Abstract - Marine Biological Laboratory...Archaea exhibit diverse metabolism including chemoorganotrophy and chemolithotrophy employing both aerobic and anaerobic processes. In oxygenated

An attempt to enrich for mesophilic archaea and associated viruses

Andrian P. Gajigan MBL Microbial Diversity, August 2018

Department of Oceanography, University of Hawaii at Manoa

Abstract Our fundamental understanding of biology relies on model systems. Model systems enable us to know in mechanistic details the molecular underpinning of biological processes. Most of the model archaea have been isolated from extreme environments such as volcanic systems as well as highly saline, acidic and alkaline habitats. It is just in recent history that we begin to uncover archaea in the mesophilic environment like the ocean, which are pivotal to global biogeochemical cycles. This study attempted to obtain an enrichment of mesophilic archaea involved in various nitrogen metabolisms specifically ammonia oxidization (AO), anaerobic ammonia oxidization (anammox) and chemoorganotrophic denitrification (CD). Open ocean samples from Buzzard’s Bay shows no growth even after 6 weeks in AO media. Growth was observed in ammonia oxidation, anammox and chemoorganotrophic denitrifying media all from Sippewissett sediment. Amplification of 16S rRNA and amoA genes confirm the presence of bacteria but not archaea. Since this study was not able to produce a culture amenable to virus infection studies, environmental survey was done. Samples from the Salt Pond, MA was subjected to transmission electron microscopy showing presence of tailed and non-tailed icosahedral viruses. For future work, it is suggested to explore new ways to selectively enrich for archaea, probably successive waves of various antibiotics and dilution to extinction techniques. Introduction Archaea is the least studied of the three domains of life. Although metagenomic surveys greatly advanced our knowledge of the immense diversity of archaea in various environments, the lack of cultured representatives impedes our understanding of its biology. By having a pure culture or an enrichment, we can begin to interrogate the ecology, physiology, genetics and biochemistry of this enigmatic domain of life. For instance, Thaumarchaeota, was first discovered based on its 16S and the subsequent cultivation and sequencing of a representative species, Nitrosopumilus maritimus resulted to the proposal of an entirely new phyla which comprises a large proportion of ocean microbial community (Könneke et al. 2005; Walker et al. 2010; Brochier-Armanet et al. 2008). Archaea exhibit diverse metabolism including chemoorganotrophy and chemolithotrophy employing both aerobic and anaerobic processes. In oxygenated waters and sediments, major groups of archaea belongs to Thaumarchaeota (Marine Group I) and Euryarchaeota (Marine Group II-IV) while for subsurface and anoxic sediments, ANME (anaerobic methanotrophic archaea), DSAG (deep-sea archaeal group), and MCG (miscellaneous crenarchaeota group; a.k.a. Bathyarchaeota) comprises a significant fraction of microbial community (Danovaro et al. 2017). Archaea are understudied and so as archaeal viruses. In a recent survey, only 2% of the known viruses are archaeal viruses while 58% and 40% have eukaryotic and bacterial hosts, respectively (Mahmoudabadi and Phillips 2018). By employing various culture strategies, this study attempted to enrich mesophilic archaea. Also, here at MBL Microbial Diversity Course, there have been efforts to study archaea (summarize below).

Studies on archaea at MBL Microbial Diversity Course

• Eric Frings (1993) attempted to cultivate members of Heliobacteriacea but was unsuccessful

• David Arahal (1995) sequenced 16S rRNA from halophiles strain collection and environmental samples

• Scott Dawson (1997) observed archaeal growth in enrichment thru FISH (anaerobic, H2/CO2 gas, elemental sulfur/nitrate as electron acceptor with orgC), inoculum: Sippewissett sediment.

• Elke Jaspers (1997) growth of potentially halophilic archaea but not confirmed thru molecular biology methods

• Spencer Nyholm (1999) sequenced clones, identified as Crenarchaeota and Euryarchaeota from animal tissue (mussel, tunicate, squid)

• Jakob Zopfi (1999), found no Korarchaeal PCR products from Sippewissett and hydrothermal vent site at Guaymas Basin.

• Lois Maignien (2005) attempted to cultivate mesophilic archaea (CO2, H2, antibiotic cocktail, various electron acceptor – sulfate, nitrate, elemental sulfur, ferric ions). Some moderate growth but was not able to confirm if it’s archaea

• Ambert Hartman (2005) No nanoarchaea species were found, although sequences clustered into a small, uncultured euryarchaea clade.

• K Kritee (2007) was able to enrich for Marine Benthic group D within Euryarcheota from algae inoculum

• Sarah Hurley (2011) found dominance of amoA archaeal gene at oxic surface water salt pond, but low abundance of archaea throughout the water column

• Around 15 studies on methanogens Materials and methods Sampling site Different aquatic environments ranging from brackish water (Salt Pond, MA; Latitude: 41° 32' 44.088" N Longitude: 70° 37' 38.16" W), coastal marine (Sippewissett Marsh; Latitude: 41° 34' 32.28" N Longitude: 70° 38' 22.38" W) and open ocean (Buzzard’s Bay; Latitude: 41° 31' 50" N Longitude: 70° 44' 2" W) were sampled covering a wide range of salinity and nutrient levels. Enrichment of mesophilic archaea Various media and culturing strategies were employed to enrich for ammonia oxidizing archaea (Appendix 1 and 2), chemoorganotrophic denitrifying archaea (Appendix 1 and 3) and anaerobic ammonia oxidation archaea (Appendix 1 and 4). In most cases, a mix of antibiotic, in this case, Kanamycin/Streptomycin were added to selectively enrich for archaea. Both Kanamycin and Streptomycin binds to bacterial 30S inhibiting protein synthesis. The ammonia oxidizing enrichment done in class were monitored up to 5 weeks (Appendix 1 and 5). For anaerobic enrichments, a negative control containing only the media was prepared. monoFISH To monitor the growth of archaea, monoFISH was employed. Briefly, paraformaldehyde (PFA) was added to 10ml of enrichment for a final concentration of 2% PFA. The fixed samples were incubated for 1hour at room temperature, centrifuge for 10 minutes at 5100rpm. The supernatant was then removed and washed with 1X PBS. Again, the cells was centrifuged, and resuspended in 1ml 1X PBS. 20ul of the fixed cell suspension was spotted in the wells of gelatin-coated slide. The slide was air dried at 35oC, washed successively in 50%, 80% and 100% ethanol for 3 minutes each. The hybridization mix were prepared containing 1 volume of

the probe and 9 volumes of hybridization buffer. 2ml of hybridization buffer, containing NaCl (final conc: 900mM), Tris-HCl (final conc: 20mM), formamide (final conc.: 35%), sodium dodecyl sulfate (final conc.: 0.01%) was prepared. Additionally, 50ml of washing buffer, containing NaCl (final conc: 0.08M), Tris-HCl (final conc: 20mM), EDTA (final conc.: 5mM) and sodium dodecyl sulfate (final conc.:0.01%) was prepared. Archaeal probe (ARCH915-Cy3 at 35% formamide; GTG CTC CCC CGC CAA TTC CT) and bacterial probe (EUB338I-III-6FAM at 35% formamide; GCW GCC WCC CGT AGG WGT) were used. 10ul of hybridization mix was added in each well and the slide was placed in hybridization vial and incubated at 46oC for 1.5 hours. Then, the slide was transferred in the washing buffer preheated at 48oC for 15min. The slide was rinsed with milliQ water and air dried at 35oC. For DAPI staining, 10ul of 1X DAPI with Vectashield in each well, incubated for 3 minutes, rinsed with milliQ water and air dried. Then 10ul of Citifluor was added to each well. DNA Extraction for enrichments and virus metagenomics To determine the presence of archaea or bacteria in the enrichment, DNA was extracted using the MoBio PowerFecal DNA Isolation kit following manufacturer’s protocol. 5-10ml of liquid enrichment were filtered in 0.2um polycarbonate filter and subjected to DNA extraction. In addition, virus was concentrated from 3ml of water sample using Amicon Ultra Centrifugal filters. Samples obtained from Salt Pond, MA specifically from the (1) surface, (2) bottom and (3) outflow water were used. Then, DNA was extracted using Macherey-Nagel NucleoMag Virus kit following manufacturer’s protocol. The gDNA was sent for metagenomics sequencing for future analysis. PCR of amoA and 16S rRNA gene 1.16S rRNA. The primer pairs 8F (AGAGTTTGATCCTGGCTCAG) and 1391R (GACGGGCGGTGWGTRCA) were used for bacteria while 4FA (TCCGGTTGATCCTGCCRG) and 1100RA (AGGGTTGCGCTCGTTG) primer pair were used for archaea. For both, 25ul of Promega GoTaq DNA polymerase were added to 1ul of forward and reverse primers, 22ul of PCR water and 1ul DNA template. PCR cycles consisted of 95°C for 2 min followed by 29 cycles of 95°C for 30s, 55°C for 30s, and 72oC for 1.5mins and finally 1X of 72oC for 10mins. 2.amoA gene. Three sets of primers, two for archaeal amoA (ammonia monooxygenase structural gene) and one for bacterial amoA gene were used. For bacterial amoA, previously published primers and PCR cycle protocol were followed (Rotthauwe, Witzel, and Liesack 1997). For archaeal amoA, previously published primers and PCR cycle protocol were followed as well (Francis et al. 2005). In addition, primers as indicated in the Microbial Diversity manual 2018 (Forward: ATG GTY TGG BYW AGR MG and Reverse: GAC CAR GCG GCC ATC CA) were used. PCR cycles consisted of 95°C for 5 min followed by 28 cycles of 95°C for 1min, 48°C for 1min, and 72oC for 1.5mins and finally 1X of 72oC for 10mins. Transmission Electron Microscopy (TEM) To examine the morphology of virus concentrate from Salt Pond, TEM was done. Briefly, the grid was prepared by subjecting it to glow discharge making it hydrophilic. A drop of sample was placed in the grid and incubated for 3 minutes. The grid was blotted to edge of filter paper to dry then washed thrice in MilliQ water. The grid was placed in a drop of filtered 2% uranyl acetate and incubated for 1 minute. The grid was hen blotted in a filter paper and washed thrice in MilliQ water.

Results and Discussion Bacteria were enriched instead of archaea in ammonia-oxidizing enrichments The ammonia oxidizing media with inoculum from Buzzard’s Bay did not show evidence of growth even after 6 weeks. It is expected for open ocean oligotrophic microbes to grow very slowly. In fact, oligotrophic heterotrophic marine microbes has a growth rate of 0.1 per day (Kirchman 2016). In one study, the authors suggested to aged open ocean seawater for 6 months or more for initial enrichment (Santoro and Casciotti 2011). AOA can survive oligotrophic condition because of its high affinity to reduced nitrogen which determines its niche separation from bacteria (Martens-Habbena et al. 2009). On the other hand, we observed growth from enrichments with inoculum from Sippewissett Marsh and Salt Pond, MA. Turbidity of the media was observed at day 3, as well as nitrite production in one of the set-up (Table 1). Wet mounts show cell morphology consisting of spiral, rod and round shaped cells (Figure 1). monoFISH reveals the same cell morphologies as well as an interesting segmented spiral shaped microbe (Figure 2). Autofluorescence overwhelm the signal of archaea making it difficult to distinguish archaeal cells from other cells. To confirm the presence of archaea or bacteria, amplification of 16S rRNA and amoA gene was done (Appendix 6). Using the methanogen enrichment from class (Britnni Bertolet, 2018) as positive control for archaea, no bands were observed in all the AO enrichments suggesting either absence of archaea or very low abundance to result to amplification. Similarly, no archaeal amoA gene was amplified for all enrichment. However, in this case, we don’t have any positive control. On the other hand, bacterial amoA was amplified albeit with a lot of unspecific binding resulting to multiple PCR products. Taken altogether, this suggests that we were able to enrich for Ammonia Oxidizing Bacteria (AOB) which most likely belong to the Genus Nitrosomonas, Nitrosococcus, Nitrospira. Similar enrichment were also able to co-culture of sulfur-oxidizing bacteria or Nitrospina-like bacteria (Park et al. 2010). Table 1. Evidence of growth in ammonia oxidizing (AO) enrichments

Metabolism Sample Turbidity Wet mount (cells)

Nitrite prod.

mono FISH

DNA 16S rRNA Arch.

16S rRNA Bact.

amoA Arch.

amoA Bact.

1 AO* Open ocean

X X X nd ✓ X ✓ ? ✓

2 AO (without antibiotic)

Coastal sediment

✓ ✓ ✓ ? ✓ X ✓ ? ✓

3 AO (with antibiotic)

Coastal sediment

✓ ✓ X ? ✓ X ✓ ? ✓

4 AO Brackish water

✓ ? X nd ✓ X ? ? ?

Legend: X - not observed, ✓ - observed, ? - inconclusive, nd - no data, *with and without antibiotic

Figure 1. monoFISH result for AO enrichment without antibiotic with bacterial probe,

without archaeal probe. Bottom right panel shows cell autofluorescence in the archaeal channel.

Figure 2. monoFISH result for AO enrichment without antibiotic,

with both archaeal and bacterial probes Similarly, bacteria were enriched in anaerobic enrichments Growth, specifically turbidity of anaerobic enrichments was first observed at day 8 except for the culture with Salt Pond bottom water inoculum. Since the anaerobic enrichments produce gas, this was used as an indicator of growth. However, it was proven difficult. The CD enrichment from coastal sediment shows no gas production while the rest shows gas production similar to the negative control. It might be cause by some chemical reaction in the media producing CO2

gas. Wet mounts and DNA extraction confirms the presence of microbial cells in the enrichments. However, similar to the aerobic enrichments, no bands were observed for archaeal 16S rRNA using the methanogen enrichment as positive control (Figure 3). This shows that the antibiotic used was ineffective in killing the bacteria. Annamox bacteria belongs to the Phylum Planctomycetes and known to have a doubling time of weeks (Kuenen 2008). The known carbon fixation pathway of annamox bacteria is through the acetyl coA pathway (Schouten et al. 2004). Table 2. Evidence of growth in anaerobic enrichments

Metabolism Sample Turbidity Gas prod.

Wet mount (cells)

DNA 16S rRNA Arch.

16S rRNA Bact.

1 Chemo. denitrifying

Coastal sediment

✓ X ✓ ✓ X ✓

2 Anammox Coastal sediment

✓ ? ✓ ✓ X ✓

3 Chemo. denitrifying

Hypoxic/ Anoxic water

X ? ? ✓ X ?

Legend: X - not observed, ✓ - observed, ? - inconclusive, nd - no data, *with and without antibiotic

Figure 3. Amplification of 16S rRNA gene from anaerobic enrichments

Icosahedral viruses were observe at Salt Pond Most of the viruses observed were tailed or non-tailed icosahedral viruses (Figure 4) although this examination might be biased.

Figure 4. Transmission electron micrographs showing icosahedral viruses in surface water (top

row), bottom water (middle row) and outflow water/seawater of Salt Pond, MA. Conclusion The ammonia oxidizing archaea culture from open ocean is proven not to be fruitful. In addition, this study was not able to generate archaeal enrichment however there are several promising cultures that could be investigated further such as ammonia oxidizing, chemoorganotrophic denitrifying and anammox cultures, all from sediment. Which are most likely dominated by bacteria. There’s a need to design better method to selectively enrich for archaea. One way is to do successive waves of different antibiotics or dilution to extinction. This study will also generate virus metagenomics from Salt Pond which available for future analysis through the course. Acknowledgements I would like to acknowledge Rachel Whitaker and George O’Toole for organizing the MBL Microbial Diversity Course 2018. I also deeply acknowledge the generosity of Kurt Hanselmann who guide me from the conception until the completion of the study. I am deeply grateful for all the learnings, mentorship and for making experiments fun all the time. I would also like to thank Grace Chong and Gabriela Kovacikova with regards to the Salt Pond sampling, George O’Toole

and Madeline Lopez Munoz for assisting me with my anaerobic cultures, Sarah and Scott for my genomics needs, Nikki for monoFISH experiments and Kasia Hammar of MBL Central Microscopy Facility for assistance with TEM. I would also like to thank Grace Chong, Peggy Lai, Callie Chappell, Alex Alexiev for being an awesome groupmates. And finally, all the staff, faculty, course assistants, teaching assistants, and fellow students for making the course memorable and transformative. References Brochier-Armanet, C, B Boussau, S Gribaldo, and P Forterre. 2008. “Mesophilic Crenarchaeota:

Proposal for a Third Archaeal Phylum, the Thaumarchaeota.” Nat Rev Microbiol 6 (3): 245–52. doi:10.1038/nrmicro1852.

Danovaro, Roberto, Eugenio Rastelli, Cinzia Corinaldesi, Michael Tangherlini, and Antonio Dell’Anno. 2017. “Marine Archaea and Archaeal Viruses under Global Change.” F1000Research 6 (0): 1241. doi:10.12688/f1000research.11404.1.

Francis, C. A., K. J. Roberts, J. M. Beman, A. E. Santoro, and B. B. Oakley. 2005. “Ubiquity and Diversity of Ammonia-Oxidizing Archaea in Water Columns and Sediments of the Ocean.” Proceedings of the National Academy of Sciences 102 (41): 14683–88. doi:10.1073/pnas.0506625102.

Kirchman, David L. 2016. “Growth Rates of Microbes in the Oceans.” Annual Review of Marine Science 8 (1): 285–309. doi:10.1146/annurev-marine-122414-033938.

Könneke, Martin, Anne E. Bernhard, José R. De La Torre, Christopher B. Walker, John B. Waterbury, and David A. Stahl. 2005. “Isolation of an Autotrophic Ammonia-Oxidizing Marine Archaeon.” Nature 437 (7058): 543–46. doi:10.1038/nature03911.

Kuenen, J Gijs. 2008. “Anammox Bacteria: From Discovery to Application.” Nature Reviews Microbiology 6 (April). Nature Publishing Group: 320. http://dx.doi.org/10.1038/nrmicro1857.

Mahmoudabadi, Gita, and Rob Phillips. 2018. “A Comprehensive and Quantitative Exploration of Thousands of Viral Genomes.” eLife 7: e31955. doi:10.7554/eLife.31955.

Martens-Habbena, Willm, Paul M. Berube, Hidetoshi Urakawa, José R. De La Torre, and David A. Stahl. 2009. “Ammonia Oxidation Kinetics Determine Niche Separation of Nitrifying Archaea and Bacteria.” Nature 461 (7266): 976–79. doi:10.1038/nature08465.

Park, Byoung Joon, Soo Je Park, Dae No Yoon, Stefan Schouten, Jaap S.Sinninghe Damsté, and Sung Keun Rhee. 2010. “Cultivation of Autotrophic Ammonia-Oxidizing Archaea from Marine Sediments in Coculture with Sulfur-Oxidizing Bacteria.” Applied and Environmental Microbiology 76 (22): 7575–87. doi:10.1128/AEM.01478-10.

Rotthauwe, Jan-Henrich, Karl-Paul Witzel, and Werner Liesack. 1997. “The Ammonia Monooxygenase Structural Gene amoA as a Functional Marker: Molecular Fine-Scale Analysis of Natural Ammonia-Oxidizing Populations.” Applied and Environmental Microbiology 63 (12): 4704–12. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC168793/pdf/634704.pdf.

Santoro, Alyson E., and Karen L. Casciotti. 2011. “Enrichment and Characterization of Ammonia-Oxidizing Archaea from the Open Ocean: Phylogeny, Physiology and Stable Isotope Fractionation.” ISME Journal 5 (11). Nature Publishing Group: 1796–1808. doi:10.1038/ismej.2011.58.

Schouten, Stefan, Marc Strous, Marcel M M Kuypers, Irene C Rijpstra, Marianne Baas, Carsten J Schubert, S M Jetten, et al. 2004. “Stable Carbon Isotopic Fractionations Associated with Inorganic Carbon Fixation by Anaerobic Ammonium-Oxidizing Bacteria Stable Carbon Isotopic Fractionations Associated with Inorganic Carbon Fixation by Anaerobic Ammonium-Oxidizing Bacteria.” Applied and Environmental Microbiology 70 (6): 3785–88. doi:10.1128/AEM.70.6.3785.

Walker, C B, J R de la Torre, M G Klotz, H Urakawa, N Pinel, D J Arp, C Brochier-Armanet, et al. 2010. “Nitrosopumilus Maritimus Genome Reveals Unique Mechanisms for Nitrification and Autotrophy in Globally Distributed Marine Crenarchaea.” Proceedings of the National Academy of Sciences 107 (19): 8818–23. doi:10.1073/pnas.0913533107.

Appendices Appendix 1. List of samples and culture strategy

Source Condition Media Enrichment for

1 Open ocean water Aerobic Liquid

AOA media With and without antibiotic

[Mesophilic archaea] MicDiv2018 AOA experiment

2 Coastal sediment Sippewissett Marsh

Aerobic Liquid (in E-flask) 3 dilutions (1:1-1;10,000)

Marine media-inorgC Without antibiotic

[Most likely ammonia oxidizers & nitrifiers] Negative control



Marine media-inorgC With antibiotic

[Mesophilic archaea] Ammonia oxidizing archae


Anaerobic Liquid (use Argon)

Marine media-orgC With antibiotic

[Mesophilic archaea] Chemoorganotrophic archaea



Marine media-annamox With antibiotic

[Mesophilic archaea] Annamox archaea

6 Salt pond water (oxic part)


Marine media-inorgC With antibiotic

[Mesophilic archaea] Ammonia oxidizing archaea

7 Salt pond water (anoxic part)


Marine media-orgC With antibiotic

[Mesophilic archaea] Chemoorganotrophic archaea

Appendix 2. Marine media-inorgC (aerobic, incubate in dark) Ammonia-oxidizing enrichment

Energy: 2 NH3 + 3 O2 → 2 NO2- + 2 H2O + 2 H+ (Go = -235kJ/mole)

Carbon fixation: 4 NH4+ + 3 HCO3

- → 2 N2 + 3 CH2O + H+ + 6 H2O (????)

Stock Chemical Volume Final conc. Remarks

1X Filtered seawater/pondwater 500ml 1X

1M MOPS buffer, pH 7.2 5.0ml 0.01M buffer

100mM K Phosphate soln 5.0ml 0.001M phosphorus source

1M Ammonium chloride 5.0ml 0.01M nitrogen source

1000X Trace elements 0.5ml 1X

1000X Vitamin solution 0.5ml 1X

1M NaHCO3 7.5ml 0.015M inorganic carbon source

1M Acetate 0.25ml 0.0005M “start-up” carbon source

50mg/ml Kanamycin/Streptomycin 0.5ml 0.05mg/ml antibiotic against bacteria

Appendix 3. Marine media-orgC (anaerobic, incubate in dark) Chemoorganotrophic denitrifying enrichment 5 CH3COO- + 8 NO3

- + 13H+ → 10 CO2 + 4 N2 + 14 H2O 5 C4H4O4

2- + 14 NO3- + 24 H+ → 20 CO2 + 7 N2 + 22 H2O


1X Filtered seawater/pondwater 500ml 1X



1M NaNO3 25.0ml 0.05M nitrogen source, oxidant

1000x Trace elements 0.5ml 1X

1000x Vitamin solution 0.5ml 1X

1M Acetate 15.0ml 0.03M organic carbon source nonfermentable

1M Succinate 7.5ml 0.015M organic carbon source nonfermentable


Appendix 4. Marine media-annamox (anaerobic, incubate in dark) Anaerobic chemolithotrophic ammonia-oxidizing enrichment Energy: NH4

+ + NO2- → N2 + H2O


- → 2 N2 + 3 CH2O + H+ + 6 H2O


1X Filtered seawater fr. source 500ml 1X



1M Ammonium chloride 5.0ml 0.01M nitrogen source, e source

1M NaNO3 5.0ml 0.01M oxidant, nitrate not toxic compared to nitrite




1M Acetate 1.25ml 0.0025M “start-up” carbon source also nitrate to nitrite (see Kuenen 2008)

1M Formate 5.0ml 0.01M nitrate to nitrite


Appendix 5. AOA media (aerobic, incubate in dark) Ammonia-oxidizing enrichment (from MicDiv 2018 manual)

Energy: 2 NH3 + 3 O2 → 2 NO2- + 2 H2O + 2 H+ (Go = -235kJ/mole)


- → 2 N2 + 3 CH2O + H+ + 6 H2O


1X Seawater base 500ml 1X



1M Sodium sulfate 0.5ml 0.001M sulfur source, e donor

1M Ammonium chloride 0.5ml 0.001M nitrogen source, e source





Appendix 6. Two gels showing the amplification of 16S rRNA and amoA gene in various ammonia oxidizing enrichments

Documents

Abstract - Marine Biological Laboratory...Archaea exhibit diverse metabolism including chemoorganotrophy and chemolithotrophy employing both aerobic and anaerobic processes. In oxygenated