pex13p in yeast cells [42] We screened human PMP70

sequence against the predicted Pex19p binding motif and

found eight regions corresponded to the motif Among them

three sites were found in TMD5ndash6 and were overlapped with

one of the Pex19p binding sites we found but none of these

sites were found in NH2-terminal 61 amino acids region

another Pex19p binding site

The Pex19p binding regions at NH2-terminal 61 amino

acids and TMD5 and 6 were also important for the targeting of

PMP70 From the immunofluorescence study GFP fusion

proteins lacking either these two regions as in PMP70

(AA62ndash659)-GFP and PMP70 (AA1ndash271)-GFP did not

show any peroxisomal localization (Fig 11B) In some PMPs

the Pex19p binding sites are suggested to be overlapped with

their targeting elements and Pex19p is thought to function as

the targeting signal receptor of PMPs [18233543] The above

findings might support that these regions in PMP70 are

included in their targeting element However we found the

candidate for the targeting element of PMP70 that was distinct

from the Pex19p binding sites at NH2-terminal 61 amino acids

and around TMD 5 and 6 by the following observations To

identify the targeting element of PMP70 we constructed

several COOH-terminal deletions of PMP70-GFP and per-

formed immunofluorescence study PMP70 (AA1ndash271)-GFP

lost its targeting ability as described above but further COOH-

terminal deletions of PMP70-GFP PMP70 (AA1ndash183)-GFP

and PMP70 (AA1ndash144)-GFP reappeared the peroxisomal

localization On the other hand further deletion construct

PMP70 (AA1ndash122)-GFP lost its targeting again (Fig 11C)

These results suggest that the targeting signal of PMP70 is

located around TMD2 PMP70 (AA123ndash144) and different

from the Pex19p binding sites Concerning the reappearance of

peroxisomal localization after deletion of TMD 4ndash6 we

assume a following possibility PMP70 (AA1ndash271) lacking

TMD 5ndash6 did not keep it in suitable conformation for targeting

since the region lacked is important for the efficient binding to

Pex19p On the other hand in the cases of PMP70 (AA1ndash183)

and PMP70 (AA1ndash144) they possess only two or three TMDs

and become more hydrophilic than PMP70 (AA1ndash271) It

might be able to keep them in suitable conformations for the

targeting although they possess only one Pex19p binding site at

the NH2-terminal 61 amino acids

Sacksteder et al also obtained the similar evidence that

PMP70 (AA1ndash183)-myc and PMP70 (AA1ndash124)-myc tar-

geted to peroxisomes but PMP70 (AA1ndash101) mis-targeted to

mitochondria [23] Recently Biemanns and Gartner have

demonstrated that efficient peroxisomal targeting of PMP70

is depend on NH2-terminal 61ndash160 amino acids including

TMD1 and 2 using NH2-terminal GFP fused PMP70 In their

experiment the construct lacking NH2-terminal 60 amino acids

still targeted to peroxisomes [44] Around TMD2 there is the

positively charged basic amino acid cluster resembling the

peroxisomal targeting motif of other PMPs [45ndash47] These

results suggest that Pex19p is not likely to function as the

specific receptor for the targeting signal of PMP70 Recently

Gould and coworkers proposed a model that Pex19p functions

both as a cytosolic chaperone and targeting signal receptor for

newly synthesized PMPs and Pex19p directs them to the

peroxisomal membrane via binding to Pex3p [3548]


Concerning the chaperone function of Pex19p in the cytosol

our data is in good accordance with the model and Pex19p

contributed to keep PMP70 in a soluble and suitable

conformation for targeting However our data were inconsis-

tent with the model in that Pex19p interact with PMP70 at the

region distinct from its targeting signal Snyder et al also

suggested Pex19p binding sites do not overlap with the

targeting signals of PMPs [24] Furthermore Fransen et al

recently demonstrated that a mutant of Pex13p that failed to

bind to Pex19p but targeted to peroxisomes [49] Pex19p is a

highly acidic protein and possesses the property to interact with

polypeptides both at the hydrophobic regions and the positively

charged cluster(s) The specificity of the interaction seems to

depend on its physical properties The interaction is not

preferential to peroxisomal targeting signals since physiolog-

ical importance about the interaction between Pex19p and non-

peroxisomal proteins such as Type IIa NaPi co-transporter [50]

and p19ARF [51] was shown recently

Recent studies demonstrated Pex19p associates with 13

PMPs including PMP70 using yeast two-hybrid system co-

immunoprecipitation ligand blotting and fluorescence reso-

nance transfer [23ndash264352ndash54] In the case of PMP70

Pex19p has been demonstrated to interact with full-length

PMP70 as well as myc-PMP70 (AA1ndash180 61ndash160 81ndash

160) but no quantitative analysis has not yet been performed

[2644]

Based on our results we propose a hypothetical model for the

targeting of PMP70 In the cytosol Pex19p interacts with

PMP70 co-translationally at the NH2-terminal 61 amino acid

region and TMD5 and 6 and keeps it in soluble and proper

conformation for targeting This solubilized PMP70 is then

targeted to peroxisomes by its own peroxisome targeting signal

located near the TMD2 including a positively charged basic

amino acid cluster and integrated into the peroxisomal

membrane by the peroxisomal membrane insertion mechanism

Acknowledgements

This work was supported in part by a Grad-in Aid for

Scientific Research from the Ministry of Education Culture

Sports Science and Technology of Japan (10217205 and

14370740) and grants from The Hokuriku Industrial Advance-

ment and The Fugaku Trust for Medical Research We would

like to thank San Francisco Edit (wwwsfeditnet) for their

assistance in editing the manuscript

References

[1] H Van den Bosch RBH Schutgens RJA Wanders JM Tager

Biochemistry of peroxisomes Annu Rev Biochem 61 (1992) 157ndash197

[2] PB Lazarow HW Moser in AL Beaudet WS Sly D Valle (Eds)

The Metabolic Basis of Inherited Disease McGraw-Hill Inc New York

1994 pp 2287ndash2324

[3] U Brosius J Gartner Cellular and molecular aspects of Zellweger

syndrome and other peroxisome biogenesis disorders Cell Mol Life Sci

59 (2002) 1058ndash1069

[4] Y Fujiki Peroxisome biogenesis and peroxisome biogenesis disorders

FEBS Lett 476 (2000) 42ndash46

[5] KA Sacksteder SJ Gould The genetics of peroxisome biogenesis

Annu Rev Genet 34 (2000) 623ndash652

[6] S Subramani A Koller WB Snyder Import of peroxisomal matrix and

membrane proteins Annu Rev Biochem 69 (2000) 399ndash418

[7] VI Titorenko RA Rachubinski The life cycle of the peroxisome Nat

Rev Mol Cell Biol 2 (2001) 357ndash368

[8] FJ Vizeacoumar JC Torres-Guzman D Bouard JD Aitchison RA

Rachubinski Pex30p Pex31p and Pex32p form a family of peroxisomal

integral membrane proteins regulating peroxisome size and number in

Saccharomyces cerevisiae Mol Biol Cell 15 (2004) 665ndash677

[9] PB Lazarow Y Fujiki Biogenesis of peroxisomes Annu Rev Cell Biol

1 (1985) 489ndash530

[10] SJ Gould G-A Keller N Hosken J Wilkinson S Subramani A

conserved tripeptide sorts proteins to peroxisomes J Cell Biol 108

(1989) 1657ndash1664

[11] T Osumi T Tsukamoto S Hata S Yokota S Miura Y Fujiki M

Hijikata S Miyazawa T Hashimoto Amino-terminal presequence of the

precursor of peroxisomal 3-ketoacyl-CoA thiolase is a cleavable signal

peptide for peroxisomal targeting Biochem Biophys Res Commun 181

(1991) 947ndash954

[12] BW Swinkels SJ Gould AG Bodnar RA Rachubinski S

Subramani A novel cleavable peroxisomal targeting signal at the

amino-terminus of the rat 3-ketoacyl-CoA thiolase EMBO J 10 (1991)

3255ndash3262

[13] D McCollum E Monosov S Subramani The pas8 mutant of Pichia

pastoris exhibits the peroxisomal protein import deficiencies of Zellweger

syndrome cellsmdashThe PAS8 protein binds to the COOH-terminal tripeptide

peroxisomal targeting signal and is a member of the TPR protein family

J Cell Biol 121 (1993) 761ndash774

[14] M Marzioch R Erdmann M Veenhuis W-H Kunau PAS7 encodes a

novel yeast member of the WD-40 protein family essential for import of 3-

oxoacyl-CoA thiolase a PTS2-containing protein into peroxisomes

EMBO J 13 (1994) 4908ndash4918

[15] T Imanaka GM Small PB Lazarow Translocation of acyl-CoA

oxidase into peroxisomes requires ATP hydrolysis but not a membrane

potential J Cell Biol 105 (1987) 2915ndash2922

[16] M Wendland S Subramani Cytosol-dependent peroxisomal protein

import in a permeabilized cell system J Cell Biol 120 (1993) 675ndash687

[17] S Subramani Protein import into peroxisomes and biogenesis of the

organelle Annu Rev Cell Biol 9 (1993) 445ndash478

[18] CC Chang S South D Warren J Jones AB Moser HW Moser SJ

Gould Metabolic control of peroxisome abundance J Cell Sci 112

(1999) 1579ndash1590

[19] EH Hettema W Girzalsky M van Den Berg R Erdmann B Distel

Saccharomyces cerevisiae pex3p and pex19p are required for proper

localization and stability of peroxisomal membrane proteins EMBO J 19

(2000) 223ndash233

[20] AC Muntau PU Mayerhofer BC Paton S Kammerer AA Roscher

Defective peroxisome membrane synthesis due to mutations in human

PEX3 causes Zellweger syndrome complementation group G Am J

Hum Genet 67 (2000) 967ndash975

[21] ST South SJ Gould Peroxisome synthesis in the absence of preexisting

peroxisomes J Cell Biol 144 (1999) 255ndash266

[22] Y Matsuzono N Kinoshita S Tamura N Shimozawa M Hamasaki

K Ghadi RJA Wanders Y Suzuki N Kondo Y Fujiki Human

PEX19 cDNA cloning by functional complementation mutation

analysis in a patient with Zellweger syndrome and potential role in

peroxisomal membrane assembly Proc Natl Acad Sci U S A 96

(1999) 2116ndash2121

[23] KA Sacksteder JM Jones ST South X Li Y Liu SJ Gould PEX19

binds multiple peroxisomal membrane proteins is predominantly cyto-

solic and is required for peroxisome membrane synthesis J Cell Biol

148 (2000) 931ndash944

[24] WB Snyder A Koller AJ Choy S Subramani The peroxin Pex19p

interacts with multiple integral membrane proteins at the peroxisomal

membrane J Cell Biol 149 (2000) 1171ndash1178

[25] M Fransen T Wylin C Brees GP Mannaerts PP Van Veldhoven

Human pex19p binds peroxisomal integral membrane proteins at


regions distinct from their sorting sequences Mol Cell Biol 21 (2001)

4413ndash4424

[26] CJ Gloeckner PU Mayerhofer P Landgraf AC Muntau A Holzinger

J-K Gerber S Kammerer J Adamski AA Roscher Human adreno-

leukodystrophy protein and related peroxisomal ABC transporters interact

with the peroxisomal assembly protein PEX19p Biochem Biophys Res

Commun 271 (2000) 144ndash150

[27] K Kamijo S Taketani S Yokota T Osumi T Hashimoto The 70-kDa

peroxisomal membrane protein is a member of the Mdr (P-glycoprotein)-

related ATP-binding protein superfamily J Biol Chem 265 (1990)

4534ndash4540

[28] T Imanaka K Aihara T Takano A Yamashita R Sato Y Suzuki S

Yokota T Osumi Characterization of the 70-kDa peroxisomal membrane

protein an ATP binding cassette transporter J Biol Chem 274 (1999)

11968ndash11976

[29] N Kinoshita K Ghaedi N Shimozawa RJA Wanders Y Matsuzono

T Imanaka K Okumoto Y Suzuki N Kondo Y Fujiki Newly

identified Chinese hamster ovary cell mutants are defective in biogenesis

of peroxisomal membrane vesicles (Peroxisomal ghosts) representing a

novel complementation group in mammals J Biol Chem 273 (1998)

24122ndash24130

[30] T Imanaka Y Shiina T Takano T Hashimoto T Osumi Insertion of the

70-kDa peroxisomal membrane protein into peroxisomal membranes in

vivo and in vitro J Biol Chem 271 (1996) 3706ndash3713

[31] S Yokota HD Fahimi Immunocytochemical localization of catalase in

rat liver J Histochem Cytochem 29 (1982) 805ndash812

[32] S Kammerer N Arnold W Gutensohn HW Mewes WH Kunau G

Hofler AA Roscher A Braun Genomic organization and molecular

characterization of a gene encoding HsPXF a human peroxisomal

farnesylated protein Genomics 45 (1997) 200ndash210

[33] K Kamijo N Kamijo I Ueno T Osumi T Hashimoto Nucleotide

sequence of the human 70 kDa peroxisomal membrane protein a member

of ATP-binding cassette transporters Biochim Biophys Acta 1129 (1992)

323ndash327

[34] E Miyazaki Y Kida K Mihara M Sakaguchi Switching the sorting

mode of membrane proteins from cotranslational endoplasmic reticulum

targeting to posttranslational mitochondrial import Mol Biol Cell 16

(2005) 1788ndash1799

[35] N Shani D Valle Peroxisomal ABC transporters Peroxisomal ABC

transporters Methods Enzymol 292 (1998) 753ndash755

[36] JM Jones JC Morrell SJ Gould PEX19 is a predominantly cytosolic

chaperone and import receptor for class 1 peroxisomal membrane

proteins J Cell Biol 164 (2004) 57ndash67

[37] O Coux K Tanaka AL Goldberg Structure and functions of the 20S

and 26S proteasomes Annu Rev Biochem 65 (1996) 801ndash847

[38] K Ferrell CRM Wilkinson W Dubiel C Gordon Regulatory subunit

interactions of the 26S proteasome a complex problem Trends Biochem

Sci 25 (2000) 83ndash88

[39] P Diestelkotter WW Just In vitro insertion of the 22-kD peroxisomal

membrane protein into isolated rat liver peroxisomes J Cell Biol 123

(1993) 1717ndash1725

[40] B Pause P Diestelkotter H Heid WW Just Cytosolic factors mediate

protein insertion into the peroxisomal membrane FEBS Lett 414 (1997)

95ndash98

[41] H Shibata Y Kashiwayama T Imanaka H Kato Domain architecture

and activity of human Pex19p a chaperone-like protein for intracellular

trafficking of peroxisomal membrane proteins J Biol Chem 279 (2004)

38486ndash38494

[42] H Rottensteiner A Kramer S Lorenzen K Stein C Landgraf R

Volkmer-Engert R Erdmann Peroxisomal membrane proteins contain

common Pex19p-binding sites that are an integral part of their targeting

signals Mol Biol Cell 15 (2004) 3406ndash3417

[43] U Brosius T Dehmel J Gartner Two different targeting signals direct

human peroxisomal membrane protein 22 to peroxisomes J Biol Chem

277 (2002) 774ndash784

[44] M Biermanns J Gartner Targeting elements in the amino-terminal part

direct the human 70-kDa peroxisomal integral membrane protein

(PMP70) to peroxisomes Biochem Biophys Res Commun 285

(2001) 649ndash655

[45] M Honsho Y Fujiki Topogenesis of peroxisomal membrane protein

requires a short positively charged intervening-loop sequence and

flanking hydrophobic segments J Biol Chem 276 (2001) 9375ndash9382

[46] X Wang MJ Unruh JM Goodman Discrete targeting signals direct

Pmp47 to oleate-induced peroxisomes in Saccharomyces cerevisiae

J Biol Chem 276 (2001) 10897ndash10905

[47] M Honsho T Hiroshige Y Fujiki The membrane biogenesis peroxin

Pex16p topogenesis and functional roles in peroxisomal membrane

assembly J Biol Chem 277 (2002) 44513ndash44524

[48] Y Fang JC Morrell JM Jones SJ Gould PEX3 functions as a PEX19

docking factor in the import of class I peroxisomal membrane proteins


[49] M Fransen I Vastiau C Brees V Brys GP Mannaerts PP Van

Veldhoven Potential role for Pex19p in assembly of PTS-receptor

docking complexes J Biol Chem 279 (2004) 12615ndash12624

[50] M Ito S Iidawa M Izuka S Haito H Segawa M Kuwahata I

Ohkido H Ohno K Miyamoto Interaction of a farnesylated protein with

renal type IIa NaPi co-transporter in response to parathyroid hormone and

dietary phosphate Biochem J 377 (2004) 607ndash616

[51] T Sugihara SC Kaul J Kato RR Reddel H Nomura R Wadhwa

Pex19p dampens the p19ARF-p53-p21WAF1 tumor suppressor pathway

J Biol Chem 276 (2001) 18649ndash18652

[52] PU Mayerhofer T Kattenfeld AA Roscher AC Muntau Two

splice variants of human PEX19 exhibit distinct functions in

peroxisomal assembly Biochem Biophys Res Commun 291 (2002)

1180ndash1186

[53] JM Jones JC Morrell SJ Gould Multiple distinct targeting signals

in integral peroxisomal membrane proteins J Cell Biol 153 (2001)

1141ndash1149

[54] AC Muntau AA Roscher WH Kunau G Dodt The interaction

between human PEX3 and PEX19 characterized by fluorescence

resonance energy transfer (FRET) analysis Eur J Cell Biol 82 (2003)

334ndash342


Much less is known regarding the targeting and assembly of

peroxisomal membrane proteins (PMPs) They do not contain a

recognizable PTS1 or PTS2 sequence [17] and their import is

independent of PTS1 or PTS2 receptors [1819] Therefore

PMPs seem to be imported into peroxisomes by a distinct

mechanism by which peroxisomal matrix proteins are

imported Most PEX genes are required for importing of

peroxisomal matrix proteins but not for peroxisomal membrane

biogenesis Only cells harboring the mutant genes of PEX3

PEX16 and PEX19 lack detectable peroxisomal structures

[20ndash22] indicating that these gene products are involved in the

synthesis of the peroxisomal membrane or the import of PMPs

Pex19p the PEX19 gene product is mainly located in the

cytosol and can also associate with the peroxisomal membrane

[23] Pex19p has been shown to bind multiple PMPs [23ndash26]

and the defect of this protein results in degradation andor

mislocalization of PMPs [19] Moreover the mislocalization of

Pex19p to the nucleus leads to the accumulation of PMPs in the

nucleoplasm [23] From these observations it is suggested that

Pex19p is able to act as a chaperone for PMPs

PMP70 is one of the major components of the mammalian

peroxisomal membranes and belongs to the ATP-binding

cassette protein superfamily [2728] It consists of 659 amino

acid residues and the putative topology of PMP70 predicts six

transmembrane segments with NH2- and COOH-terminus

facing the cytoplasm In the PEX19 mutant cell PMP70

mostly remained in the cytosol and was degraded rapidly [29]

This finding was interpreted to suggest that the interaction

between Pex19p and PMP70 was important for the targeting of

PMP70 To better understand the role of Pex19p in the

targeting process of PMP70 we have characterized the binding

of Pex19p to various regions of PMP70 using an in vitro

Table 1

Oligonucleotide primer sequences used for construction of plasmids

Conctruct name Oligonucleotide Primer (5VY3V)

PMP70(AA1-659) TTTAAACTCGAGCCGCCATGGCGGCCTT AT


PMP70(AA175-659) AATTATATTATACTCGAGATGGGGAATCTGG

PMP70(AA224-659) AATTATATTATACTCGAGATGGCAATTGGAG

PMP70(AA263-659) AATTATATTATACTCGAGATGGGAGAATATA

PMP70(AA314-659) AATTATATTATACTCGAGATGGGCTTCATTG

PMP70(AA341-659) AATTATATTATACTCGAGATGTCTCATCCTCG







AATTATATTATAAGCGGCCGCCTACCGAGAA

ABC-me ATATTATAACTCGAGATGCGCGCCCCTTCTG



PMP70(AA62-659)-GFP AAATTTCTGCAGGCCATGGTGTTTTTCTCA

PMP70(AA1-271)-GFP TTTAAACTCGAGCCGCCATGGCGGCCTT AT


PMP70(AA1-144)-GFP TTTAAACTCGAGCCGCCATGGCGGCCTT TT


Restriction sites used for directional cloning are underlined (XhoI or PstI in forwa

truncated mutants anneals to downstream of PMP70cDNA and the PCR product w

translation system and examined the role of the regions in the

targeting of PMP70 to peroxisomes

2 Materials and methods

21 Materials

PRO-MIXi L-[35S] in vitro cell labeling mix (70 L-[35S]methionine

and 30 L-[35S]cysteine gt37 TBqmmol) was purchased from Amersham

Biosciences (Piscataway NJ) PROTEIOSi a wheat germ cell-free protein

synthesis core kit was obtained from TOYOBO (Osaka Japan) Nucleotides

such as ATP CTP UTP and GTP for mRNA synthesis were obtained from

Promega (Madison WI) The protein G-agarose and molecular weight marker

were from Sigma (St Louis MO) pQE30 pEU3-NII and pEGFP-N1 were

obtained from Qiagen (Valencia CA) TOYOBO (Osaka Japan) and Clontech

(Palo Alto CA) respectively The mouse anti-His G antibody was from

Invitrogen (Carlsbad CA) Preparation of the antibody against the COOH-

terminal 15 amino acids of rat PMP70 was described in [30] The anti-rat liver

catalase antibodies were raised in guinea pigs [31]

22 Plasmid constructions

The plasmid pcDNA3PEX19 which contains the human cDNA sequence

encoding Pex19p was described in [32] From this cDNA the full-length

Pex19p was excised with BamHI and HindIII and recloned into pQE30 vector

at the corresponding sites to obtain pQE30PEX19 Different cDNA fragments

of PMP70 were amplified using a full-length human PMP70 cDNA [33] as a

template The PCR-generated fragment with XhoI and PstI or NotI and BamHI

restriction sites was subcloned in frame into either pEU3-NII or pEGFP-NI

expression vector respectively The full-length cDNA of mouse ABC-me with

XhoI and NotI sites was generated by PCR using the ABC-me cDNA in pRc

CMV vector [34] as a template The obtained fragment with XhoI and NotI

sites was ligated with pEU3-NII vector The identity of all subclones was

confirmed by semiautomated sequencing on an ABI 310 DNA sequencer

(Perkin Elmer Life Science Wellesley MA) The oligonucleotide primers used

for construction of plasmids are listed in Table 1

GGCTGGCAACTAGAAGGC

AAGGCTCATAC ATGGCTGGCAACTAGAAGGC

ACAACAGAATAGC ATGGCTGGCAACTAGAAGGC

CTCAGGG ATGGCTGGCAACTAGAAGGC

GATATGTTAATTCTCGG ATGGCTGGCAACTAGAAGGC

ATAGTATTATTGCC ATGGCTGGCAACTAGAAGGC

ACATCTCAAGAAG ATGGCTGGCAACTAGAAGGC

ATTATATTATAAGCGGCCGCCTACTTGAGATGTCGAGGATGAGA

ATTATATTATAAGCGGCCGCCTAGGCAATAATACTATCAATGAAGCC

ATTATATTATAAGCGGCCGCCTACCGAGAATTAACATATCTATATTCTCC

ATTATATTATAAGCGGCCGCCTAGCCCTGAGCTCCAATTGC

ATTATATTATAAGCGGCCGCCTAAGCTATTCTGTTGTCCAGATTCCC

AAGGCTCATAC

TTAACATATCTATATTCTCC

CT ATATTATAAGCGGCCGCCTACGCCCGTGCAGGTTCCA

AATTTGGATCCGAGCCGAACTCAACTGTGT

AATTTGGATCCTTGAGATGTCGAGGATGAGAC

AGGCTCATAC AAATTTGGATCCGAGCCGAACTCAACTGTGT

ATTTAGGATCCCGAGAATTAACATATCTATATTCTCCTTC

AATTTGGATCCGCTATTCTGTTGTCCAGATTCC

TAAAGGATCCTTCAAGAAGTTATTAACCAGAGAG

AATTTGGATCCAAATCTTTCCTGCTACGACCAATG

rd primers NotI orBamHI for reverse primers) Reverse primer for N-terminal

as digested at NotI site originally existed in the vector sequence
























80 -C






















































29 Other methods






3 Results




























shown)



















mRNA


































insoluble fraction
















































-

-




































(lower panel)











without Pex19p

























cDNAs (Fig 7B)


























































and Pex19p





f

f









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342
























80 -C






















































29 Other methods






3 Results




























shown)



















mRNA


































insoluble fraction
















































-

-




































(lower panel)











without Pex19p

























cDNAs (Fig 7B)


























































and Pex19p





f

f









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342





















shown)



















mRNA


































insoluble fraction
















































-

-




































(lower panel)











without Pex19p

























cDNAs (Fig 7B)


























































and Pex19p





f

f









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342










insoluble fraction
















































-

-




































(lower panel)











without Pex19p

























cDNAs (Fig 7B)


























































and Pex19p





f

f









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342




































(lower panel)











without Pex19p

























cDNAs (Fig 7B)


























































and Pex19p





f

f









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342







































and Pex19p





f

f









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342









































































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342






































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342





































4 Discussion




























proteins [3738]

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342

















































interaction





























































































[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342



























[2644]










Acknowledgements








References





1994 pp 2287ndash2324



59 (2002) 1058ndash1069














1 (1985) 489ndash530



(1989) 1657ndash1664





(1991) 947ndash954




3255ndash3262









EMBO J 13 (1994) 4908ndash4918










(1999) 1579ndash1590




(2000) 223ndash233












(1999) 2116ndash2121




148 (2000) 931ndash944








4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342



4413ndash4424





Commun 271 (2000) 144ndash150




4534ndash4540




11968ndash11976






24122ndash24130













323ndash327




(2005) 1788ndash1799










Sci 25 (2000) 83ndash88



(1993) 1717ndash1725



95ndash98




38486ndash38494







277 (2002) 774ndash784




(2001) 649ndash655






J Biol Chem 276 (2001) 10897ndash10905
















J Biol Chem 276 (2001) 18649ndash18652




1180ndash1186



1141ndash1149




334ndash342

Documents

Role of Pex19p in the targeting of PMP70 to peroxisome