ORIGINAL PAPER

Screening promoters for Anthurium transformation usingtransient expression

Tracie K. Matsumoto • Lisa M. Keith •

Roxana Y. M. Cabos • Jon Y. Suzuki •

Dennis Gonsalves • Roger Thilmony

Received: 1 October 2012 / Revised: 7 November 2012 / Accepted: 12 December 2012 / Published online: 3 January 2013

� Springer-Verlag Berlin Heidelberg (outside the USA) 2012

Abstract

Key message There are multiple publications on

Anthurium transformation, yet a commercial product

has not been achieved. This may be due to use of non-

optimum promoters here we address this problem.

Abstract Different promoters and tissue types were

evaluated for transient b-glucuronidase (GUS) expression

in Anthurium andraeanum Hort. ‘Marian Seefurth’ fol-

lowing microprojectile bombardment. Plasmids containing

the Ubiquitin 2, Actin 1, Cytochrome C1 from rice, Ubiq-

uitin 1 from maize and 35S promoter from Cauliflower

Mosaic Virus fused to a GUS reporter gene were bom-

barded into in vitro grown anthurium lamina, somatic

embryos and roots. The number of GUS foci and the

intensity of GUS expression were evaluated for each con-

struct. Ubiquitin promoters from rice and maize resulted in

the highest number of expressing cells in all tissues

examined. Due to the slow growth of anthurium plants,

development of transgenic anthurium plants takes years.

This research has rapidly identified multiple promoters that

express in various anthurium tissues facilitating the

development of transformation vectors for the expression

of desirable traits in anthurium plants.

Keywords Anthurium � Monocot � Promoter �Transformation � GUS

Abbreviations

2,4-D 2,4-Dichlorophenoxyacetic acid

GUS b Glucuronidase

HDOA Hawaii Department of Agriculture

MS Murashige and Skoog

USDA United States Department of Agriculture

X-Gluc 5-Bromo-4 chloro-3 indolyl-b-D-glucoride,

cyclohexyl ammonium salt

Introduction

Anthurium andraeanum Hort, cultivars derived from

Anthurium andraeanum Linden ex. Andre and other spe-

cies comprise the majority of the cut-flower production in

the Netherlands and other tropical and subtropical regions

including Hawaii (Matsumoto and Kuehnle 1997). In 2008,

81.4 million stems of anthuriums were sold on the Dutch

auctions for 39.0 million € (*$57.3 million) conversion

based on 2008 average of $1.47 US/1 € (CBI Market

Survey 2009; Board of Governers of the Federal Reserve

System 2012). In Hawaii, anthuriums are the top cut-flower

with 6.3 million stems sold for $3.5 million in 2008

(HDOA Agricultural Development Division and USDA

National Agricultural Statistics Service 2011).

In subtropical and tropical regions, where anthuriums

are grown under natural or artificial shade, bacterial dis-

eases are often major hindrances in production. In Hawaii,

the bacterial blight caused by the pathogen Xanthomonas

axonopodis pv. dieffenbachiae caused severe damage to

anthurium industry reaching epidemic proportions in

1985–1989, destroying the production of approximately

Communicated by H. Jones.

T. K. Matsumoto (&) � L. M. Keith �R. Y. M. Cabos � J. Y. Suzuki � D. Gonsalves

USDA, ARS, Pacific Basin Agricultural Research Center,

64 Nowelo Street, Hilo 96720, HI, USA

e-mail: tracie.matsumoto@ars.usda.gov

R. Thilmony

USDA, ARS, Western Regional Research Center Crop

Improvement and Utilization Research Unit,

800 Buchanan Street, Albany 94710-1105, CA, USA

123

Plant Cell Rep (2013) 32:443–451

DOI 10.1007/s00299-012-1376-z

200 small farms (Nishijima 1994; Alvarez et al. 2006).

Hawaii’s production dropped from a record high of

approximately 30 million stems in 1980 to 15.6 million

stems in 1990 (Shehata 1992).

Burrowing nematode (Radopholus similis) is another

major pest of anthurium capable of significantly reducing

the plant growth and yield in commercial nurseries

(Aragaki et al. 1984). This nematode lives within plant

roots, feeding and reproducing as it moves through plant

tissues (Duncan and Moens 2006). Symptoms of burrowing

nematode infestation on anthurium include elongated dark-

brown lesions on the roots, which eventually lead to

blackening and destruction of the entire root system

(Aragaki et al. 1984). Above ground symptoms are stun-

ting, fewer and smaller leaves, yellowing, reduced yields,

and the production of smaller flowers. The recent reduction

in commercial nematicides available in the US market has

left the industry without an effective treatment to manage

plant-parasitic nematodes in anthurium fields.

Genetic transformation of Anthurium andraeanum Hort.

was first reported in 1996 (Chen and Kuehnle 1996) using

Agrobacterium-mediated gene transfer of an anti-bacterial

gene attacin under the control of a double 35S promoter

using etiolated internodes as explants. Transgenic anthur-

ium plants were also obtained using the same anti-bacterial

gene containing plasmid with anthurium roots as the

explant material (Chen et al. 1997). Transgenic anthurium

plants of ‘Paradise Pink’ and ‘Tropic Flame’ were obtained

by Agrobacterium-mediated transformation of etiolated

internodes explants (Kuehnle et al. 2001). These plants

expressed Shiva-1, a synthetic analog of the natural cecr-

opin B anti-bacterial peptide, fused to the PR1b secretion

signal under the control of the double 35S promoter

(Kuehnle et al. 2004). Differences in bacterial resistance in

the transgenic lines were hypothesized to be due to low

expression levels of Shiva-1 in susceptible lines and cul-

tivars. Recently, ‘Marian Seefurth’ and ‘Midori’ were

transformed with the anti-bacterial genes NPR1 from

Arabidopsis, attacin from Hyalophora cecropia and lyso-

zyme from T4 bacteriophage and for nematode resistance

genes, rice cystatin and cowpea trypsin inhibitor (Fitch

et al. 2011). The bacterial genes were under the control of

the 35S promoter and the nematode gene under the sug-

arcane polyubiquitin promoter ubi9, however, expression

levels were not reported for any of the transformed genes.

To expedite the production of useful transgenic plants

for commercial anthurium growers it is important to con-

sider the transformation of multiple traits into a single line,

because the development of a new cultivar by conventional

breeding may require 8–10 years (Matsumoto and Kuehnle

1997). Optimization of promoters is important in devel-

oping transformation systems, because repeated use of

the same promoter may result in homology-dependent

transcriptional gene silencing (Peremarti et al. 2010) and

the level of expression in the target tissues is important in

determining the desired phenotype. Due to the slow growth

of anthurium plants evaluation of transgenic lines takes

years. Analysis of the anthurium plants transformed with

Shiva-1 required 21 months for plant transformation and

initial molecular confirmation, another 2 years for clonal

micropropagation and an additional two more years to

transfer and grow plants to the greenhouse for disease and

additional molecular evaluation (Kuehnle et al. 2004). Here

we describe a transient GUS (b-glucuronidase) assay to

determine promoter expression and tissue specificity in

anthurium.

Materials and methods

Plant material

‘Marian Seefurth’ tissue cultured plants were obtained

from the Hawaii Anthurium Industry Association. Anthur-

ium plantlets were propagated using enhanced axillary

branching (Matsumoto and Kuehnle 1997). Cultures were

maintained at 22 �C with a photoperiod of 16-h light and

8-h dark under cool white fluorescent lights. Lamina and

root tissue for bombardment were harvested from anthur-

ium plantlets grown in � strength Murashige and Skoog

(MS) salts, MS vitamins modified to contain 0.4 mg/L of

thiamine, 2 % sucrose and 0.6 % agar (Murashige and

Skoog 1962). Somatic embryos were initiated on medium

B or G as described in Kuehnle et al.(1992). The media

were modified to contain � strength MS salts, MS vitamins

modified to contain 0.4 mg/L of thiamine, 2 % sucrose and

1 % glucose at pH 5.7 solidified with 0.9 g/L gellan gum.

Medium B consists of 2.0 mg/L 2,4-D and 0.33 mg/L

kinetin and medium G 4.0 mg/L 2,4-D and 0.5 mg/L

kinetin. Briefly, leaves were harvested from anthurium

plantlets grown in culture, petiole removed and lamina was

placed abaxial side lying on the surface of the medium.

Cultures were incubated in the dark and sub-cultured every

3–4 weeks.

Plasmid constructs

All vectors were constructed using standard restriction

enzyme cloning methods and introduced into bacteria using

a RbCl2 heat shock transformation method (Sambrook

2001). The pMaizeUbi-GUSPlus vector is a derivative of

the pUbi-BASK vector (courtesy of James Thomson). The

pUbi-BASK plasmid is a modified pAHC20 vector

(Christensen and Quail 1996), which had the EcoRI

restriction site within maize Ubiquitin 1 promoter 50 intron

removed using site directed mutagenesis. The bar gene was

444 Plant Cell Rep (2013) 32:443–451

123

excised from pAHC20 with BamHI and KpnI and two

annealed oligos containing BamHI/AscI/SpeI/KpnI

(BASK) restriction sites were inserted in its place between

the ubiquitin promoter and the nos terminator. The GUS-

Plus coding sequence was PCR amplified from pCAM-

BIA1305.1 (Broothaerts et al. 2005) using the following

GUSPlusF (50-CTCGAGGCGCGCCAACCATGGTAGAT

CTGAGGGTAAATTTCTAG-30) and GUSPlusR (50-TC

TAGACCTGCAGGTCACACGTGATGGTGATGGTGA

TC-30) primers and the high fidelity Phusion polymerase

(New England Biolabs, Ipswich, MA). The PCR product

was digested with AscI and XbaI (underlined in primers)

and ligated into the pUbi-BASK vector digested with AscI

and SpeI (compatible ends with XbaI). The resulting vector

was confirmed with sequencing.

The pRUBQ2-GUSPlus vector is a derivative of the

pRUBQ2-AKSP vector, which contains the Rice Ubiqutin

2 (RUBQ2) promoter and intron separated from the nos

terminator by ApaI, KpnI, SalI and PstI (AKSP) restriction

sites. This vector is also a derivative of pUbi-BASK. The

pMaize Ubi-BASK plasmid had the maize ubiquitin 1

promoter and intron excised with HindIII and KpnI, and

replaced with the RUBQ2 promoter and intron from the

pGPro3 binary vector (GenBank JN593323). A GUSPlus-

nosT fragment was excised from pCAMBIA1305.1 with

BamHI (blunted with Klenow polymerase) and MauBI and

inserted into pRUBQ2-AKSP plasmid cut with KpnI

(blunted with Klenow polymerase) and MauBI. The

resulting vector was confirmed with sequencing.

The pRUBQ2m-GUSPlus vector was constructed from

the pRUBQ2-Ubimonomer-BNXAP vector. This vector

contains the RUBQ2 promoter, 50 intron and an ubiquitin

monomer coding sequence followed by BamHI, NcoI,

XbaI, AscI and PstI restriction sites. The ubiquitin mono-

mer sequence including a 30 portion of the upstream intron

and the several restriction sites was synthesized by Gen-

Script (www.genscript.com/) and the *700 bp sequence

was inserted into the pRUBQ2-AKSP vector digested with

PacI and PstI. The resulting pRUBQ2-Ubimonomer-

BNXAP vector was confirmed with sequencing. A GUS-

Plus-nosT fragment (excised from pCAMBIA1305.1 with

NcoI and MauBI) was inserted into pRUBQ2-Ubimono-

mer-BNXAP vector plasmid also cut with NcoI and

MauBI. The pRUBQ2m-GUSPlus vector was confirmed

with restriction enzyme digestion and DNA sequencing.

The pUC-CaMV35S-GUSPlus vector was constructed

from the 35S expression cassette that was distributed as

part of the pGreen binary vector series (Hellens et al.

2000). The GUSPlus gene was excised from pCAM-

BIA1305.1 with NcoI and BstEII (both blunted with Kle-

now polymerase) and inserted into the SmaI site of pGreen

35S cassette (in between the 35S promoter and 35S ter-

minator). A selected clone was confirmed with restriction

enzyme digestion and sequencing. The construction of the

pAct1-D and the pSUNG-Cc1 vectors was previously

described (McElroy et al. 1990; Thomson et al. 2011).

All plasmid constructs were transformed into Esche-

richia coli XL-1 Blue (Agilent Technologies, Santa Clara,

CA). Selection of plasmids were performed on Luria Broth

or Agar plates supplemented with either 100 mg/L of

ampicillin or 25 mg/L kanamycin for each respective

plasmid. Plasmids were purified by Plasmid Midi Kit

(Qiagen Inc, Valencia, CA) and normalized to 1 mg/mL

using a BioSpec Mini spectrophotometer (Shimadzu,

Columbia, MD).

Particle bombardment

All microprojectile bombardment experiments were per-

formed using the PDS-1000/He system (Bio-Rad, Hercu-

les, CA). Plasmid DNA (5 lg) was precipitated into 1 lm

gold particles (Bio-Rad, Hercules, CA) using calcium

chloride and spermidine (Kikkert 1993). Anthurium tissues

were harvested and placed in a *3 cm circle in the middle

of a petri dish containing fresh medium. Rupture disk

pressures of 650 and 1,100 psi (pounds per square inch)

were used for each bombardment. Chamber vacuum was

held at 28 psi for all bombardment experiments. At a dis-

tance of *1 cm (top slot) between the rupture disk and the

microcarrier launch assembly, plates containing the bom-

barded plant tissue were placed *8 cm from macrocarrier

(third slot from top). A minimum of two plates were used

for each plasmid and tissue combination and uncoated gold

particles were used as the negative control for each

experiment. The entire experiment including gold particles

only and each plasmid and tissue combination was repeated

on a minimum of three different dates. Tissues were kept in

the dark and assayed for b-glucuronidase (GUS) activity

5–7 days after bombardment.

b-Glucuronidase assay and analysis

b-Glucuronidase activity was determined using a modified

histochemical method developed by Jefferson 1987.

Briefly, 5.3 mg of X-Gluc (5-bromo-4 chloro-3 indolyl-b-

D-glucoronide, cyclohexyl ammonium salt) was dissolved

in dimethyl formamide and the volume was brought up to

10 mL with 0.1 M sodium phosphate buffer at pH 7.5 with

0.1 % Triton X-100. Tissues were incubated in the solution

at 37 �C overnight and chlorophyll removed with several

washes of 70 and 95 % ethanol. Tissue was examined

using a dissecting microscope and the number of blue spots

for each bombardment event was recorded. Photographs

were used to document the intensity of the blue staining.

The data were analyzed by one-way or two-way ANOVA

with mean separation by Tukey’s multiple range test at

Plant Cell Rep (2013) 32:443–451 445

123

P \ 0.05 using SigmaStat (Systat Software, Point Rich-

mond, CA).

Results

The functions of the maize Ubiquitin 1 promoter (Christen-

sen and Quail 1996), the rice Ubiquitin 2, RUBQ2 (Wang

and Oard, 2003) promoter (used both as a transcriptional

fusion and a ubiquitin monomer translational fusion to the

GUSPlus reporter gene), the rice Actin 1 promoter (McElroy

et al. 1990), the rice Cytochrome C1 promoter (Jang et al.

2002) and the CaMV35S promoter were tested for their

ability to drive reporter gene expression in bombarded

anthurium tissues. Diagrams of the six reporter gene cassettes

used for biolistic transient expression assays are shown in

Fig 1. The average number and the range in the number of

observed b-glucuronidase positive spots per bombardment

are summarized in Table 1. Although the amount of blue

cells varied between bombardments and between replicate

experiments, the relative number of spots observed for each

promoter construct compared to the other promoter con-

structs remained relatively constant. The observed variation

may be due to physiological variation in explant material

used or in the variability in the number of viable cells that

receive the introduced plasmids in each bombardment. The

length of incubation prior to GUS staining was investigated,

since many other tissues can be stained 1–2 days after

bombardment. We compared tissues stained after 3 days to

those stained after 5–7 days and observed that all the con-

structs exhibited higher levels of GUS expression at

5–7 days compared to the samples stained after 3 days. Thus,

we chose to use the later time point for all subsequent

experiments to maximize the level of expression that was

detected. This was particularly important for the Actin 1,

Cytochrome C1 and CaMV35S promoters, which exhibited

relatively low levels of expression.

In all the tissues tested, the highest number of b-glu-

curonidase positive spots was observed for the maize and

rice ubiquitin promoters. Although high expression was

observed in somatic embryos at 1,100 psi acceleration

pressure, which is recommended for plant tissues (Kikkert

1993), there was no statistically detectable difference in

acceleration pressure. Other acceleration pressures may be

useful in future experiments conducted on roots; however,

due to the lack of available plant material root bombard-

ments experiments were only conducted using 1,100 psi

acceleration pressure. Somatic embryos bombarded with

the pRUBQ2m-GUSPlus (P = 0.046) and in the pMaize-

Ubi-GUSPlus (P = 0.041) constructs exhibited the highest

number (300?) of GUS positive expressing cells and had

averages as high as 174–206 GUS positive spots (Table 1).

For lamina tissue, there was no significant difference in

acceleration pressure for the number of GUS foci. ANOVA

analysis of the combined number of GUS foci from 650 to

1,100 psi acceleration pressure for each plasmid suggests

that pRUBQ2-GUSPlus bombarded lamina samples

exhibited the highest number of GUS foci (P = 0.031).

(Table 1). Overall the anthurium roots showed the lowest

amount of X-gluc positive staining with no statistically

significant difference in the number of GUS foci regardless

of the promoter construct used. This may be due to the low

surface area of the roots and the relative difficulty in

obtaining large amount of tissue. Interestingly, the rice Cc1

promoter construct did not produce any b-glucuronidase

positive cells. Tissues bombarded with the CaMV35S

promoter had a modest level of GUS positive cells similar

to those generated by the Actin 1 promoter construct, while

Fig. 1 Promoter-reporter expression cassette maps. Diagrams of the

six promoter expression cassettes tested in Anthurium are shown.

Promoters are represented as green boxes with their 50 introns (if

present) as yellow boxes. The GUSPlus and GUS reporter genes are

blue arrows and 30 polyadenylation sites/terminators (nosT and 35St)

are shown as red boxes. The GUSPlus reporter gene contains the

castor-bean catalase intron shown as small yellow boxes near the 50

end. The pRUBQ2 m-GUSPlus cassette contains an ubiquitin mono-

mer (blue Ubi arrow) translationally fused to the GUSPlus coding

sequence (color figure online)

446 Plant Cell Rep (2013) 32:443–451

123

the ubiquitin promoters exhibited five or more fold higher

averages in observable GUS foci.

Photographs documenting the intensity of the histo-

chemical b-glucuronidase activity staining are shown in

Figs. 2, 3 and 4. In lamina tissue the intensity and number

of observed expressing cells was the greatest for the

ubiquitin promoters. In somatic embryo tissue (Fig 3), the

staining intensity was the greatest in the pMaize

Ubi-GUSPlus, followed by the pRUBQ2 m-GUSPlus

bombarded tissue consistent with the quantified average

number of expressing cells shown in Table 1. Overall, the

intensity and number of GUS positive staining cells for

the Cytochrome C1 construct was quite low. In roots, the

highest levels of staining were observed for the rice and

maize ubiquitin promoters, while very low expression was

detected from the CaMV35S and rice Actin 1 promoter

constructs, no expression was detected from the rice Cc1

promoter construct.

Table 1 Summary of transient expression of b-glucuronidase activity in Anthurium tissues

Tissue Promoter Plasmid Rupture disc

pressure (psi)

Average number

of spots

Range of

observed spots

Lamina None Gold only 650 0 0

1,100 0 0

CaMV35S pUC-CaMV35S-GUSPlus 650 29.3 1–80

1,100 28 2–78

Rice Actin 1 pAct1-D 650 23.7 0–63

1,100 8.0 3–15

Rice Cytochrome C 1 pSUNG-Cc1 650 17.0 0–51

1,100 2.3 0–5

Maize Ubiquitin 1 pMaizeUbi-GUSPlus 650 89.7 66–112

1,100 122.3 21–207

Rice Ubiqutin 2 pRUBQ2-GUSPlus* 650 116.7 8–313

1,100 140.7 38–298

Rice Ubiqutin 2 ? monomer pRUBQ2m-GUSPlus 650 109.7 10–239

1,100 117.3 51–249

Somatic Embryo None Gold only 650 0 0

1,100 0 0

CaMV35S pUC-CaMV35S-GUSPlus 650 32 5–65

1,100 32.3 4–63

Rice Actin 1 pAct1-D 650 10.0 0–30

1,100 6.0 1–18

Rice Cytochrome C 1 pSUNG-Cc1 650 2.3 2–3

1,100 3.0 0–7

Maize Ubiquitin 1 pMaizeUbi-GUSPlus* 650 135.3 11–319

1,100 206.0 116–347

Rice Ubiqutin 2 pRUBQ2-GUSPlus 650 92.7 21–152

1,100 154.3 40–212

Rice Ubiqutin 2 ? monomer pRUBQ2m-GUSPlus* 650 162.0 13–346

1,100 173.7 50–366

Root None Gold only 1,100 0 0

CaMV35S pUC-CaMV35S-GUSPlus 1,100 2.0 0–4

Rice Actin 1 pAct1-D 1,100 1.0 0–2

Rice Cytochrome C 1 pSUNG-Cc1 1,100 0 0

Maize Ubiquitin 1 pMaizeUbi-GUSPlus 1,100 20.5 11–30

Rice Ubiqutin 2 pRUBQ2-GUSPlus 1,100 10.0 5–15

Rice Ubiqutin 2 ? monomer pRUBQ2m-GUSPlus 1,100 11.5 2–21

The average number and range of GUS foci in anthurium lamina, somatic embryos and roots for each plasmid construct at two rupture disc

pressures of 650 and 1,100 psi

*The mean number of GUS foci was significantly different as determined by Tukey’s multiple range test at P \ 0.05

Plant Cell Rep (2013) 32:443–451 447

123

Discussion

Here, we utilized a transient expression assay to examine

the functionality of several promoters in anthurium tissues.

Although these results are useful indicators of promoter

function, caution should be taken in the interpretation of

promoter analysis using transient expression assays. Many

factors influence the transient expression observed includ-

ing the number of viable cells that have successfully

received the transgene, as well as the functionality of each

expression construct. Expression variability is also

observed in stably transformed plants as well, requiring the

analysis of multiple independently-derived transformants

for quantitative and qualitative analyses. Differences in the

observed transgen expression within transgenic plants has

been correlated with the number of transgene copies

incorporated into the genome, the transgene insertion site,

DNA modification of the incorporated sequenes (i.e. DNA

methylation) or transcriptional and posttranscriptional

processes like RNA silencing or interference with other

genetic sequences within the construct (Butaye et al. 2005;

Singer et al. 2012). Although stable transformation would

provide a more detailed evaluation of promoter function,

the slow growth and development of anthurium plants

makes this type of approach a challenge. From the data

presented here, we are able to better predict which

promoters are likely to be useful for expression of desired

traits in various anthurium tissues.

In previous research, it has been determined that the

level of the anti-bacterial peptide expression Shiva-1 is

important for gene function (Kuehnle et al. 2004). Since, a

potential site for natural inoculation of the Xanthomonas

axonopodis pv. dieffenbachiae is in the leaves of anthur-

ium, use of the maize or rice ubiquitin promoters may be

useful for expression of anti-bacterial genes. In potato,

greater anti-bacterial resistance to soft rot disease was

observed in potato plants transformed with Shiva-1 under

the control of the PAL5, phenylalanine ammonia-lyase

promoter compared to those transformed with CaMV35S

promoter (Yi et al. 2004). Nematode resistance in anthur-

ium plants may be achieved through targeted transgene

expression. Transgenic banana and plantain, which are also

tropical monocots, have been transformed with rice cyst-

atin or maize cystatin under the control of the maize

ubiquitin 1 promoter for resistance to plant-parasitic nem-

atodes Radopholus similis or Helicotylenchus multicinctus

(Atkinson et al. 2004; Roderick et al. 2012).

The highest number of b-glucuronidase positive spots

was observed for the maize and rice ubiquitin promoters.

The addition of the ubiquitin monomer enhanced the

expression of the GUS gene as evident by the presence of

numerous darker GUS stained cells. In addition to the

Fig. 2 Histochemical staining

of anthurium lamina.

Representative photographs of

lamina tissue expressing GUS

following bombardment with

A CaMV35S-GUSPlus,

B pACT1-D, C pSUNG-Cc1,

D pMaizeUbi-GUSPlus,

E pRUBQ2-GUSPlus, and

F pRUBQ2m-GUSPlus

448 Plant Cell Rep (2013) 32:443–451

123

strong transcriptional activity by the ubiquitin promoter,

the ubiquitin monomer has the potential to provide a

posttranscriptional enhancement, augmenting the accumu-

lation of the desired protein (Hondred et al. 1999).

Enhanced expression and protein accumulation may further

improve the accumulation of antimicrobial peptides in

anthurium.

High expression of selectable markers in somatic

embryos may be useful for improved selection strategies;

however, it may also be useful to consider the use of the

CaMV35S or Actin 1 promoters for moderate expression of

selectable markers to prevent the occurrence of chimeric

transgenic plants. Very high expression levels may lead to

the inactivation of selectable agents protecting neighboring

untransformed cells which would then result in the survival

of chimeric or non-transformed material. It is clear that the

pSUNG-Cc1 plasmid carrying the rice Cytochrome C1

constitutive promoter conferred weak or undetectable

expression in anthurium lamina, somatic embryo and root

tissues. Although this promoter conferred relatively strong

constitutive expression in transgenic rice (Jang et al. 2002),

it does not appear to function very well in anthurium. The

failure of the rice Cc1 construct to confer substantial

expression in anthurium may be due to several potential

causes. The promoter may simply lack the needed cis

elements necessary to drive efficient transcription in

anthurium cells. Alternatively, the observed weak expres-

sion could be partly due to the use of a relatively large

binary vector plasmid for the bombardments (compared to

the other constructs). This large construct may not be an

efficient substrate for biolistic delivery and transient

expression compared to the other plasmid constructs.

A third possibility distinguishing the Cc1 promoter from

the other tested monocot promoters is that it lacks a 50

intron. In a number of instances, the presence of a 50 intron

has been shown to significantly enhance transgene

expression (Rose 2008; Rose et al. 2011). Intron mediated

enhancement of expression also may be important in

Anthurium and may contribute to the higher levels of

expression observed for the other promoter-reporter gene

Fig. 3 Histochemical staining of anthurium somatic embryos.

Representative photographs of callus tissue expressing GUS follow-

ing bombardment with A CaMV35S-GUSPlus, B pACT1-D,

C pSUNG-Cc1, D pMaizeUbi-GUSPlus, E pRUBQ2-GUSPlus, and

F pRUBQ2m-GUSPlus

Plant Cell Rep (2013) 32:443–451 449

123

constructs. It will be interesting in the future to determine

how these promoters perform in stably transformed

Anthurium andraeanum transgenic plants.

Acknowledgments The authors thank Donna Ota for her excellent

technical assistance.

References

Alvarez AM, Toves PJ, Vowell TS (2006) Bacterial blight of

Anthuriums: Hawaii’s experience with a global disease. APSnet

feature. http://www.apsnet.org/online/feature/anthurium/

Aragaki M, Apt WJ, Kunimoto RK, Ko WH, Uchida JY (1984)

Nature and control of Anthurium decline. Plant Dis 68:509–511

Atkinson HJ, Grimwood S, Johnston K, Green J (2004) Prototype

demonstration of transgenic resistance to the nematode Radoph-

olus similis conferred on banana by cystatin. Transgenic Res

13:135–142

Board of Governers of the Federal Reserve System (2012) Foreign

exchange rates—H.10 country data. http: http://www.federal

reserve.gov/releases/H10/hist/dat00_eu.htm. Accessed 05 Nov

2012

Broothaerts W, Mitchell HJ, Weir B, Kaines S, Smith LM, Yang W,

Mayer JE, Roa-Rodriguez C, Jefferson RA (2005) Gene transfer

to plants by diverse species of bacteria. Nature 433:629–633.

doi:10.1038/nature03309

Butaye KMJ, Cammue BPA, Delaure SL, De Bolle MFC (2005)

Approaches to minimize variation of transgene expression in

plants. Mol Breed 17:79–91

CBI Marketing Survey (2009) The EU market for tropical flowers.

http://www.cbi.eu/marketinfo/cbi/docs/cut_flowers_and_foliage_

the_eu_market_for_tropical_flowers. Accessed 21 Sept 2012

Chen FC, Kuehnle AR (1996) Obtaining transgenic Anthuriumthrough Agrobacterium-mediated transformation of etiolated

internodes. J Am Soc Hort Sci 121:47–51

Chen FC, Kuehnle AR, Sugii N (1997) Anthurium root for micro-

propagation and Agrobacterium tumefaciens-mediated gene

transfer. Plant Cell Tiss Org Cul 49:71–74

Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors

for high-level expression of selectable and/or screenable marker

genes in monocotyledonous plants. Transgenic Res 5:213–218.

doi:10.1007/bf01969712

Duncan LW, Moens M (2006) Migratory endoparasitic nematodes.

In: Perry RN, Moens M (eds) Plant nematology. CABI,

Oxfordshire, pp 123–152

Fitch MMM, Leong TCW, He X, McCafferty HRK, Zhu YJ, Moore

PH, Gonsalves D, Aldwinkle HS, Atkinson HJ (2011) Improved

Anthurium transformation. HortSci 46:358–364

HDOA Agricultural Development Division and USDA National

Agricultural Statistics Service (2011) Statistics of Hawaii

agriculture 2009. http://www.nass.usda.gov/Statistics_by_State/

Hawaii/index.asp. Accessed 26 Jan 2012

Hellens RP, Anne Edwards E, Leyland NR, Bean S, Mullineaux PM

(2000) pGreen: a versatile and flexible binary Ti vector for

Agrobacterium-mediated plant transformation. Plant Mol Biol

42:819–832

Hondred D, Walker JM, Mathews DE, Vierstra RD (1999) Use of

ubiquitin fusions to augment protein expression in transgenic

plants. Plant Physiol 119:713–723

Jang IC, Cho WB, Lee KH, Song SI, Nahm BH, Kim JK (2002) High-

level and ubiquitious expression of the rice cytochrome c gene

Fig. 4 Histochemical staining of anthurium roots. Representative photographs of root tissue expressing GUS following bombardment with

A CaMV35S-GUSPlus, B pACT1-D, C pMaizeUbi-GUSPlus, D pRUBQ2-GUSPlus, and E pRUBQ2m-GUSPlus

450 Plant Cell Rep (2013) 32:443–451

123

OsCc1 and its promoter activity in transgenic plants provides

a useful promoter for transgenesis of monocots. Plant Phys

129:1473–1481

Jefferson RA (1987) Assaying chimeric genes in plants: the GUS

gene fusion system. Plant Mol Biol Rep 5:387–405

Kikkert JR (1993) The biolistic PDS-1000/He device. Plant Cell Tiss

Org Cul 33:221–226

Kuehnle AR, Chen FC, Sugii N (1992) Somatic embryogenesis and

plant regeneration in Anthurium andreanum hybrids. Plant Cell

Rep 11:438–442

Kuehnle AR, Chen FC, Sugii N (2001) Transgenic Anthurium. In:

Bajaj YPS (ed) Biotechnology in agriculture and forestry, vol

48., Transgenic crops IIISpringer, Berlin, pp 3–15

Kuehnle AR, Fujii T, Chen FC, Alvarez A, Sugii N, Fukui R, Aragon

SL, Jaynes JM (2004) Peptide biocides for engineering bacterial

blight tolerance and susceptibility in cut-flower Anthurium.

HortSci 39:1327–1331

Matsumoto TK, Kuehnle AR (1997) Micropropagation of Anthurium.

In: Bajaj YPS (ed) Biotechnology in agriculture and forestry, vol

40., High-tech and micropropagation VISpringer, Berlin, pp 14–29

McElroy D, Zhang W, Cao J, Wu R (1990) Isolation of an efficient

actin promoter for use in rice transformation. Plant Cell

2:163–171. doi:10.1105/tpc.2.2.163

Murashige T, Skoog F (1962) A revised medium for rapid growth and

bioassay with tobacco tissue cultures. Physiol Plant 15:473–497

Nishijima WT (1994) Diseases. In: Higaki T, Lichty JS, Moniz D

(eds) Anthurium culture in Hawaii. HITHAR research extension

series 152. College of Tropical Agriculture and Human

Resources, University of Hawaii, Honolulu, pp 13–18

Peremarti A, Twyman RM, Gomez-Galera S, Naqvi S, Farre G,

Sabalza M, Miralpeix B, Dashevskaya S, Yuan D, Ramessar K,

Christou P, Zhu C, Bassie L, Capell T (2010) Promoter diversity

in multigene transformation. Plant Mol Biol 73:363–378

Roderick H, Tripathi L, Babirye A, Wang D, Tripathi J, Urwin PE,

Atkinson HJ (2012) Generation of transgenic plantain (Musa

spp.) with resistance to plant pathogenic nematodes. Mol Plant

Pathol 13:842–851

Rose AB (2008) Intron-mediated regulation of gene expression. In:

Nuclear pre-mRNA processing in plants, vol 326. Current topics

in microbiology and immunology. Springer, New York

Rose AB, Emami S, Bradnam K, Korf I (2011) Evidence for a DNA-

based mechanism of intron-mediated enhancement. Front Plant

Sci 2:98

Sambrook J (2001) Molecular cloning: a laboratory manual. Volume

accessed from http://nla.gov.au/nla.cat-vn2284148. Cold Spring

Harbor Laboratory, Cold Spring Harbor, NY

Shehata S (1992) Supply-demand and market analysis of the cut-

flower industry: a focus on the Hawaiian anthurium industry. In:

Delate KM and Tome CHM (eds) Proceedings of Anthurium

blight conference of 5th Hawaii Institute of Tropical Agricultural

Human Research, University of Hawaii, Honolulu, pp 35–38

Singer SD, Liu Z, Cox KD (2012) Minimizing the unpredictability of

transgene expression in plants: the role of genetic insulator. Plant

Cell Rep 31:13–25

Thomson JG, Cook M, Guttman M, Smith J, Thilmony R (2011)

Novel sul1 binary vectors enable an inexpensive foliar selection

method in Arabidopsis. BMC Res Notes 4:44. doi:10.1186/

1756-0500-4-44

Wang J, Oard JH (2003) Rice ubiquitin promoters: deletion analysis

and potential usefulness in plant transformation systems. Plant

Cell Rep 23:129–134

Yi JY, Seo HW, Yang MS, Robb JE, Nazar RN, Lee SW (2004)

Plant defense gene promoter enhances the reliability of shiva-1gene-induced resistance to soft rot disease in potato. Planta

220:165–171

Plant Cell Rep (2013) 32:443–451 451

123