Biotemplated Inorganic Nanostructures: Supramolecular DirectedNanosystems of Semiconductor(s)/Metal(s) Mediated by NucleicAcids and Their PropertiesAnil Kumar* and Vinit Kumar

Department of Chemistry, Indian Institute of Technology Roorkee, Roorkee-247667, India

CONTENTS

1. Introduction A1.1. Nanosized Semiconductors and Metals:

Their Synthetic Protocols B1.1.1. Physicochemical Methods B1.1.2. Inorganic Templates C1.1.3. Organic and Bioorganic Templates C

2. DNA-Based Nanoarchitectures D2.1. Nanostrucures of DNA D2.2. DNA-Templated Inorganic Nanostructures D

2.2.1. DNA-Templated Semiconductor Nano-structures D

2.2.2. DNA-Templated Metal Nanosystems J3. RNA-Mediated Nanosystems Q

3.1. RNA-Templated Semiconductor Nanostruc-tures Q

3.1.1. RNA−CdS Q3.1.2. RNA−PbS Q3.1.3. RNA−PbSe Q3.1.4. RNA−CdS/ZnS S3.1.5. RNA−Iron Oxide T

3.2. RNA-Templated Metal Nanostructures T3.2.1. RNA−Au U

4. Nucleotide- and Nucleobase-Templated Nano-structures U4.1. Nucleotide-Templated Semiconductors U

4.1.1. Nucleotide Triphosphate (GTP, ATP,CTP, UTP) Mediated SemiconductingNanostructures V

4.1.2. Nucleotide Monophosphate (GMP,AMP, UMP, CMP) Mediated Semicon-ducting Nanostructures V

4.2. Nucleotide-Templated Metals: Nucleotide-Templated Au Nanostructures W

4.3. Nucleobase-Mediated SemiconductingNanostructures W

4.3.1. Purine/Adenine/Guanine−CdS W4.3.2. Adenine−β-FeOOH X

4.4. Integrated Nanosystems Y4.4.1. DNA-Templated Au/Fe2O3 Nanostruc-

tures Y4.4.2. Adenine-Templated Ag/CdS Y4.4.3. GMP-Templated Binary (Ag/CdS, β-

Fe2O3/CdS) and Ternary (β-Fe2O3/Ag/CdS) Nanohybrids Y

4.4.4. GMP-Templated Binary (β-Fe2O3/CdS)(SG) and Ternary (β-Fe2O3/Ag/CdS) (SI)Nanohybrids AA

5. Biologically Synthesized Quantized Semiconduc-tor Nanostructures: CdS and ZnS AB

6. General Discussion AB6.1. Future Prospects and Challenges AE

Author Information AFCorresponding Author AFNotes AFBiographies AF

Acknowledgments AGReferences AG

1. INTRODUCTION

Nature is among the foremost architects for the design andsynthesis of nanomaterials using biological components ofnanoscale dimensions. Biological systems such as proteins,lipids, nucleic acids, antibodies, antigens, and enzymes, havingnanodimensions of their different component(s),1−5 constitutethe fundamental building blocks of natural systems. Diversefunctionality and highly specific inter- and intramolecularnoncovalent interactions among these building blocks areelegantly used by nature for the fabrication of variousnanostructures and assemblies.5−7 Several natural materialsand most of the organisms represent highly sophisticatedhierarchical nanocomposites consisting of individual inorganicor organic components or a mixture of these materials, whichare grown spontaneously using supramolecular interactions andself-assembly principles.8,9

A large number of biominerals such as teeth, shells, and bone,demonstrating functional utilities in human and animals, areamong such nanocomposites exhibiting higher hierarchical

Received: January 10, 2013

Review

pubs.acs.org/CR

© XXXX American Chemical Society A dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXX

structure with varied shape and functional specificity.10 Unlikebulk materials, the interfacing of organic and inorganiccomponents at nanoscale levels also imparts them the variedphysicochemical and mechanical properties as is observed inabalone shell, spider silk, and bone.11 These aspects havefascinated biologists and chemists to mimic such a bottom-upapproach in the laboratory for the design/fabrication of newmaterials with varied morphology and tunable properties.Biopolymers, namely, nucleic acids, proteins, and poly-

saccharides, constitute the major bioorganic constituents ofliving things. Nucleic acids, being water-soluble, stable, andstructurally diverse, allowing easy custom synthesis, and havingvarious constituent units providing coordinating sites tointeract with metal ions and fairly high flexibility due torotation around bonds in the sugar−phosphate backbone, couldserve as an interesting template for the fabrication of nanoscaleassemblies.12

The polymers of nucleic acid are of two typesdeoxyribonucleic acid (DNA) and ribonucleic acid (RNA)differing in their structure of the sugar and nucleotides. Thesugar component is 2′-deoxyribose in DNA and 2′- ribose inRNA, and the nucleotides consist of the heterocyclic bases, thepurines and pyrimidines. DNA contains four bases: substitutedpurines (adenine and guanine) and pyrimidines (cytosine andthymine) (Figure 1). Three of these bases (adenine, guanine,and cytosine) are common in RNA, but thymine is replaced byuracil. Furthermore, RNA is composed of smaller subunits ofnucleotide monomers.Among the above biopolymers, DNA encodes organism

hereditary information controlling the growth and division ofcells. The genetic information stored in DNA is transcribed intoRNA, which is eventually translated for the synthesis ofproteins needed for cellular functions. In DNA two nucleotidenanowires are twisted around each other with a replicate unitevery 3.4 nm with a diameter of 2 nm.13 The RNA in its “A”form helix consists of replicate units every 2.9 nm with adiameter of 2.6 nm.14,15 In this unit t-RNA, which is essentialfor protein synthesis, exhibits well-defined three-dimensionalsecondary and tertiary structures with an average size of about 5nm. The biological organisms in the living system assemble themolecular building blocks of these biopolymers into organizednanostructures called nanoscale machines. Thus, DNA andRNA have long-range hierarchical order, large functionalities,and nanodimensions, making them attractive templates andscaffolds for integration with nanosized inorganics such assemiconductors and metals for designing new syntheticnanomaterials.

1.1. Nanosized Semiconductors and Metals: TheirSynthetic Protocols

Semiconductor nanoparticles (NPs) have attracted a greatamount of interest for more than last two decades because oftheir multidisciplinary applications in the areas of solar energyconversion,16−18 sensing,19−21 optics,22,23 electronics,24−27

photonics,1,28−31 magnetism,32−35 and biomedicine.36−38 Themost fascinating observations about these materials are theirsize- and shape-dependent novel properties, such as optical,electronic, photochemical, and magnetic, which have demon-strated tremendous potential in the above-mentionedareas.16−38

Metal nanoparticles (MNPs), having dimensions approach-ing the Fermi wavelength of electrons, also exhibit discreteelectronic transitions and display unique optical and electrical

properties.39−45 A distinctive feature of MNPs is theircharacteristic localized surface plasmon resonance (LSPR)band, which largely governs their physicochemical properties.Precise control of the SPR band and its intensity can bemanipulated by a change in the size, shape, dimensionality, andarrangement of the MNPs and the refractive index of themedium. Owing to these characteristics, MNPs are findingwide-ranging applications from biosensing to small-moleculedetection, optical data storage, and in vivo tissue imaging.46−49

1.1.1. Physicochemical Methods. In the literature a largenumber of techniques comprising both physical and chemicalmethods have been employed for the synthesis of semi-

Figure 1. Structures of nucleic acids (DNA and RNA), ribonucleotides(AMP, GMP, CMP, and UMP), and nucleobases (A, G, C, T, and U).

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXB

conductor and metal nanostructures.50−58 The applications ofphysical methods, however, remains limited, as quite often thenanomaterial(s) thus produced remain attached to the matrixand may not allow their bulk preparation.59

Chemical methods, including chemical precipitation andsol−gel, solvothermal, microwave, photochemical, and radiol-ysis techniques, have been used more extensively. Synthesis ofcolloids using wet chemistry has provided an interestingmethodology to grow different nanostructures in solution usingthe bottom-up approach, which provides greater flexibility andreproducibility for their synthesis with tunable properties.Excellent reviews on a number of colloidal approaches havebeen contributed from the groups of Henglein,56 M. A. El-Sayed,57 and Alivisatos.58 Moreover, they offer convenientmeans for nanofabrication of integrated materials forapplications in the areas of catalysis, light-emitting diodes(LEDs), solar cells, lasers, photodetectors, sensors, biology, andmedicine.57−61

For the preparation of colloidal materials of II−VI and IV−VI semiconductors, the commonly used method is chemicalprecipitation. It is performed either in the presence of a suitablestabilizer(s) or employing an organized medium such asLangmuir−Blodgett films, polymers, surfactants, micelles,vesicles, and glasses, which not only allow control of the sizeof the colloidal materials but also improve upon theircharacteristic properties, such as solubility, optical, andmagnetic properties. Another popular synthetic route, utilizingthe pyrolysis of organometallic precursors by injecting theminto the hot coordinating solvent, for their preparation withnarrow size distribution was developed by Murray et al.62 Forthe preparation of colloidal metal oxides, hydrolysis of metalsalts in the absence and presence of surfactants, hydrothermaland sol−gel methods are generally employed.51,54

Colloidal MNPs of different sizes and shapes have beensynthesized largely by the chemical reduction of metal salts inan aqueous or organic medium employing a number ofreducing agents such as citric acid, sodium borohydride,hydrazine, ascorbic acid, poly(ethylene glycol), and form-aldehyde/sugars.51,52,55,57,63,64 Some other popular reducingagents which serve binary functions as both reducing andstabilizing agents used for the preparation of MNPs arepoly(vinylpyrrolidone) (PVP) and ethylene glycol.63,64

In the absence of a suitable stabilizer(s), the colloidalnanostructures either grow at the expense of smaller particles togain thermodynamic stability through Ostwald ripening orundergo aggregation to reduce their surface free energy. In theabsence of any functionality of the capping agent, the abovemethods though lack control of the architecture andprogrammability of the synthesized nanosystems.1.1.2. Inorganic Templates. In recent years several novel

metal−organic frameworks (MOFs) comprising mainly tran-sition-metal ions (Cu2+, Zn2+, Co2+, and Mn2+) and organicligands (bidentate and tridentate carboxylic acids, squaric acid)and zeolites have drawn considerable attention as templates forgenerating NPs within their cavities or by encapsulation of thepresynthesized NPs in their framework.65−68 This allowssimultaneous observation of the properties of NPs and thatoriginating from the framework materials.65,66 These templatesthough provide tunable pore size and a rigid frame for thegrowth of nanomaterials, but due to their nonmanipulativemicroenvironment they restrict the reorganization of thenanomaterials to form self-assemblies and limit their use for

controlling the shape, size, and three-dimensional distributionsof growing NPs within the templates.69

The colloidal nanocrystals with a large solid/liquid interfaceare quite vulnerable to the surrounding chemical environment.The presence of a large number of unsaturated atomic speciesand dangling bonds on their surface make their surface reactiveand highly sensitive to their surroundings.53,58,69−71 Therefore,the treatment of the surface of the colloids through surfacepassivation makes it feasible to produce new materials withenormous flexibility, reproducibility, and enhanced properties.

1.1.3. Organic and Bioorganic Templates. Recently, theinterfacing of quantized colloidal nanomaterials with organics/bioorganics as templates has emerged as a challenging area ofresearch to generate new materials with controlled dimensionsand morphology. The ligation prevents their aggregation byreducing their surface energy besides reducing their size andinducing new transitions to display different physicochemicalproperties. Unlike inorganic templates, specific interaction(s)between the functional group(s) of organic/bioorganicligand(s) with metal ion centers may provide a tool toassemble their 1D, 2D, and 3D nanoarchitectures.72,73

Specifically, the synthesis of metal/semiconductor nano-hybrids consisting of an inorganic core coated by an organic/bioorganic shell having the same dimensions might be exploitedto enhance the physicochemical properties of the core.53,59,70,74

The functionalization of the inorganic core has been achievedthrough a variety of interactions, such as electrostaticadsorption by anionic ligands or positively charged functionalgroups and chemisorption, and by specific interactions such asaffinity binding of biomolecules.57,58 In this synthesis thefunctionality of the organic shell due to its differing interactionwith the core would play a key role in determining the size andshape of the nanohybrids. A variety of biocompatible organics,such as dendrimers75 and thiols,76,77 and biological moleculeshave been used as matrix or capping agents to synthesize metalchalcogenides/metal oxides,78−81 MNPs,82 and metal/semi-conductor nanocomposites.83 These investigations have addeda new dimension to NP research with respect to their biologicalapplications.84 Although different templates have their specificuses in regard to stabilization and precise control of thearchitecture of nanocrystallites, capping by nucleic acidsprovides greater programmable capability due to theircharacteristic structural features and molecular recognitionproperties.

1.1.3.1. Nucleic Acid-Mediated Nanostructures. Nucleicacids with long-range nanoscale order can control thenucleation and growth of nanocolloids effectively by bindingof metals/metal ions or the metals of semiconductors to thespecific sites of biomolecules.6,7,84−90 These materials will notonly provide chemical functionality for integration but alsomake it possible to modify and manipulate the structure,morphology, and properties of the biomolecules convenientlythrough reorganization and self-assembly. Besides this, thecapping of the inorganic core by bioorganics may impart themseveral additional features, such as enhanced solubility andsurface properties. The synthesis of functional nanomaterialsrequires judicious consideration and applications of thesefeatures for designing the building blocks and converting themfurther into multicomponent systems with an appropriatepotential gradient and synergic effect to achieve the effectivecharge separation and enhanced optoelectronic properties. Asystematic organization of metal/semiconductor nanostructuresis drawing considerable attention because of their potential

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXC

applications for the fabrication of new materials required foradvanced technology (vide ut supra). The colloidal nanocrystalsof semiconductors and metals offer attractive and promisingbuilding blocks for the fabrication of advanced materials.For the preparation of nucleic acid-templated nanostructures,

the wet chemical precipitation and reduction method(s) havelargely been adopted. In general, two types of protocols havebeen used. In the first approach, metal ions bound supra-molecularly to different functionalities of the template areconverted chemically to yield the desired nanostructures.2,85

More specifically, metal cations at physiological pH or pH > 7initially bind the nucleic acid scaffold through the phosphatebackbone and the functionalities of the nucleotides. In the caseof semiconductors, their subsequent reaction(s) with thereagents furnishing sulfide/selenide/telluride ions then initiatesthe nucleation of the respective semiconducting NPs. For thesynthesis of oxides, generally hydrolysis of metal ionscoordinated to the nucleic acid or its components forms therespective capped metal oxides. These small clusters tend toaggregate in the growth process, which is prevented by thecapping with the nucleic acid and its components. For thesynthesis of metallic nanostructures, metal ion-bound tem-plates/scaffolds are reduced chemically or photochemically (asdiscussed in section 1.1.1).In another method, presynthesized nanostructures with

similar dimensions and structural compatibility with biomo-lecular templates are interacted to form nanohybrids byexploring their supramolecular interactions.2

These methods avoid extensive heat and radiation, whichcause degradation/denaturation of the nucleic acids.The present review outlines the recent status of the synthesis

of nanohybrids/nanostructures of semiconductors and metalstemplated by nucleic acids (DNA and RNA) and theircomponents using mainly the wet/colloidal approach. It alsohighlights changes in their optical, electronic, magnetic, andelectrical properties based on their morphology and self-assembly and envisages their potential for the synthesis ofadvanced materials for technological applications.

2. DNA-BASED NANOARCHITECTURES

DNA-mediated assemblies of NPs have attracted a largeamount of attention for the organization of both metallic andsemiconducting NPs to yield well-defined 1D, 2D, and 3Dnanoarchitectures with control of their geometry andfunctionalities.91,92 In several nanotechnological applicationsof DNA-linked materials, their hybridization has mainly beenexploited. Self-assembly of such integrated materials may leadto the fabrication of new nanostructures with controlleddimensions and tunable properties for applications indevices.93−99

2.1. Nanostrucures of DNA

Because of the importance of DNA as an importantbiotemplate, a variety of nanostructures of different DNAstrands alone have been synthesized by using DNA origamitechnology, developed by Paul Rothemund.100 The DNAorigami structures have been successfully used as programmedtemplates for the assembly of NPs, small molecules, andproteins, in single-molecule analysis, and as containers fordelivery of small to large molecules such as proteins.101−104

Apart from the well-established origami technology, Wilneret al.105 have developed a chemical approach by using circularDNA as a building block for the construction of DNA

nanotubes. The circular DNA was modified with amine andthiol functionalities, the modified DNA was then reacted withbismaleimide-functionalized nucleic acid to yield circular DNA-bridged long nanowires with an average height of about 0.6 nm,indicating they contain single-stranded DNA (Scheme 1).

These wires could be subsequently cross-linked by bisthiolatednucleic acid to yield fairly stable DNA nanotubes. In analternative approach, circular DNA consisting of four aminesfunctionalized on its pole upon cross-linking with bisthiolatednucleic acid also yields nanotubes.2.2. DNA-Templated Inorganic Nanostructures

DNA due to its stability, mechanical rigidity, nanodimensionsof the repeating unit, manipulative length, selective interactionof single strands, and multifunctionality is extremely suited tonanotechnological manipulation.106,107 Its remarkable molec-ular recognition properties, complementary base-pairing, andstructural features further make it appropriate as a program-mable “smart” building block for the construction of organizedmaterials by interfacing with the synthetic inorganic colloidalmaterials. In several nanotechnological applications of DNA-linked materials, their hybridization has been exploited formaking nanohybrids/assemblies. Self-assembly of such inte-grated materials may lead to the fabrication of newnanostructures with controlled dimensions and tunable proper-ties for applications in bionanoelectronics and computing-related devices.101,108,109

The possibility of manipulating the DNA-templatednanostructures mainly takes place through the negative chargeon its phosphate backbone and multifunctionality through fournucleobases, which may allow its interaction with metals/metalions.

2.2.1. DNA-Templated Semiconductor Nanostruc-tures. DNA-mediated growth of semiconductors generally

Scheme 1. Synthesis of Covalently Linked DNA Nanotubesthrough the One-Step Cross-Linking of TetraaminatedCircular DNAsa

aReprinted from ref 105. Copyright 2010 American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXD

makes use of the bottom-up approach. A number ofmethodologies have been tried to enhance the physicochemicalproperties of different semiconductors using various DNAsequences.110−114 Some of these studies based on templating ofthe fluorescing quantum dots by different DNA sequences andtheir modified analogues have been discussed and may findapplications in medicine, sensing, and imaging.2.2.1.1. DNA−CdS/PbS/CdSe/CdTe. DNA−CdS. Coffer et

al.78,110−113 in their pioneering work for the first timedemonstrated that calf thymus (CT) DNA could be used asan effective stabilizer for the synthesis of CdS NPs.110 Theadenosine-containing polynucleotide was observed to beunique in generating small CdS clusters of average diameterof about 35 Å and the corresponding 520 nm peak maximum intheir steady-state fluorescence spectrum. CdS particles,stabilized by poly[C], poly[C]·poly[G], poly[U], and poly[G],exhibit prominent photoluminescence (PL) maxima at 590,605, 630, and 640 nm, respectively, indicating the structuralinfluence of the polynucleotide on cluster formation (Figure 2).

Thermolysis of Q-CdS (Q = quantized) stabilized by thepolynucleotide results in an increase in the particle sizeassociated with a shift in the photoluminescence maximum, andthe extent of the shift was found to be nucleotide dependent.The photoluminescence spectrum of Q-CdS−DNA exhibitsbroad trap emission ranging from 480 to 720 nm with amaximum at 620 nm. This emission has been attributed to thesulfur vacancies.78 An interaction between Cd(OH)2-layered Q-CdS and the polynucleotide has been examined by usingemission spectroscopy. The addition of either of thepolynucleotides, Escherichia coli DNA or poly[A], quenchesthe emission of these particles. The observed quenching fitsinto a Perrin-type model.112 A marked difference in the

luminescence behavior was observed for Q-CdS stabilized bypoly(adenylic acid) and poly(uridylic acid) in terms ofpressure-induced changes in the luminescence. The coating ofthe surface of each type of Q-CdS with Cd(OH)2 resulted in aleveling effect whereby only a steady decrease in emissionintensity was observed for each of these systems. A modelinvolving pressure-induced perturbation of anionic sulfur holetraps at the CdS surface is suggested to explain these findings(Scheme 2).113

Coffer et al.114a for the first time demonstrated the use ofcircular plasmid DNA, anchored to the derivatized substrate(polylysine-coated glass slide) for templating of CdS toproduce the Q-CdS nanostructure assembly. They also pointedout the application of this method for producing the diverserange of semiconductor nanostructures by employing plasmidsof varied size, shape, and composition. Gao and Ma114b havedemonstrated the application of DNA plasmid-templatedluminescing CdS NPs as a facile strategy for gene delivery.The synthesis of a CdS nanoparticle on the DNA template wascarried out in five consecutive precipitations for completeshielding of the negative charge on the backbone on plasmidDNA (Scheme 3). The concentrations of CdS nanocrystals(NCs) employed in this work were 4 and 15 nM, which werefairly low to cause severe cytotoxicity compared to thepreviously reported 70−200 nM concentrations, which wereeven reported to be nontoxic to a variety of cell lines.The growth of quantized nanosized semiconductors in low

dimensionality, specifically nanowire-, nanorod-, and nanotube-like morphologies, could be explored for wide-rangingapplications in the areas of nanoelectronics/nanocircuitry,optoelectronics, fluorescence imaging, drug delivery, andsensing.115−117 Dong et al.118 reported a DNA-templatedchain of NPs with an average size of NPs of 14.2 nm ± 10% butdecreasing to 12.0 nm ± 0.67% upon standing. These one-dimensional structures exhibited emission maxima at 540 nm ina thin film and at 520 nm in solution and upon integration witha simple two-terminal electrical device bridging about a 7 μmgap demonstrated charge transport (Figure 3). The photo-

Figure 2. Absorption and photoluminescence spectra of nonactivatedand activated Q-CdS stabilized by (a) CT DNA, (b) poly[A], (c)poly[A,U], and (d) poly[U]. Reprinted from ref 113. Copyright 1999American Chemical Society.

Scheme 2. Cartoon Representation of the Possible Modes ofInteraction of Anionic Surface Sulfide Sites of NonpassivatedQ-CdS with Amino Moieties of the Pyrimidine Bases ofPoly[A]a

aReprinted from ref 113. Copyright 1999 American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXE

luminescent image of this device exhibited bright emission inthe region of the nanowires, confirming that the CdS nanowiresare coated with λ-DNA strands.

In another approach, the fabrication of a CdS wire on a DNAscaffold (average length ∼3−4 μm and diameter ∼40−50 nm)from salmon testes adopted the photochemical route exhibitingan excitonic band at about 350 nm.119 The wires were found tobe electrically conducting, and the ohmic resistance for thelinear fit was calculated to be 742 Ω, thus demonstrating theirapplication as a tool for electronic devices (Figure 4). From thesame laboratory the synthesis of λ-phase DNA (48500 bp)templated CdS nanowires of 8−12 μm length and 140−170 nmaverage diameter using microwave irradiation has beenreported.120 These nanowires were observed to be fairly stablefor more than three months, retaining their optical properties(Figure 5), and also exhibited a linear ohmic behavior, fromwhich their resistance was calculated to be 115.78 Ω.DNA−PbS. Patel et al.121 reported the synthesis of DNA-

templated PbS quantum dots (QDs) with a fairly well-defined

absorption band at 538 nm having an average size between 4and 6 nm with no detectable fluorescence at room temperature.In a subsequent work, Levina et al.122 reported the synthesis of

Scheme 3. Schematic Illustration of DNA Plasmid-Templated CdS NC Growtha

aKey: (a) CdS NC growth along the DNA plasmid induced DNA packing and GSH-mediated DNA unpacking, (b) schematic illustration of thedouble-stranded DNA−CdS NC hybrid nanostructure, (c) electrostatic interaction between the phosphate backbone and surface Cd2+ ions.Reprinted from ref 114b. Copyright 2012 American Chemical Society.

Figure 3. Luminescence image of the device illustrating the emissionof the CdS nanowire. Scale bar = 20 μm. Reprinted with permissionfrom ref 118. Copyright 2007 Wiley.

Figure 4. (A) Field emission scanning electron microscopy (FE-SEM)image of a single DNA−CdS nanowire stretched across a 20 μm gapon a Si chip. The inset shows the corresponding higher magnificationimage. (B) Current−voltage characteristics of a single DNA−CdSbridge spanning from electrode to electrode as shown in part A.According to the linear fit of the experimental data, the ohmicresistance of the single bridge has a value of 742 Ω. (C) I−Vcharacteristics of three different nanowires showing good reproduci-bility of the experiments. Reprinted with permission from ref 119.Copyright 2008 Wiley.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXF

efficient infrared-emitting QDs grown on a DNA template insolution. These particles are produced with face-centered cubic(fcc) structure having an average size of about 4 nm and exhibita featureless electronic spectrum having an absorptionthreshold in the NIR region. Under 830 nm irradiation theseparticles show a strong band edge luminescence peaking at1100 nm with a fluorescence quantum efficiency of 11.5%. Thesolid thin film prepared by the deposition of these DNA-grownNPs exhibited a photoluminescence quantum efficiency of 8 ±1% compared to PbS NPs grown by the organometallic route,which exhibited a much reduced quantum efficiency ofluminescence of 0.5−1.5%.DNA−CdSe. DNA molecules have also been used as building

blocks for templating of CdSe by exploiting its recognitioncapability, tunable sequence, and length. This has been carriedout by depositing a colloidal aqueous solution of cationic CdSenanorods on a planar DNA−PVPy-20 (poly(4-vinylpyridine))complex by short incubation of DNA−PVPy-20. This resultedin the formation of a highly luminescent DNA−CdSe nanorodcomplex via electrostatic interaction between cationic CdSe

nanorods (length exceeding 1 μm and diameter ∼100 nm) andnegatively charged phosphate groups of DNA.123 The self-organized complexes of CdSe nanorods and DNA wereobserved to have filamentary, netlike, or spheroidal morphologyupon incubation for 7 min. These filaments were found topossess strong linearly polarized photoluminescence due to theunidirectional orientation of the nanorods.

DNA−CdTe. The synthesis of chimeric DNA-functionalizedCdTe results in the formation of nanocrystals having excitonicabsorption at 520 nm and emission in the visible range (λem

max

= 560 nm) with a fairly high quantum yield of emission (17%)and fwhm of 50 nm (Figure 6).124 The hydrodynamic size ofthese nanocrystals was estimated by gel filtration chromatog-raphy. Phosphorothioate−phosphate-modified CdTe is pro-duced in the size range of 6−6.5 nm, whereas glutathione-modified particles have a diameter ranging from 4.3 to 4.5 nm.These nanocrystals exhibit highly specific binding to nucleicacids, proteins, and cell targets. Having a small hydrodynamicdiameter, these particles could find applications in bioimaging,but their toxicity observed in recent years raises concerns abouttheir physiological applications.125

In recent years several sensors based on QDs and dye-labeledbiomolecules have been developed. The detection of DNAhybridization based on fluorescence resonance energy transfer(FRET) between blue luminescent CdTe QDs and cyanine 3(Cy3) labeled ssDNA (ss = single-stranded) and dsDNA (ds =double-stranded) has been reported.126 In this system Cy3−DNA acts as an acceptor, the cationic polymer acts as anelectrostatic linker, thus causing an FRET from the QD donorto the dye acceptor (Scheme 4). The differential interaction ofssDNA and dsDNA with CdTe+ results in differential changesin the FRET efficiency, which has been used to recognize thehybridization (Figure 7).Core−shell fluorescent semiconducting nanosystems have

been studied widely because of their high quantum yield andphotostability at room temperature, making them useful forbiological applications such as biological labeling, imaging, anddetection as fluorescent materials.60,127 Some of the DNA-tethered core−shell CdSe@ZnS systems used for sensing andFRETs are discussed below.

Figure 5. UV−vis absorption spectra of a DNA−CdS nanowire atdifferent stages of synthesis: (A) DNA strand itself in water, (B)DNA−Cd2+ complex, and (C) mixture of DNA, Cd salt, and t-NH2after microwave irradiation for 60 s. The absorption band at 340−420nm corresponds to the excitonic peak of the CdS nanowire. Reprintedfrom ref 120. Copyright 2009 American Chemical Society.

Figure 6. DNA-functionalized CdTe nanocrystals: (a) emission spectrum and absorption spectrum (inset) of DNA-functionalized CdTe QDs, (b)sizing of ps−po DNA and all po DNA-passivated CdTe QDs using gel filtration chromatography. ps−po: (5'TCCGCTGCA-GAAAAAT*C*G*G*G*C*G*T*A*C3' (* indicates phosphorothioate linkage); po: 5'TCCGCTGCAGAAAAATCGGGCGTAC3'. Reprintedwith permission from ref 124. Copyright 2010 Nature Publishing Group.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXG

2.2.1.2. DNA−CdSe/ZnS. Lee et al.128 have prepared stablecationic DNA−CdSe@ZnS complexes using electrostaticinteraction between poly(ethylene glycol) (PEG5000) con-jugated amine-functionalized CdSe@ZnS QDs and DNA. PEGconjugation leads to enhanced stability, increased solubility, andreduced nonspecific adsorption of DNA on the surface of theQDs. The hydrodynamic size of the QD−DNA (1:1) complexwas estimated to be 16.5 ± 1 nm, which is increased to 20 ± 1.8nm for the 1:5 complexes. The fluorescence of these QDs wasquenched up to 90% on complexation with carboxytetrame-thylrhodamine (5′-TAMRA) modified oligonucleotide throughFRET (Figure 8). The quenching of fluorescence could bereversed by binding of unlabeled DNA, which allowed thecomplementary target to be detected selectively. Its detectioncapability for pathogenics, specifically the synthetic 100-meroligonucleotide derived from H5N1 influenza virus, is at 200nM in the solution.Freeman et al.129 synthesized CdSe@ZnS (d = 3.8 nm)/

CdSe@ZnS (d = 5.8 nm) QDs modified with thymine (T) richnucleic acid (1)/cytosine (C) rich nucleic acid (2), respectively,using bis(sulfosuccinimidyl) suberate (BS3) as a bifunctionalcoupling reagent. T-rich- or C-rich-nucleic acid-modified QDshaving λem = 560 nm and λem = 620 nm, respectively, werefound to be selective for the analysis of Hg2+ or Ag+ ions usingan electron-transfer-quenching path by monitoring thequenching of luminescence. The detection limits for analyzingHg2+ and Ag+ were found to be 2 and 200 ppb, respectively.Besides, using them as optical transducers for sensing, theseQDs have also been employed as optical labels to follow logicgate operations using Hg2+ and Ag+ as inputs. The mixture ofthe two QDs yielded an “AND” gate upon interaction with Ag+

and Hg2+ ions as inputs. Fluorescence quenching of theluminescence of the system at either λ = 560 nm or λ = 620 nm

is defined as a “False” output, or “0”. In the presence of the twoinputs, Ag+ and Hg2+ ions, fluorescence quenching ofluminescence at both emissions is defined as a “True” output,or “1” (Figure 9). The “OR” gate was designed by

functionalization of these QDs with either nucleic acid 1 ornucleic acid 2. In this case the quenching of luminescence byeither Hg2+ or Ag+ provided the OR logic gate.Recenly, Wang et al.130 have achieved QD−DNA bio-

conjugation in a one-step reaction using DNA oligomers with asingle thiol modification for the conjugation. They havesynthesized CdSe/ZnS core−shell QDs by surface cappingwith two capture strands, strand 1 with 34 bases (C1) andstrand 2 with 27 bases (C2). The CdSe core particles with C1and C2 strands are fairly monodisperse with sizes of 4.9 ± 0.2and 6.9 ± 0.3 nm and exhibit emission peaks at 548 and 670nm, respectively (Figure 10). After the formation of the ZnSshell, the quantum yield (QY) of emission due to theseparticles is significantly increased from 8.6% to 41.3% for a

Scheme 4. Principle of DNA Detection Based on QD/Cy3-Labeled DNA FRETa

aReprinted from ref 126. Copyright 2007 American Chemical Society.

Figure 7. Normalized spectra of (a) emission of CdTe+ excited at 360nm, (b) absorption of Cy3−DNA, (c) emission of Cy3−DNA excitedat 488 nm, and (d) emission of CdTe+/Cy3−DNA excited at 360 nm.All spectra were recorded in saline−sodium citrate (SSC) buffer.Reprinted from ref 126. Copyright 2007 American Chemical Society.

Figure 8. Detection of target DNA with QD−DNA (p25) complexes.(A) QD PL spectra: (a) initial QD PL without TAMRA-labeled DNA,(b) QD PL quenched on complexation with TAMRA-modified DNA,(c) significant recovery of QD fluorescence at 530 nm was observedafter hybridization with complementary DNA (DNA/QD molar ratioof 5), (d) weak recovery of QD fluorescence was observed withnoncomplementary DNA. (B) Photograph of the corresponding QD−DNA complexes illuminated with a UV lamp (340 nm). Theconcentrations of QD and target DNA are 100 nM and 5 μM inphosphate-buffered saline (1× PBS, pH 7.2), respectively. Reprintedwith permission from ref 128. Copyright 2009 Wiley.

Figure 9. Time-dependent fluorescence changes of the AND logic gatesystem depicted in Scheme 2 and activated by the following inputs: (a)no Hg2+, no Ag+ (0, 0); (b) no Hg2+, 30 μM Ag+ (0, 1); (c) no Ag+, 30μM Hg2+ (1, 0); (d) 30 μM Hg2+, 30 μM Ag+ (1, 1). Inset: truth tableof the AND gate logic system. Reprinted with permission from ref 129.Copyright 2009 Wiley.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXH

green QD (G-QD-C1) and from 4.4% to 21.7% for a red QD(R-QD-C2) due to the passivation of the core. The surfacecapping by ZnS enhanced the water solubility of these particlessignificantly. To examine the FRET from QDs to fluorescentdyes, Cy3 and Cy5 having good spectral overlap with green andred QDs, respectively, the dyes were conjugated with the 3′ endof DNA reporter strands R1 and R2, which were comple-mentary to the C1 and C2 capture strands. Green QDs werehybridized to reporter strands R1 and R3 to yield G-QD-C1-R1(11.2 nm) and G-QD-C1-R3 (7.5 nm), respectively. In thesestrands Cy3 is present at the 3′ and 5′ ends, respectively, of R1and R3, and the FRET in this hybridized system was observedto increase with decreasing donor−acceptor distance in linewith the Forster equation. For G-QD-C1-R3, the FRETefficiency was observed to increase drastically from 66% to95%. This thus indicates it to arise from the sequence-specificbinding of DNA strands on the surface of the QDs.Boeneman et al.131 have reported CdSe@ZnS core−shell

QD-sensitized DNA-mediated photonic nanowires employingthe self-assembly approach based on polyhistidine-drivencoordination to metal ions. The primary amine on thebackbone DNA was modified to an aldehyde and then wascovalently coupled to 2-hydrazinonicotinoyl (HYNIC) modi-fied (His)6-peptide using aniline-catalyzed chemoselectiveligation. The different dye-labeled strands were then hybridizedto their complementary sequence on the (His)6-peptide-modified DNA backbone and ratiometrically self-assembled toQDs to produce QD−DNA photonic nanowires with variedphotophysical capabilities. DNA fragments prelabeled withdifferent dye acceptors such as Cy3, Cy5, Cy5/Cy5.5, and Cy5/Cy7 were hybridized to a complementary DNA template asshown in Scheme 5.

These labeled dye acceptors were then excited by the CdSe@ZnS core−shell QDs via FRET. The efficiencies of QD−Cy3and QD−Cy3−Cy5 were found to be 65% and 18%,respectively. The average fluorescence lifetimes of dye−DNAwhen hybridized in different positions (shown in italics), QD−Cy3, QD−Cy3−Cy5, QD−Cy3−Cy5, and QD−Cy3−Cy5−Cy5.5, were observed to be 4.70, 3.84, 4.08, and 2.85 ns,respectively. These lifetimes were much higher compared tothose of the individual dyes Cy3 and Cy5, which were found tobe the same, 1.33 ns. Such nanowire formation has beensuggested to have potential for the fabrication of a nanosystemfor harvesting light in the UV range and obtaining emission inthe visible and NIR ranges. Integration of such a DNA-basedphotonic structure with QDs could help in the generation of abiophotonic wire assembly with potential in nanotechnology.CdSe@ZnS core−shell QDs stabilized by mercaptopropionic

acid (MPA) produced water-soluble highly luminescent QDswith a diameter of about 3 nm.132 These QDs and Au electrodewere bridged through the mercapto (−SH) and amino (−NH2)ends of i-motif DNA molecules. Electron transfer from thephotoexcited QDs to the Au electrode is modulated by a motorDNA conformation change, which is driven by a change in thepH of the electrolyte. By changing the pH from 8 to 5, motor

Figure 10. (a) One-step in situ DNA functionalization of CdSe@ZnScore−shell QDs. (b) PL spectra of CdSe core QDs and the DNA-capped CdSe@ZnS core−shell QDs. Both the green and red QDsshow a significant increase of the QY after growth of the ZnS shell andDNA capping simultaneously. The intensities were normalized bygreen CdSe@ZnS core−shell QDs. (c, d) TEM images of green andred core−shell QDs, respectively. Higher magnification images ofindividual dots are shown in the insets. Reprinted with permissionfrom ref 130. Copyright 2008 Wiley.

Scheme 5. DNA/Peptide Sequences and Peptide−DNAChemoselective Ligationa

aKey: (1) The terminal amine group on the “backbone” DNA isactivated to a formylbenzoic acid and chemoselectively ligated to anHYNIC-modified (His)6-peptide sequence. Individual dye-labeledDNA strands are (2) hybridized to their complementary sequenceon the (His)6-modified DNA backbone and (3) self-assembled to theQDs via metal-affinity coordination. The resulting structure consists ofa central QD with multiple, rigid dye-labeled DNAs centrosymmetri-cally arrayed on its surface as designated by the QD1:DNAn ratio. UVexcitation of the system results in an energy transfer cascade from thecentral QD through the sequential aligned dye acceptors which emitfrom the visible to the near-IR portion of the spectrum. 1−4 indicatesequential dyes and are used to indicate the dye position relative to theQD in subsequent experiments. Reprinted from ref 131. Copyright2010 American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXI

DNA molecules folded from the stretched state to thequadruplex i-motif structure, which shortened the distancebetween the QDs and the Au electrode to 3 nm from 10 nm(Scheme 6). The dynamic response of switching the photo-

current of the motor is understood by the tunneling of thephotoexcited electron from the QDs to the Au electrode. Therate of electron transfer is found to be inversely proportional tothe distance between the donor and acceptor and is consideredto have occurred by a change in pH. On this basis, a dynamicpH-driven modulation system of photoelectric conversion hasbeen realized.FRET and fluorescence enhancement studies indicate that

the detection limit and sensitivity of these nanohybrids fordifferent target DNAs or other metal ions do not show anyspecific correlation with the number of base pairs. They arelikely to depend upon the nature and charge carrier dynamics ofthe metal/semiconducting QDs.2.2.1.3. DNA−Iron Oxides: Magnetic Properties. Byrne et

al.133 have synthesized largely denatured herring sperm DNA(present substantially as single-stranded DNA) templatedFe3O4 nanowires in an aqueous suspension. A markeddifference in the morphological alignment between duplexDNA (entangled chains) and denatured DNA (randomlydistributed chains) has been attributed to the efficient bindingof the magnetic NPs through the phosphate backbone in thelatter case. This creates a long-range-ordered chain with anincreased number of magnetic NPs along the chain. Thesenanowires exhibit remarkably high relaxivity at low field andhave been suggested to have a potential application in MRI. Inregard to the contribution of the phosphate binding to theobserved behavior, it may be added that the simplepolyphosphates, having a negatively charged monomer unit(PO3

−), would also stabilize iron oxide nanostructures bybinding to the surface iron (Fe2+/Fe3+) through an ionic bondand may influence their magnetic properties due to a change inspin. However, unlike biopolymers, they are not expected toproduce varied nanoarchitectures such as a long-range-ordered/organized chainlike morphology to demonstrate the enhancedmagnetic behavior. Kinsella and Ivanisevic134,135 reported thesynthesis of DNA-templated magnetic nanowires with Fe2O3(average height 4.1 ± 0.9 nm) and CoFe2O3 (3.4 ± 0.8 nm)NPs by exploiting the electrostatic interaction betweenpositively charged NPs and the negatively charged backboneof DNA. Both iron oxide and cobalt iron oxide were found tobe superparamagnetic at room temperature, but at 10 K thecobalt iron oxide particles displayed weak ferromagneticbehavior (Figure 11). At 300 K CoFe2O3 exhibited a higher

value of saturation magnetization, 89 emu/g, compared to 66emu/g at 10 K. The magnetic force microscopy exhibited theDNA templated structures to be strongly magnetic at roomtemperature.

2.2.2. DNA-Templated Metal Nanosystems. DNA-templated synthesis of metal nanostructures has beeninvestigated extensively for a number of metals, such assilver,136 gold,137 platinum,138 palladium,139 cobalt,140 nickel,141

and copper.142 Most of these reports explored the formation ofone-dimensional nanostructure-like nanowires because of theirpotential in the development of functional nanoelectronic,optoelectronic, and magnetic storage devices.Gold and silver in the form of salts and their compounds, and

as nanoparticles have been used as therapeutic agents sincemedieval times for treating a variety of diseases.61,143

Nanostructures of Au and Ag have recently drawn greatattention for their increased medical applications because oftheir inertness and biocompatibility.63,144−148 Although bothAu and AgNPs have been considered largely to be nontoxicwithin a specific dose limit,146−148 several contradictory reportshave appeared specifically on the toxicity aspects of Au andAgNPs.145,148a,149,150

In a biological system, NPs interact with the cellularcomponents (nucleus, membrane, mitochondria) and mayinfluence their overall functioning.148,150,151 Recent investiga-

Scheme 6. Scheme of the QD−Motor DNA−Au ConjugatedElectrodea

aNot to scale. The electron transfer process from the photoexcitedQDs to the Au electrode is modulated by the motor DNA’sconformation change, which is driven by changing the pH value ofthe electrolyte. Reprinted with permission from ref 132. Copyright2009 Royal Society of Chemistry.

Figure 11. SQUID (superconducting quantum interference device)magnetometry of the magnetic NPs at 300 and 10 K. (A) Iron oxidenanoparticles. The room-temperature data are plotted in blue and thedata obtained at 10 K in red. (B) SQUID data of the cobalt iron oxidenanoparticles. Room-temperature data are shown in pink and dataobtained at 10 K in blue. The inset in both plots shows an enlargedregion at zero applied field. Reprinted from ref 135. Copyright 2007American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXJ

tions have indicated that the toxicity of metal NPs dependsstrongly on the chemical properties of the ligands/cappingagent attached to their surface along with their size, shape, dose,and charge. An analysis of clinical data available on AuNPsindicates a peculiar correlation of toxicity with their size, shape,and biocompatible coating.145,146,149,152,153 For the sameparticle size, capping of NPs with certain biocompatible ligandshas been found to have the least toxicity.152

In particular, DNA-functionalized Au nanostructures havebeen extensively explored for their various chemical andbiological applications.136,154−174 In this area a large numberof investigations have been carried out on the synthesis ofnanohybrids with control of their morphology and analysis oftheir characteristic optical properties (surface plasmonabsorption), melting temperature (Tm), and surface-enhancedRaman scattering. The organization of different noble NPs withcontrol of their interparticle distance also remains a challengefor applications in nanotechnology. Because of their largefunctionality and biocompatibility, they are important forbiomedical applications.2.2.2.1. DNA−Au. Recently, a new DNA-encoding scheme

for the precise controlled synthesis of Au−DNA nanomaterialsof varied novel shapes has been reported.156 Different DNAsequences, such as oligo-dA30 (A30), oligo-dT30 (T30), oligo-dC30 (C30), or oligo-dG20 (G20), were added to a solutioncontaining a gold nanoprism, hydroxylamine (NH2OH), andhydrogen tertrachloroaurate(III) (HAuCl4). The morphologiesof the resulting NPs were found to be varied with differentDNA sequences. The sequences A30, T30, C30, and G20 yieldedround nanoplates with a rough surface, six-pointed nanostars,round plates with a smooth surface, and hexagonal nanoplates,respectively. These authors have found that the morphologiesof the resulting nanostructures are independent of the lengthsof the nucleotides, and therefore, it was concluded that it is thesequence and not the length of the DNA that dictates themorphologies of the NPs.Zhang et al.157 used a self-assembled 2D DNA nanogrid as a

template consisting of short ssDNA oligonucleotides of an A15base sequence, which hybridize with 5 nm gold NPsfunctionalized with an oligo-T15 sequence to yield a periodicsquare lattice. Each gold NP sits only on a single DNA tile inwhich the center-to-center interparticle spacing betweenneighboring particles could be controlled to nearly 38 nm inlinear repeat and 25−27 nm in diagonal repeat, indicating theabsence of a AuNP at the center of each possible square (Figure12). This peculiar organization is understood to arise due to thestrong electrostatic repulsion between highly negatively chargedsurfaces of nearby AuNPs. Such a system may be explored togenerate more complex NP patterns through self-assembly,which may find applications in the fabrication of nanoelectronicand nanophotonic devices.Nanotubes of various 3D nanostructures have been designed

by the modification of single-stranded DNA by gold NPs ofdifferent sizes, which provided 3D architectures of differentshapes ranging from stacked rings to a single spiral, doublespirals, and nested spirals with different distributions of the tubeconformation.158 For AuNPs of 5 nm, stacked ring and singlespiral tubes were observed to form at 55% and 45%,respectively, which changed to 92% and 7% for AuNPs of10−15 nm size. By engineering the DNA tile structures, itcould thus become possible to add different sizes and types ofNPs inside or outside the tube, which may substantially advancethe production of nanodevices.

The DNA-directed self-assembly of gold NPs into binary andternary nanostructures has been performed using twostrategies.159 In the first strategy, gold particles were function-alized with alkanethiol-capped ssDNA and then hybridizationwas carried out with complementary ssDNA-labeled NPs. Inthis approach, each Au nanoparticle may become attached tomany such particles, thereby leading to extensive aggregation asshown in Figure 13 C. However, the second approach involvedhybridization between complementary alkanethiol-cappedoligonucleotides with dsDNA containing a thiol group attachedat the end first followed by attachment of a AuNP to thescaffolding through a gold−sulfur bond to give a binary particleassembly (Figure 13 E). TEM and UV−vis studies suggest thatthe size of the assemblies did not change significantly uponmodification with an oligonucleotide. By using a similarapproach, AuNP trimers could also be synthesized.Kim and Lee160 described a simple method for the reversible

assembly of DNA−Au nanoclusters in an aqueous mediumusing dithiothreitol (DTT) and monothiol DNA as stabilizersby exploiting the cross-linking of DTT with Au due to stronggold−sulfur bond formation. The hydrodynamic diameter ofthese particles could be easily controlled by adjusting thestoichiometry of DTT and DNA, and the solutions of theAuNP nanoclusters showed varied colors ranging from purple(42 nm) to violet (49 nm) and blue (115 nm) due to theirsurface plasmon resonance (SPR) (Figure 14). In the absenceof DTT, the SPR of DNA−AuNPs alone exhibits a red color(∼520 nm) and indicates the hydrodynamic diameter is 35 nm.These nanoassemblies upon heating dehybridize in a highlycooperative manner, exhibiting an extremely sharp meltingtemperature. Above the melting temperature the color of thesample turned back to red (47 °C), purple (48.9 °C), violet

Figure 12. (A, B) Comparison of the AFM images before and aftergold NPs were assembled onto the DNA nanogrids. (C) Schematicdrawing of the assembly representing the scenarios if all sites areoccupied and the observed case. The expected distances are 25−27 nm(blue-to-blue-tile diagonal repeat) and 38 nm (blue-to-blue-tile linearrepeat). Reprinted from ref 157. Copyright 2006 American ChemicalSociety.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXK

(46.9 °C), and blue (48.9 °C) depending on the size of theclusters. The reversible optical behavior suggested these clustersto be fairly stable after melting at high temperature (>60 °C).This method provides a quantitative measurement of the targetDNA concentration from 1 to 50 nM with a detection limit of 1nM.

Different deoxynucleoside-modified AuNPs exhibit se-quence-dependent stability and also a significant change inthe surface plasmon band frequency and intensity. dA, dG, anddC caused the surface plasmon band due to the pure gold NPsto red shift from 520 to 650, 667, and 693 nm, respectively,whereas dT did not show any appreciable change in theintensity or the frequency of the absorption.161 Furthermore,the gold NP solution containing dA, dG, and dC precipitatedout after 4 h, whereas neither gold NPs alone nor the dT-containing AuNPs precipitated. The kinetics of the particleagglomeration indicated that the solution containing dC/dGagglomerated at the fastest rate followed by dA. Theseexperiments demonstrate that the binding of a deoxynucleotideto the gold NPs follows the order dC/dG > dA > dT. Thisindicates that the interaction between the oligonucleotide andNP surface is detected by a nuclear surface plasmon, whichaffects the nucleotide surface coverage. This shows that goldnanoparticles functionalized with 5S(T)x (5S = 5' thiol-modified oligonucleotide) exhibit enhanced stability towardthe electrolyte compared with NPs functionalized with theoligonucleotides 5S(A)x and 5S(C)x. Furthermore, an increasein the oligonucleotide length from 5 to 15 base pairs alsoenhanced the stability of gold NPs functionalized with 5S(T)xparticles compared to those functionalized with 5S(A)x or5S(C)x particles. The enhanced stability 5S(T)x found in theelectrolyte has been explained due to an increase in the surfacecoverage, which increased the surface charge and steric stability.These nanosystems have been suggested to have significantimportance in the designing of a DNA-modified gold probe forsensing purposes.In most of the study the detection of the target DNA

sequence was achieved by the hybridization of the ssDNA withcomplementary ssDNA-functionalized AuNPs (GNPs). Krpetic et al.162 have reported a new concept for the direct detection ofdsDNA using pyrole−imidazole polyamide (PA) functionalizedgold NPs (Figure 15). The method works on the basis of theselective recognition of the dsDNA sequence by PAs; the latter

Figure 13. (A) Illustration of strategy 1 to prepare binary assemblies. (B, C) TEM images of Au nanoparticle dimers synthesized by strategy 1. (D)Illustration of strategy 2 to prepare binary assemblies. (E) TEM images of Au nanoparticle dimers synthesized by strategy 2. Reprinted withpermission from ref 159. Copyright 2007 IOP Publishing.

Figure 14. (A) Scheme depicting reversible assembly and disassemblyof the DNA−AuNP cluster conjugates. (B) Normalized meltingtransitions of the assembled DNA−AuNPs (B1) and the assembledDNA−AuNP clusters with various sizes (B2, B3, B4). The insets showsolutions of unhybridized DNA−AuNPs and DNA−AuNP clusters(U), hybridized DNA−AuNPs and DNA−AuNP clusters (H), andredehybridized DNA−AuNPs and DNA−AuNP clusters after themelting experiments (M) for red, purple, violet, and blue. The meltingtemperatures (Tm) and fwhm’s were determined by the first derivativeof the melting transitions (see the insets). Reprinted from ref 160.Copyright 2009 American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXL

induce the controlled aggregation of the ssDNA-functionalizedGNPs in the presence of the target DNA. This aggregation wasevidenced by TEM. For 15 nm GNPs, aggregation followed byUV−vis spectroscopy exhibited a less intense red-shifted SPRband due to AuNPs. This method could be utilized for theselective recognition of unique and biologically relevant dsDNAsequences.Xu et al.163 have investigated the stability of ssDNA−GNPs

and citrate-protected GNPs against salt-induced aggregationusing a ζ probe and UV−vis spectroscopy. ζ potential values forall the GNPs were negative, but these values were higher for allthe ssDNA−GNPs compared to citrate-protected GNPs. Asimilar effect was noted on the values of the ζ potential uponincreasing the length of the oligonucleotide. In UV−visspectroscopy the addition of NaCl to GNPs caused theiraggregation as could be observed by a red-shifted plasmon bandof absorption due to Au and by a change in the color fromyellow-red to blue at all concentrations ≥50 mM NaCl, whereasfor dGNP and dG6−GNPs and dG12−GNPs the red shift andchange in the color could be observed only at concentrations≥400 mM NaCl. The higher salt tolerance of ssDNA−GNPssuggested their better stability and biological utilization withoutany further stabilization. Fluorescence measurement was carriedout to explain the presence of ssDNA on the surface of gold-functionalized DNA NPs. By employing fluorophore-labeledoligonucleotides, the intensity of 5- carboxyfluoroscein (FAM)labeled DNA was observed to increase by approximately 5-, 7-,and 10-fold after hybridization with dGMP−, dG6−, and dG12−GNPs, respectively, compared to bare FAM−DNA. Thefluorescence due to FAM−DNA was found to be moreprominently enhanced for dGNPs with increasing mers in theorder dGNP < dG6 < dG12 at 518 nm. Similarly, the energy ofthe ssDNA−GNP plasmon (529 nm) and FAM exciton (518nm) has been suggested to result in a resonance condition inthe hybrid complex of GNPs and FAM. Since the plasmonenergy is very similar to the exciton energy, the observedincrease in fluorescence intensity might have been induced bythe plasmon.2.2.2.2. DNA−Ag. The preparation of AgNPs, nanorods, and

nanowires on the surface of DNA could be directly achieved bythe reduction of the adsorbed Ag+ ions on its network.136,164 Ina classic work of Braun et al.,136 DNA-templated assembly of a

conducting silver nanowire was developed by the reduction ofsilver ion on silver ion-exchanged DNA. This wire regained thelost fluorescence image due to the DNA skeleton, and theelectric current is carried solely by the silver deposited on theDNA bridge (Figure 16). The recognition capabilities of DNA

identified in this work have also been explored to produce wiresin other studies. In another report the dimensions andmorphology of silver NPs were determined by the diameterof the pores on the DNA network.164 At relatively lowerconcentration of DNA (∼50 ng/μL), AgNPs were formed ontDNA with a size distribution of about 6.79 ± 0.61 nm. Whenthe concentration of DNA was increased to 100 and 150 ng/μL, the diameter of the pores was observed to decrease from 19to about 12 nm, which changed the morphology of thesenanostructures to nanorods and nanowires, respectively. Thus,an increase in [DNA] was observed to reduce the diameter ofthe pores. Such control of the morphology of these

Figure 15. (a) Sequence of PA 1. (b) Scheme of PA 1- and ssDNA-functionalized GNPs and their subsequent aggregation upon addition of DNAmatching sequences (oligodeoxynucleotides, ODNs). (c) Aggregation of the PA−GNPs in the presence of DNA-functionalized GNPs followed byUV−vis spectroscopy (scanning kinetics at 10 °C) upon addition of the fully matched target DNA sequence ODN1 over 120 min for 15 nm GNPs.Reprinted from ref 162. Copyright 2012 American Chemical Society.

Figure 16. Experimentally observed I−V curves. (a) Two terminal I−V curves of the silver wire. Arrows indicate the voltage scan direction.The two curves in each direction present repeated measurements, thusdemonstrating the stability of a given wire. Note the differentasymmetries pertaining to the two scan directions. (b) I−V curves of adifferent silver wire in which the silver growth was more extensive thanin (a). Extensive growth resulted in a narrower current plateau (solidcurve), on the order of 0.5 V, and a lower differential resistance (7 MΩversus 30 MΩ in (a)). By applying 50 V to the wire, the plateau hasbeen permanently eliminated to give an ohmic behavior (dashed−dotted line) over the whole measurement range. I−V curves of a DNAbridge with no silver deposition and silver deposition without a DNAbridge are depicted in the bottom and top insets, respectively. In bothcases, the sample is insulating. Reprinted with permission from ref 136.Copyright 1998 Nature Publishing Group.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXM

nanostructures has been suggested to find applications innanoelectronics.The optical properties of Ag nanocrystals were controlled by

binding them with a DNA template,165 which upon reductionby NaBH4 produced Ag bound to different mers ofoligonucleotide. Time-dependent formations of clusters rangingin size from Ag1− to Ag4−oligonucleotide were observed withcharacteristic absorption and fluorescence spectral features(Figure 17). The chemical shift in NMR spectra indicated thebase-specific interaction.Gwinn et al.166 have reported the fluorescence properties of

few-atom Ag nanoclusters attached to ssDNA by employing asequence of 19-base DNA oligomers, viz., complementary Cand G strands and 7 base pair stem hairpin oligomers having 5-base A, T, G, and C loops attached to Ag nanoclusters (Scheme7). Both the G and C strands produced brightly visible

fluorescence having λem = 573.6 ± 0.1 nm with λex = 509.2 ±0.6 nm and λem = 647.6 ± 2.4 nm with λex = 572.2 ± 2.3 nm,respectively, whereas the duplex did not fluoresce. For DNAwith A, G, and C loops, fluorescence peaks centered at 534.9 ±2.8, 614 ± 2.6, and 646.3 ± 2.6 nm, respectively, were observed(Figure 18). The fluorescence intensity of the A loop wasalmost 10 times lower than that of the C and G loops, whereasthe T loop did not exhibit any fluorescence. The fluorescence

intensities of the C and G strands were roughly 3 and 5 timeshigher than those of the C and G loop hairpins, respectively,and have been ascribed to the geometrical restriction imposedby the hairpin loop, which makes it difficult for Ag to beincorporated. These findings suggest the fluorescence charac-teristics of few-atom Ag−ssDNA nanohybrids are susceptible tothe sequence and secondary structure of the bases comprisingthe strand.Sengupta et al.167 have made use of DNA as a scaffold for the

synthesis of Agn nanoclusters (where n = 2−10) and observedsequence specificity involving cytosine and thymine inoligonucneotides. They also studied the influence of the basesand the base sequence on the formation of the blue/green-emitting Ag clusters using thymine-containing oligonucleotidesdT12, dT4C4T4, and dC4T4C4. dT12 showed a pH-dependentgreen emission peaking at 540 nm for λex = 350 nm with themaximum emission intensity for a DNA:Ag stoichiometry of

Figure 17. Fluorescence emission spectra of the silver nanoclusters bound to the oligonucleotide. For these spectra, [oligonucleotide] = 10 μM,[Ag+] = 60 μM, and [BH4

−] = 60 μM. In the left panel, a series of emission spectra were acquired using 240, 260, 280, and 300 nm excitation. Abroad emission band is observed between 400 and 550 nm, and a peak is observed at 632 nm. In the right panel, excitation at 540, 560, and 580 nmresults in emission bands with maxima at 629, 638, and 642 nm, respectively. Reprinted from ref 165. Copyright 2004 American Chemical Society.

Scheme 7. Cartoons of the 19-Base DNA Oligomers Used inThis Worka

aKey: blue, cytosine (C); green, thymine (T); red, guanine (G);yellow, adenine (A). Black dots represent base pairing and solid linesthe sugar−phosphate backbone. Top: the C-strand and G-strand formthe duplex when annealed together. Bottom: hairpin C, G, T, and Aloops. Reprinted with permission from ref 166. Copyright 2008 Wiley.

Figure 18. Contour maps of fluorescence from DNA−Ag solutions:(a) C strand, (b) G strand, (c) C loop, (d) G loop. The black contourlies at half the maximum intensity. Upper legend: contour interval andpeak intensity. Lower legend: wavelengths of the primary peak, derivedfrom three independent data sets. Shaded regions along λex = λem:scattered light prevents detection of fluorescence. Reprinted withpermission from ref 166. Copyright 2008 Wiley.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXN

2:1 (Figure 19). At the midpoint, the green emission observedat 540 nm showed dependence on the pH. The intensity of this

band could be enhanced by 100-fold by a variation in pH from8 to 11 with a midpoint at pH 9.3, which is almost similar tothe pKa (9.7) corresponding to N3 of the thymine base. For thedT4C4T4−Ag cluster the fluorescence peak was noted at 475nm with λex = 370 nm, similar to the trend observed with dT12.Among these bases, the sequences and the concentration ofdC4T4C4 were found to influence the fluorescence properties ofthe cluster. The higher concentrations favor a red-emittingspecies and interestingly the lower concentrations a blue/green-emitting cluster.

Synthesis of DNA-origami-directed self-assembly of silverNPs has been reported using the bottom-up approach.168 Inthis work a well-ordered AgNP architecture on self-assembledDNA origami structures of triangular shape were obtainedusing 20 nm AgNPs conjugated with chimeric phosphor-othioated DNA (9ps-T15) strands as building blocks. The ninesulfur atoms on the ps domain of the DNA backbone providethe DNA strand with high affinity for the surface of AgNPs.Different AgNPs and Ag−Au hybrid architectures were thenassembled with the required number of staple strands mixedwith three, six, or nine capture strands, each of which has asingle-stranded overhang of approximately 15 bases that iscomplementary to the DNA sequence on the AgNP surface.The center-to-center distance between adjacent AgNPs couldbe precisely controlled from 94 to 29 nm (Figure 20). Suchcontrol of the spatial distance of AgNPs is suggested to havesignificant potential in photonic applications.Park et al.169 have synthesized polyvalent plasmonic DNA−

Ag hybrids using silver nanocubes and thiol-modified DNAsequences. These DNA−Ag conjugates exhibited reversibleassembly properties similar to those of the usual DNA−AuNPs.The bare AgNCs exhibit an SPR band at 426 nm whichbecomes slightly blue-shifted after conjugation with DNA dueto the change in the morphology of the AgNCs fromnanocubes to truncated. The authors have used this systemto detect the target DNA concentration at 1 nM, and it couldfind applications in diagnostics for detecting target DNAstrands.In a simple approach, detection of DNA hybridization has

been sensed by Au islands deposited on a glass slide byemploying transmission surface plasmon resonance spectros-copy.170 ssDNA was self-assembled onto Au nanoislands on aglass slide with the subsequent introduction of mercaptohex-anol as a spacer molecule and then hybridized by comple-mentary DNA functionalized by Au/AgNPs. From the densityof the gold and silver NPs (approximately 400 particles in 1μm2 in both the cases), the detection limit of DNA

Figure 19. Composite fluorescence spectrum of 15 μM dT12 with 90μM Ag+ and 90 μM BH4

− in a pH 10.5 buffer. The emissionwavelengths are on the bottom axis, and the excitation wavelengths areincremented by 20 nm on the right axis. The spectra were acquired 16h after addition of BH4

−. The inset excitation spectrum was acquiredusing λem = 540 nm. The excitation maximum is 350 nm, and weakertransitions are observed at 295 and ∼420 nm. Reprinted from ref 167.Copyright 2008 American Chemical Society.

Figure 20. Left: illustration of individual designs I−IV with different center-to-center distances. Middle: in the first four columns are enlarged TEMimages of individual structures after negative staining of the samples with uranyl formate. The shape of the triangular DNA origami can be clearlyseen; the dark balls are the AgNPs. The fifth column shows STEM images of the samples without staining. Again, the shape of the triangular DNAorigami is clearly visible; the AgNPs appear as bright spots. Scale bars = 100 nm. Right: yield distribution of the formed structures. Reprinted withpermission from ref 168. Copyright 2010 Wiley.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXO

hybridization has been estimated to be 4 × 107 oligonucleo-tides.2.2.2.3. DNA−Ag/Au. DNA-modified Ag/Au171 and Au/

Ag172 core−shell nanosystems have also been developed. Ag/Au-modified DNA has made use of the plasmonic character-istics of silver. The excitonic coefficient of the surface plasmonresonance of Ag is 4 times larger than that of Au, which couldbe utilized to tailor the optical properties and could be exploredfor SPR and surface-enhanced Raman scattering (SERS)detection systems. The monolayer shell on the gold NPs hasbeen functionalized with an oligonucleotide to produce goldoligonucleotide conjugates (Figure 21). In another approach,

gold NPs are used as the core and silver particles are employedas the shell, which provides high stability to Au/Ag core−shellNPs (Scheme 8). These particles exhibit silver-shell-thickness-based optical properties, which are distinctively different fromthose of a Ag and Au mixture or Ag/Au alloy.Lim and co-workers173 have developed plasmonic DNA-

tethered heterodimeric gold−silver core−shell Raman-activenanodumbbells for imaging and sensing applications. TheAuNPs used as the probe for their fabrication were modifiedwith two different DNA sequences, a protecting sequence (5′-CACGCGTTTCTCAAA-PEG18-A10-(CH2)3-SH-3′) and a tar-get-capturing sequence (5′-TAACAATAATCCCTC-PEG18-A10-(CH2)3-SH-3′), preconjugated with Raman-active dye(Cy3) so that the dye could be located at the junction of thesingle-DNA interconnected probes. Upon target DNA hybrid-ization, this produces single-DNA-tethered AuNP hetero-

dimers. Nanosized silver shells of varied thickness were thengrown using 1% poly(N-vinyl-2-pyrrolidine) as the stabilizerand sodium ascorbate as the reductant for differentconcentrations of silver as could be observed by thecharacteristic surface plasmon resonance band at 400 nm.AFM-correlated Raman measurement demonstrated that thecharacteristic Raman peaks for Cy3-modified oligonucleotidesobserved at 1470 and 1580 cm−1 were enhanced by a factor ofabout 2.7 × 1012 using Au/Ag core−shell nanodumbbells with a5 nm Ag shell, which is large enough for single-moleculedetection.In an interesting work, Lee et al.174 have carried out the

directional assembly of Ag−Au bimetallic nanostructures withDNA which were found to have a strong salt concentrationdependent on the reaction kinetics by using DNA−AuNPs asthe seed and Ag−PVP complexes. At high salt concentrationsalt passivates DNA−AuNPs by uniformly distributing itselfaround the gold NP surface, which makes it difficult for theAg−PVP complex to penetrate through the salt. In contrast, ata low concentration of salt a relatively less uniform DNAstructure is formed at the surface of the gold NPs, which allowsAg−PVP to interact through a certain direction to approach thegold NP surface readily. The Ag center acts as a nucleation sitefor the deposition of more Ag−PVP complex, resulting in afaster and directional growth at the silver nanostructure on thegold NP surface as is evidenced by HR-TEM images of theparticles under different experimental conditions. This growthwas also evidenced by UV−vis spectroscopy, which demon-strates a change in the SPR band, a spherical shape at high saltconcentration and a rod (dimeric shape) at lower saltconcentration.Timper et al.175 developed a novel strategy for the

construction of conducting nanowires by designing a bifunc-tional DNA template consisting of a 300 base pairimmobilization sequence and a 900 base pair metallizationsequence. The alkyne-functionalized immobilization DNAsequence was covalently linked to azide-functionalized Sisurfaces using click chemistry through copper-catalyzedalkyne−azide cycloaddition (CuAAC), while the long metal-lization sequences contained diol-modified nucleobases. Thediol groups on the DNA sequence were cleaved into mono- anddialdehyde groups using periodate, which then reduced the Ag+

into Ag0 in a Tollens reaction along the DNA wire. These Ag0

nucleation sites act as seeds for subsequent deposition of gold.These DNA wires exhibited ohmic behavior depicting themetallic conductivity, for which the resistivity varied from 2.3 ×10−5 to 11.3 × 10−5 Ω m. This method presents a promising

Figure 21. (A) TEM image of Ag/Au core−shell nanoparticles. (B)Energy-dispersive X-ray (EDX) spectra of Ag core particles (dottedline) and Ag/Au core−shell particles (solid line). L and M signifyelectron transitions into the L and M shells of the atoms, respectively,from higher states. (C) UV−vis spectra of the Ag core (dotted line)and Ag/Au core−shell (solid line). The inset shows the calculatedextinction spectra of Ag particles (dotted line) and Ag/Au core−shellparticles (solid line). (D) Thermal denaturization curve of aggregatesformed from hybridized oligonucleotide-modified Ag/Au core−shellparticles in buffer solution (0.3 M NaCl and 10 mM phosphate buffer,pH 7). The inset shows the UV−vis spectra of dispersedoligonucleotide-modified Ag/Au core−shell particles (solid line) andaggregated oligonucleotide-modified Ag/Au core−shell particlesformed via hybridization (dotted line). Reprinted from ref 171.Copyright 2001 American Chemical Society.

Scheme 8. Schematic Illustration of the Synthesis of DNA-Embedded Au/Ag Core−Shell Nanoparticlesa

aReprinted with permission from ref 172. Copyright 2008 RoyalSociety of Chemistry.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXP

approach for the construction of DNA template nanoelectroniccircuitry.

3. RNA-MEDIATED NANOSYSTEMS

Similar to DNA nanotechnology, three-dimensional nano-objects made of RNA have also been synthesized using thesupramolecular strategy,176,177 but RNA-templated systems aresomewhat different from their DNA counterparts;178−180 forexample, RNA-mediated nanostructures generally harness theproperties of noncanonical secondary and tertiary structuralelements or motifs which are specific for many biological RNAsand less for DNA. RNA motifs are known to fold into relativelyrigid and spatially well-defined nanoarchitectures. Due to thenegative charge on RNA, different metal ions may influence itsthree-dimensional architecture significantly in regard to foldingand stabilization.181 Moreover, differing binding strengths andstabilities of a number of alkaline-earth and d-block cations onthe RNA strand have been observed.182

The strategy for designing programmable 3D nanoscalescaffolds of RNA with different shapes, sizes, and compositionsthrough self-assembly has been reported.179 By using tRNAmolecules as building blocks, the polyhedral architecture hasbeen synthesized.180 These nanoscaffolds could be function-alized through the modification of the core strand(s), whichmay prove their vast utility in biomedical applications.Moreover, owing to its single-stranded-ness, RNA is consideredto be superior to DNA for use in intracellular applications.183

3.1. RNA-Templated Semiconductor Nanostructures

RNA has been considered to be an important template as it canproduce sequence- and structure-dependent sizes and shapes ofinorganic NPs.90,184 Recently, a mixture of RNA sequences hasalso been employed to mediate the synthesis of semiconductingNPs.80,185−188,190−192 The experimental conditions of pH,concentration(s) of the biomolecule, and environment seemto play an important role in controlling their growth,morphology, and physicochemical properties.3.1.1. RNA−CdS. RNA has been reported to act as an

effective template for the synthesis of quantized CdS NPs.184

Structured (wild-type, WT) tRNA yielded a single producthaving a compact structure with a hydrodynamic diameter ofabout 6 nm, whereas its unstructured mutant yielded a broaderproduct size distribution ranging from 7 to 11.5 nm. Both WTtRNA and mutated (MT) tRNA stabilized CdS producedspherical particles (Figure 22)7 with average diameters of 4.4 ±0.4 and 5.5 ± 1.0 nm, respectively, as recorded by high-

resolution TEM. The mobilities of WT and MT tRNA werestrikingly different as observed with gel filtration chromatog-raphy. However, extensive structural characterization of thesematerials was not carried out.RNA from torula yeast containing a mixture of RNA

sequences has also been reported to serve as an effectivetemplate for the synthesis of fluorescing water-solublequantized CdS NPs and mediates their growth to createnovel assemblies.185 Chelation of Cd2+ with RNA restricts thenucleation of CdS. Their aging results in increased networkingthrough supramolecular interactions in the process of self-assembly (Figure 23). Unlike DNA-stabilized particles in anaqueous medium, these particles display a prominent excitonicband at 380 nm and a relatively strong emission band (Φem =0.02) at 2.34 eV. Aging of these particles further enhances theiremission efficiency by more than 2.5-fold with a blue shift inthe emission band to 2.39 eV.

3.1.2. RNA−PbS. The multifuctionality of RNA has beenexploited for the designing of nanomaterials with tailoredoptical and electronic properties of IV−VI semiconductingNPs.80,186 Kumar and Jakhmola80 have synthesized RNA-mediated red fluorescing quantized PbS (∼5 nm) having a face-centered cubic structure. These particles displayed prominentexcitonic peaks at 350 and 570 nm and a strong narrowfluorescence band exhibiting an emission maximum in thevisible range at 675 nm with an emission quantum yield of<1%, which, however, upon aging is enhanced significantly to5.1 ± 0.1%. Under specific experimental conditions, for atypical molar ratio of Pb/S = 2, the addition of excess Zn2+ (2 ×10−3 mol dm−3) results in 1D growth of RNA-mediated PbSQDs to form nanofibers via several metastable self-assembledsupernanostructures (Figure 24). The nanofibers producedupon aging displayed a narrow emission band with an emissionquantum yield of about 12 ± 0.1%.186 Zn2+ passivates thesurface of RNA-templated PbS by binding to the specific sitesof RNA through PO2

− and purine bases (Scheme 9) andcontrols the dynamics of the charge carriers, electronicproperties, and growth of PbS in the nanocomposite. Thesechanges are also associated with a drastic increase in thefluorescence lifetime from 0.06 to 0.27 μs upon aging. Themultifunctionality of the RNA contributes to the observedelectronic properties in a cooperative manner as wasdetermined by using its different components individuallyunder identical conditions (vide infra). These studiesdemonstrate a correlation between the morphology of thenanostructures and their electronic properties.

3.1.3. RNA−PbSe. Recently, a novel one-step method hasbeen reported for the synthesis of RNA-mediated fluorescingquantized PbSe nanostructures in aqueous media.187 Self-assembly of QDs produced in the fresh sample results in theformation of a nanotubular structure (Figure 25). Binding ofRNA to the surface of PbSe prevents its growth andaggregation to produce monodispersed red fluorescing QDswith fcc structure. The excess Pb2+ present on the RNA strandinduces polarization in the QDs to enhance supramolecularinteractions among different building blocks, which over aperiod of a few days self-assemble into entangled nanotubes.These particles display an onset of absorption in the NIR rangeat about 1208 nm (0.97 eV) and weak excitonic bands in thevisible region at 320, 405, and 670 nm.188 The excitation offresh particles by 670 nm light results in dual fluorescence inthe red and NIR regions peaking (range) at 770 nm (690−850nm) and 1000 nm (850−1150 nm), with quantum efficiencies

Figure 22. Transfer RNA as a template for CdS quantum dotformation. Reprinted with permission from ref 7. Copyright 2008Royal Society of Chemistry.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXQ

(Φfl) of about 0.018 and 0.27, respectively. Freshly preparedcolloidal PbSe in the visible and NIR ranges is observed to havefairly long lifetimes of 320 and 31.8 ns, respectively, unlike theorganic dyes (<1.5 ns)189 emitting in this range. A poorabsorption in the NIR range along with a fairly intensefluorescence in the wavelength range of 850−1150 nm makesthese particles highly suitable for fluorescence imaging of bodyfluids and tissues in the NIR region (where tissue does notabsorb), medicine, and extending the sensitization range tolonger wavelengths.

Recently, certain metal ions have been found to bringmorphological changes in RNA-mediated PbSe nanostruc-tures.190,191 The addition of Mg2+ introduces new supra-molecular interactions among RNA-mediated PbSe, Pb2+, andMg2+, bringing a change in the morphology of PbSe to produceporous nanostructures compared to PbSe QDs produced in itsabsence along with a significant change in the opticalproperties.190 These particles display an onset of absorptionat 1.03 eV and dual fluorescence in both the red region andNIR range (700−1150 nm) peaking at 750 and 970 nm,

Figure 23. 3D AFM images of CdS having a Cd/S molar ratio of 4: fresh (A), aged for 2 months (B). FESEM images of CdS having a Cd/S molarratio of 4: distribution of Cd (C) and S (D) along the wire. Reprinted from ref 185. Copyright 2008 American Chemical Society.

Figure 24. TEM micrographs exhibiting a change in the morphology of PbS particles as a function of added [Zn2+] (10−3 mol dm−3) [0 (a), 0.5 (b),1.0 (c), and 2.0 (d)] and upon aging them for 20 (e) and 40 (f) days. Reprinted from ref 186. Copyright 2007 American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXR

respectively. The quantum efficiencies of fluorescence in thered and NIR regions are observed to be 0.02 and 0.38,respectively. The increased oscillator strength of PbSe in thissystem enhanced the absorption coefficient in both the visibleand NIR ranges compared to that of PbSe obtained in theabsence of Mg2+. The confinement of PbSe in the porousnanostructures induces nonradiative relaxation populating theshallow traps, resulting in the blue-shifted fluorescenceassociated with a reduction in the intensity and fluorescencelifetime. The dual fluorescence observed in the red and NIRranges has fairly long lifetimes of 204 and 24 ns, respectively.In the presence of Pb2+, Zn2+ ions induce intramolecular

folding of RNA in RNA-mediated PbSe to produce porousZn2+/PbSe building blocks, which self-assemble to form ahoneycomb-like structure encapsulating Q-PbSe confined inthe pores through intermolecular interactions (Figure 26).191

These nanostructures also exhibit dual fluorescence in the redand NIR regions at 806 nm (Φf = 0.01) and 1050 nm (Φf =0.5), respectively. CD and IR analysis reveals that Zn2+ inducesthe folding of RNA in the RNA-templated Zn2+/PbSe, possiblyinvolving the transformation from its B form to its A form.These morphological changes produce new channels to

create additional surface states in PbSe involved in radiative andnonradiative transitions responsible for the observed opticalabsorption and emission behavior in the visible and NIR ranges.An increase in the porosity with an enhanced NIR absorptioncoefficient and fluorescence in the wavelength range of 900−1150 nm suggests the use of these materials in the areas ofsensing, biomedical and clinical applications, and fluorescenceimaging of tissues and the incorporation of dyes to enhancetheir light-harvesting capability.

3.1.4. RNA−CdS/ZnS. RNA has also been utilized tofabricate novel tubular nanostructures through self-organizationin a colloidal CdS/ZnS semiconducting system.192 Supra-molecular interactions of various functionalities of RNA with

Scheme 9. Structures Depicting Interaction of Zn2+ with RNA (A) and Structure of an Aged Zn/PbS Nanostructure on an RNAMatrix with a High Zinc Concentration (B)a

aReprinted from ref 186. Copyright 2007 American Chemical Society.

Figure 25. TEM micrographs of RNA-mediated PbSe (containing[RNA] = 0.022 g/100 mL, Pb/Se molar ratio 2 at pH 8.5) (SP1):fresh (2a), aged (2a′). 2D and 3D AFM images of SP1: fresh (2b, 2c),aged (2b′, 2c′). Reprinted with permission from ref 187. Copyright2011 Royal Society of Chemistry.

Figure 26. AFM (left) and FESEM (right) images of aged Zn2+/PbSe(containing [RNA] = 0.022 g/100 mL, [Zn2+] = 10 × 10−5 mol dm−3,[Pb2+] = 3 × 10−4 mol dm−3, and [HSe−] = 1.5 × 10−4 mol dm−3 atpH 8.5) (SP1). Reprinted from ref 191. Copyright 2013 AmericanChemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXS

CdS, ZnS, and Zn2+ ions are used in this bottom-up synthesisto yield a thermodynamically stable arrangement. The presenceof excess Zn2+ induces spontaneous folding of thesenanostructures, which subsequently assemble into a tubularmorphology (Figure 27). This system exhibited an onset ofabsorption at 400 nm and an emission maximum at 509 nm.The formation of nanotubes is suggested to take place viaspecific interactions among different moieties/functionalgroups of the RNA template with CdS and ZnS attached onthe folded RNA on different sides. Linking then takes placethrough van der Waals and hydrogen-bonding interactionsinvolving nucleic bases and Cd(OH)2 to construct the tubularstructure. The optical spectrum of the nanotubes exhibits ahigher absorption coefficient for the excitonic peak, and thefluorescence band becomes about 4 times more intense,accompanied by an increase in the emission lifetime by afactor of about 1.7. This enhancement in optical properties canbe assigned to the 2D confinement of charge carriers along thenanotube, which would lead to an increase in the density ofstates in the conduction and valence bands compared to thoseof spherical QDs. These morphological and structural changesalso affect the optical, fluorescence, and anisotropic propertiesof these nanostructures.

3.1.5. RNA−Iron Oxide. The selected RNA sequences havebeen observed to initiate the formation of spherical iron oxideNPs in the presence of a small amount of Co2+ at neutral pHusing the iterative cycle of RNA selection and amplification193

(Figure 28). The RNA sequences upon incubation with FeCl2in the presence of CoCl2 were able to convert the Fe2+ intocrystalline magnetite−maghemite NPs at neutral pH and roomtemperature. A direct role of RNA in inducing ferrihydritecondensation and oxolation is suggested.

3.2. RNA-Templated Metal Nanostructures

Taking into consideration the propensity of RNA to fold into3D structures, Gugliotti et al.90 in a seminal study havediscovered the RNA sequences from a library of about 1014

unique RNA sequences that can catalyze and stabilize theformation of hexagonal PdNPs of micrometer size. The RNAsequences used were modified at the UTP nucleotide with 4-pyridylmethyl, which imparts additional coordination sites formetal binding. These strands were incubated with themetal complex tris(dibenzylideneacetone)dipalladium(0)[Pd2(DBA)3] in an aqueous medium. Eight selection cycleswere performed, which results in the formation of mainlyhexagonal PdNPs.

Figure 27. Three-dimensional AFM image of an isolated nanotube (A). Inset: histogram of the surface roughness distribution of the nanotube. TEMimage of a colloidal system depicting the formation of a network of nanotubes (B). Inset: selected area electron diffraction (SAED) of the nanotubes.Schematic representation of the formation of the nanotubes (C). Reprinted with permission from ref 192. Copyright 2009 Royal Society ofChemistry.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXT

Biomolecule sensing is becoming increasingly importantfrom both medicinal and chemical application points of view. Inthis regard, the applications of Au- and Ag-like metals and theirconjugates with RNA have been explored extensively (vide utsupra).3.2.1. RNA−Au. AuNPs modified with RNA-conjugated

fluorescent dye have been used for the detection of specificsequences of DNA and various RNA nucleases. The uniqueproperty of RNase H for cleaving the RNA phosphodiesterbonds without digesting DNA or ssDNA/RNA when it iscontained in an RNA−DNA heteroduplex has beenexploited.194 Using this approach, complementary target

DNA could be detected at 10 pM with a signal-to-noise ratio(S/N) of 1.8 (Figure 29).DNA and RNA detection in target molecules such as

hepatitis A virus, hepatitis B virus, HIV virus, Ebola virus,variola virus, and Bacillus anthracis has been performed usingRaman-labeled dyes and oligonucleotide-modified AuNPs asprobes.195 The AuNPs facilitated the formation of Ag coatingthat acts as an SERS-enhancing promoter for the dye, theintensity of which was followed by two peaks, 1650 cm−1 forthe tetramethylrhodamine (TMR) labeled probe and 1588cm−1 for the Cy3-labeled probe. The detection limit of thismethod was estimated at about 20 fM.

4. NUCLEOTIDE- AND NUCLEOBASE-TEMPLATEDNANOSTRUCTURES

For the detailed understanding of the mechanism ofstabilization of semiconductors and metals by nucleic acids, itwill be useful to understand how different components ofnucleic acids, namely, nucleotides, nucleosides, and nucleobasescontribute to the stabilization of different inorganic NPs.Knowledge of the stabilization of nucleotide- and nucleoside-mediated semiconductor/metal nanostructures and an analysisof their interactions will be helpful in elucidating thecontribution of various components/functionalities of biopol-ymers for the above-studied semiconductor/metal nanostruc-tures.

4.1. Nucleotide-Templated Semiconductors

Nucleotides are the building blocks of nucleic acids. Nucleotidetriphosphatesguanosine 5′-triphosphate (GTP), adenosine5′-triphosphate (ATP), cytidine 5′-triphosphate (CTP),thymidine 5′-triphosphate (TTP), and uridine 5′-triphosphate(UTP)play the central role in metabolism, whereasguanosine 5′-monophosphate (GMP), adenosine 5′-mono-

Figure 28. Illustration of the RNA in vitro selection cycle used todiscover sequences capable of mediating the formation of magneticnanoparticles. UTP* represents 5-(4-imidazolylmethyl)-UTP. RNAsand nanoparticles are not drawn to scale. Reprinted with permissionfrom ref 193. Copyright 2009 Royal Society of Chemistry.

Figure 29. Left: target DNA detection using RNase H. (a) Increasing the concentration of DNA with fixed GNP−RNA−dye and RNase Hconcentrations shows a detection limit of 10 pM. (b) Sequence specificity is displayed by fluorescence before (solid line) and after (dashed line)complementary DNA of 100 nM concentration is added. The inset shows similar conditions for before and after 100 nM noncomplementary DNAwas added to the GNP−RNA−dye and RNase H. Right: cartoon showing RNA−dye-modified GNPs for detecting DNA, RNase H, and RNase A.Due to the enzymatic digestion of the RNA portion of the conjugates by either RNase H or RNase A, fluorescein diffuses away from the GNPbeyond distances of efficient energy transfer, leading to a detectable fluorescent signal. The GNPs were modified with a 26-base RNA moleculecontaining a 59-hexylthiol and a 39-fluorescein. DNA is detected through hybridization to the RNA portion of the probes followed by RNase Hdigestion. RNase H can be detected by preforming an RNA−DNA heteroduplex and monitoring probe degradation. RNase A is detected using thesingle-stranded conjugates. Reprinted with permission from ref 194. Copyright 2007 Royal Society of Chemistry.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXU

phosphate (AMP), cytidine 5′-monophosphate (CMP),thymidine 5′-monophosphate (TMP), and uridine 5′-mono-phosphate (UMP) constitute the key components of DNA andRNA. It would be interesting to examine their efficiency towardstabilization and contribution to different optoelectronicproperties.4.1.1. Nucleotide Triphosphate (GTP, ATP, CTP, UTP)

Mediated Semiconducting Nanostructures. 4.1.1.1. GTP/ATP/CTP/UTP−CdS. 5′-Nucleotide triphosphates have beenshown to be effective ligands for stabilization to producefluorescing CdS NPs. Green and co-workers196 have used 5′-nucleotide triphosphates (GTP, ATP, TTP, and CTP) ascapping agents for the synthesis of CdS. The particles cappedby GTP, ATP, and TTP were water-soluble and exhibited aband edge absorption at 480 nm, whereas CTP-capped CdSparticles precipitated from the solution, suggesting CTP isunsuitable for stabilization of the particles. These particles wereproduced with a size ranging between 3 and 5 nm (averagediameter): (ATP−CdS) 3.99 nm ± 12%, (TTP−CdS) 4.44 nm± 14%, (GTP−CdS) 4.34 nm ± 27%. GTP- and TTP- cappedCdS exhibited band edge photoluminescence at 550 nm, whileATP-capped particles exhibited deep trap emission at 630 nm.A difference in the coordination of these moieties to theparticle surface has been suggested to contribute to theobserved characteristics.In another study, Dooley et al.79 have synthesized 5′-

nucleotide triphosphate (GTP, ATP, CTP, and UTP) stabilizedCdS at two different pHs, 7.0 and 10.0, and elucidated thespecific chemical functionalities involved in the synthesis ofthese emissive materials. The quantum efficiency of emission atpH 7.0 followed the order GTP (4.7%) > ATP (0.5%) > UTP(0.1%) > CTP (0.0%), whereas at pH 10.0 the order changedto ATP (6.9%) > UTP (6.1%) > GTP (3.6%) > CTP (3.5%).In this study guanosine diphosphate (GDP) was found todisplay properties very similar to those of GTP. GMP was,however, reported to be ineffective in regard to passivation,producing a marginally luminescent product. GTP having amaximum luminescing efficiency was observed to stabilize CdSNPs through N7 electrons of guanine primarily through theinteraction of N7 with the CdS surface, which was evidenced bythe use of 7-methylated GTP and inosine triphosphate (ITP),as the latter ligands yielded CdS with limited emissionefficiency comparable to that of ATP.4.1.1.2. GTP/ATP/CTP/UTP−PbS. Hinds et al.197 in other

study synthesized ATP-, CTP-, GTP-, and UTP-directed PbSNPs. Among these, only GTP produced water-soluble PbS NPshaving an average size of 4 nm. These particles exhibited theonset of absorption in the near-IR region, and the electronicspectrum did not exhibit any excitonic features. The excitationof these particles by 831 nm laser light exhibits poor NIRemission (Φem = 0.01−0.02) peaking at 1300 nm. The bindingof N7 of GTP influences the size of the NPs and itsluminescent properties, which was evidenced by the use of 7-methyl-GTP exhibiting blue-shifted emission and is understoodby a change in the binding mode of GTP. On the other hand,ITP and guanosine produced nonluminescing particles. Theexocylic N2 of GTP appears crucial for binding to the surface ofPbS, whereas phosphate participated in the growth of PbS bybinding Pb2+ from the solution initially, but it reverts to theunbound state after the addition of S2−, suggesting the primaryrole of phosphate is to bind to Pb2+ and N2 as a ligand for PbSnanocrystals (Figure 30). In the presence of ATP, CTP, and

UTP, the soluble particles were not the major product and PbSparticles were nonemissive.

AMP, GMP, CMP, and UMP and their mixtures have alsobeen employed to stabilize PbS NPs.80,186 None of these asindividuals or their mixture produced PbS with the opticalproperties recorded with RNA.186 These ligands exhibitednegligible emission in the wavelength range observed with theRNA−PbS system.

4.1.2. Nucleotide Monophosphate (GMP, AMP, UMP,CMP) Mediated Semiconducting Nanostructures.4.1.2.1. GMP/AMP/CMP/UMP−CdS. In recent studies, differentnucleotide monophosphates have been employed to mediatethe synthesis of CdS. Among these, GMP, AMP, and UMPwere able to stabilize CdS particles.198 In the case of GMP andAMP, the best conditions under which the strong excitonicabsorption and emission bands could be observed correspondto 0.015 g/100 mL nucleotide with an excess of 1 × 10−4 moldm−3 Cd2+ at pH 9.2. However, for UMP a relatively higherconcentration (0.025 g/100 mL) has to be employed. In thecase of CMP, it was not possible to stabilize CdS NPs even athigher or lower concentrations. A comparison of the opticalabsorption and emission spectra for GMP-, AMP-, and UMP-mediated CdS indicates a red shift of the excitonic absorptionand emission maxima along with a significant decrease in thefluorescence intensity and broadening of the fluorescence bandfor AMP and UMP as compared to that of GMP (Figure 31).Thus, it is GMP which effectively mediates the synthesis of

CdS. Its concentration-dependent change in optical andphotophysical properties suggests these particles are producedin the quantum-confined region. CdS is observed to bind

Figure 30. Effect of specific chemical functionalities present on GTPon PbS quantum dot synthesis: (A) luminescence spectra obtainedwhen GTP, G, ITP, and 7-CH3-GTP were used for PbS synthesis, (B)proposed roles of phosphate and base functionalities on GTP innanoparticle nucleation, growth, termination, stabilization, andpassivation. Reprinted from ref 197. Copyright 2006 AmericanChemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXV

through >CO, N7, and imidazole moieties of GMP andinfluence the vibrational frequencies due to imidazole,pyrimidine (N7), >CO, and the P−O-5′-sugar, unlike theinteraction with GTP, which was reported to take place throughN7 and PO2

2− (Scheme 10).The optical properties of CdS capped with GMP, AMP, and

UMP were markedly different compared to those of RNA−CdSas the latter system displayed blue-shifted electronic andemission bands. The aging of GMP-mediated Q-CdS for aboutthree months caused a change in its morphology from QDs tonanorods with an average length and diameter of 73 and 21 nm,respectively, and aspect ratio of 3.5 as was also evidenced by anincrease in fluorescence anisotropy from 0.05 to 0.25. Ananalysis of the relaxation kinetics of charge carriers showedthese particles to have an average lifetime of 48 ns, which,however, decreased upon aging to 43 ns.4.1.2.2. GMP−Iron Oxide. In a simple hydrothermal

dephosphorylation approach, Gao et al.199 have synthesizedhighly stable and water-soluble nucleotide-templated γ-Fe2O3NPs with an average diameter of 5 nm. The addition ofNa2CO3 to an FeSO4 solution containing GMP initiallyproduced FeCO3. FeCO3 then undergoes hydrothermaldecomposition to give Fe3O4 (FeO·Fe2O3), which uponprolonged heating (10 h) produces GMP-templated Fe2O3.

In the presence of GMP, the interfacial FeO component ofFe3O4 NPs reacts with the monophosphate group to form athin layer of water-soluble NaFePO4. These particles exhibitsuperparamagnetic behavior with magnetic responsiveness(18.2 emu g−1). The authors have also proposed a plausiblereaction mechanism for the synthesis of nucleotide-capped γ-Fe2O3 on the basis of an FTIR, XRD, and XPS study. Owing totheir stability, water dispersibility, affinity for surfaces, andsuperparamagnetic properties, these NPs could be utilized as invivo computed tomography (CT) contrast agents.5′-GMP-mediated β-FeOOH nanostructures of varied

morphology ranging from nanorods to porous nanostructuresvia the formation of spherical NPs have recently beenreported.200 Colloidal β-FeOOH NPs upon aging result inthe formation of a hydrogel associated with a change in pHinvolving supramolecular interactions (Figure 32). Interactionsof β-FeOOH through different functionalities of 5′-GMP,specifically involving N and P centers, are indicated by IRspectroscopy and also supported by XPS studies. The room-temperature superparamagnetic behavior of the hydrogel with amagnetization of 4.8 emu/g, a fairly high stability at about pH7, low toxicity, and biocompatibility suggests the potential ofthese nanostructures in biomedical applications.4.2. Nucleotide-Templated Metals: Nucleotide-TemplatedAu Nanostructures

Water-soluble nucleotide-capped gold NPs with tunable sizeranging from 2 to 5 nm having narrow monodispersity havebeen prepared.201 Among different nucleotides, the efficiency ofthe nucleotide in controlling the size and stability of AuNPswas found to follow the order ATP > CTP > GTP > TTP. Thesizes of the gold particles synthesized in the absence andpresence of ATP were found to be 7.85 ± 2.31 and 3.75 ± 0.60nm, respectively (Figure 33). The authors have also usedadenosines bearing different numbers of phosphate groups ascapping ligands, i.e., from ATP to ADP, AMP, and adenosine.However, with decreasing number of phosphate groups, moreaggregated and fused AuNPs were obtained. These nanoma-terials are suggested to act as novel building blocks forbioconjugation, nanodevices, biosensors, and biolabels.4.3. Nucleobase-Mediated Semiconducting Nanostructures

4.3.1. Purine/Adenine/Guanine−CdS. Purines being theimportant constituents of nucleotides, Kumar and Mital

Figure 31. Electronic and emission spectra of CdS mediated by GMP[fresh (red), aged (orange)], AMP (blue), and UMP (green) (λex =380 nm). Reprinted from ref 198. Copyright 2009 American ChemicalSociety.

Scheme 10. GMP-Templated CdSa

aReprinted from ref 198. Copyright 2009 American Chemical Society.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXW

synthesized cadmium sulfide capped with purine,202 adenine,203

6-(dimethylamino)purine (6-DMAP),204 and guanine. In theseinvestigations chelation of Cd2+ with the nucleic bases wasobserved to restrict the CdS nucleation and control thenanostructure size in a dynamic process. Additional substratebinds to the core structure through H-bonding (Scheme 11).The optimum conditions corresponded to an about 5 × 10−3

mol dm−3 concentration of substrates at pH 11.0.Under optimized conditions, purine-stabilized CdS NPs

(average diameter 5 nm) exhibited an excitonic band at 380 nm(3.26 eV) and a broad emission band peaking at 540 nm (2.30eV). The quantum efficiency of fluorescence due to theseparticles was observed to be 0.01.202 Under similarexperimental conditions in the presence of adenine, CdS

nanoclusters with an average diameter of 2.7 nm wereproduced. The excitonic absorption and emission maximadue to these particles are blue-shifted to 350 nm (3.54 eV) and530 nm (2.34 eV), respectively, compared to those of purine-capped particles. The quantum efficiency of emission of theseparticles is increased to 0.02. Capping of CdS by 6-DMAPcaused a further blue shift in the onset of the absorption andexcitonic (sharp) bands to 475 nm (2.61 eV) and 340 nm (3.65eV), respectively. These particles were relatively much smaller(average diameter 2 nm) having a narrow size distribution. Forthese particles the fluorescence band is now moved to stillhigher energy at 2.36 eV (525 nm), and the Φfl for theseparticles is now improved to about 0.03.204 The appearance of asharp excitonic peak in the optical absorption and band gapemission with a high quantum yield clearly indicate 6-DMAP tobe acting as a better capping agent compared to purine andadenine. In a control experiment adenosine was also observedto stabilize CdS particles with a poor excitonic absorption bandand a fairly broad emission peak at 420 and 560 nm,respectively. The intensity of adenosine-capped CdS wasabout 10 times smaller compared to that of adenine-mediatedCdS. Moreover, these particles were fairly unstable andcoagulated after a day. Other bases, such as guanine andguanosine, though stabilized CdS particles, but these particlesdid not exhibit any fluorescence.Purine in purine-capped Q-CdS becomes weakly bound

through Cd2+ attached to CdS with the N9 of purine, whereasthe protonated N7−H may bind another purine moleculethrough H-bonding. In these nanosystems the CdS particlesinteract via Cd(OH)2 with different functionalities of purinesthrough H-bonding (Scheme 11). In the case of adenine and 6-DMAP, this interaction occurs through the amino group as wasindicated by both IR and NMR spectroscopy, and thesecondary interaction with other adenine molecules takesplace through N9−H. The observation that guanine poorlystabilizes CdS despite the availability of the N9 proton andamino group has been understood by the poor complexingproperties of guanine to Cd2+ compared to those of adenine.Photocatalytic investigations indicate that the particles

stabilized by strongly bound molecules are not suitable toinitiate photocatalysis, whereas a weakly bound purine moleculechannelizes the charge carriers effectively to the bound solute.Thus, the nature of the surface capping agent was found to playan important role in controlling the photophysics andphotocatalytic properties.

4.3.2. Adenine−β-FeOOH. Capping by adenine provides asynthetic control to manipulate the size, morphology, andoptical and magnetization properties of β-FeOOH nanostruc-tures in an aqueous medium.205 An increasing concentration ofadenine brings a regular change in the morphology from

Figure 32. TEM image of aged GMP-mediated β-FeOOH (a). Magnetic hysteresis loops for 5′-GMP-mediated colloidal β-FeOOH NPs (black) andthe hydrogel (red) at 300 K (b). Gelation of GMP-mediated colloidal β-FeOOH with a change in pH (c). Reprinted with permission from ref 200.Copyright 2013 Royal Society of Chemistry.

Figure 33. (A) Representative TEM image of AuNPs prepared in theabsence of ATP. The average size is 7.85 ± 2.31 nm. (B, C)Representative TEM and HRTEM images, respectively, of ATP-capped AuNPs. The HAuCl4:ATP:NaBH4 molar ratio in thisexperiment is 1:1:16.7. The size of the ATP-capped AuNPs is 3.75± 0.60 nm. The insets in (A) and (B) are size distributions. The insetin (C) shows the fast Fourier transform (FFT) of the selected area.The discrete dots in the FFT pattern illustrate the crystalline nature ofthe as-prepared AuNPs. (D) UV−vis absorption spectra of AuNPsolutions prepared in the presence (capped) or absence (unprotected)of ATP. Reprinted with permission from ref 201. Copyright 2007Wiley.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXX

nanorods to spherical NPs. At higher [adenine] (>1 × 10−2 moldm−3), increasing numbers of spherical NPs encapsulating β-FeOOH with an average diameter of 2.5 nm in the core andadenine molecules in the shell are obtained. The higheststability with a ζ potential of ∼67 mV was observed for thesample containing 2 × 10−2 mol dm−3 adenine. Increasing[adenine] from 1 × 10−3 to 2 × 10−2 mol dm−3 in nanohybridsenhanced the saturation magnetization due to β-FeOOHgradually from 2.0 to 6.9 emu/g at 300 K and resulted in thereversal of the magnetic nature from superparamagnetic toferromagnetic at <80 K. A correlation between the morphologyand magnetic properties of these nanostructures has beenanalyzed.

4.4. Integrated Nanosystems

Hybrid nanostructures consisting of two or more nanoscaleinorganic components coupled together through biomoleculesmay benefit an enhancement of their properties arising fromthe synergy among different components due to increasedinteractions among them, the large common interface owing tosimilar dimensions, and the changed dynamics of the chargecarriers in irradiated systems. The interfacing of two or morethan two components (metal(s)/semiconductor(s)) withdifferent redox potentials of their energy levels may cause anefficient separation of charge to modify the photophysics of thecore semiconductor component.56,83,206−208 Such nanosystemsmay find a number of promising applications in photocatalysis,photophysics, and photonics. Some of the integrated systemsdemonstrating the morphological transition in the process ofself-assembly associated with the change in optical andmagnetic properties are presented below.4.4.1. DNA-Templated Au/Fe2O3 Nanostructures. A

novel method for the construction of a gold/iron oxidenanostructure chain scaffolded on DNA has recently beenreported using the electrostatic interaction between thenegatively charged backbone and positively charged NPs andhas been suggested to be cost-effective and promising for thedetection of disease through MRI.206 Each of the DNAtemplate NPs (Au/Fe2O3) was treated with EcoRI restrictionenzyme, which cut a specific sequence of DNA into shorterstrands. These short chains of NPs were then joined togetherby other T4 DNA ligase enzymes to produce the above referrednanostructure. These chains were able to increase the protonrelaxation time in solution compared to the individualprecursor NPs and were observed to be nontoxic in the cell.

4.4.2. Adenine-Templated Ag/CdS. This work makes useof the interaction of Ag metal with presynthesized adenine-templated CdS.83 Adenine serves as an effective matrix for thestabilization of Ag/CdS through interaction of N1, N3, and−NH2 with Ag. The amount of Ag in the nanohybrid isobserved to influence the organization of the Ag and CdSphases in the composite and also modifies the nature ofelectronic transition in CdS. For the nanohybrid containing aAg/CdS molar ratio of 0.1, CdS NPs (2.5 nm) surround the Ag(6.5 nm) core. The excitation of these particles by 340 nmlight, where the absorption due to the Ag phase in thenanohybrid is negligibly small, results in the enhancement offluorescence by a factor of about 7 as compared to that of bareCdS. However, for the particles containing a Ag/CdS molarratio of 1, bigger clusters (14 nm) are produced, which causesthe quenching of the emission of CdS. In time-resolvedemission spectroscopy the spectral shift from 415 nm (3.0 eV)to 550 nm (2.26 eV) monitored over a period of 1−220 ns isunderstood by the relaxation of charge within the surface statesof varied energy from 180 to 370 eV. The observed changes influorescence behavior in terms of intensity, lifetime, andspectral shift are understood by the electronic interactionbetween the Ag and CdS phases. The charge separation couldbe further increased by replacing adenine with 6-DMAP tostabilize the CdS NPs, which increases the average lifetime to330 ns. These changes in electronic properties could beassigned to the binding of metal to various sites of thebiomolecules as well as their structure. The manipulation ofelectronic and fluorescence properties in these nanohybridscould be exploited for optoelectronic, molecular recognition,and sensing applications.

4.4.3. GMP-Templated Binary (Ag/CdS, β-Fe2O3/CdS)and Ternary (β-Fe2O3/Ag/CdS) Nanohybrids. The func-tionalities of GMP have been successfully employed for thesynthesis of binary and ternary nanohybrids with modifiedoptical, photophysical, and magnetic properties.207,208

4.4.3.1. GMP-Templated Ag/CdS (SP1). GMP-mediated Ag/CdS nanohybrids have been synthesized in the quantum-confined region.207 The presence of Ag in the nanohybrid andits binding with GMP have been ascertained by XRD, IR, andXPS studies. GMP is attached to the surface of Ag/CdSthrough its various functionalities, such as −NH2, −CO,−NH−, −OH, N7−C8 + C8−H, PO3

2−, P−O-5′-sugar, andsugar ring, through supramolecular interactions and brings a

Scheme 11. Structures of Purine-Capped (a) and Adenine-Capped (b) Q-CdS

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXY

change in its optical and electronic properties. The presence ofAg at the interface of GMP-mediated CdS introduces severalnew additional surface states at the interface of the two colloids,enhancing the radiative transition to cause an increase in thequantum efficiency of fluorescence from 0.005 in the absence ofAg to 0.039 in its presence (Figure 34). This is also evidencedby an increase in the fluorescence lifetime from 40 to 160 ns. Inthis time domain different intermediates are understood to beproduced by the relaxation of charge within the surface states of

varied energies from 220 to 367 eV. The nature of the surface

states could be controlled kinetically by optimizing the amountof Ag in the nanohybrid. Aging of Ag/CdS nanohybrids induces

self-assembly, changing the morphology from quantum dots

with an average particle size (size distribution) of 5 nm (2−8nm) to nanowires with an average diameter (size distribution)

of 8.5 nm (3.5−11.5 nm) over a period of one month, unlike

GMP-mediated CdS, which forms nanorods.198 These changes

Figure 34. Left: optical and emission spectra of GMP−CdS (a, a′) and the GMP-templated Ag/CdS nanohybrid (b, b′) under optimized conditionsof [GMP] = 2 × 10−4 mol dm−3, Ag/CdS molar ratio 0.1, and pH 9.2 (λex = 340 nm). Right: TEM image of aged SP1. Reprinted with permissionfrom ref 207. Copyright 2012 Wiley.

Scheme 12. Structure of a Ternary Nanohybrida

aReprinted with permission from ref 208. Copyright 2011 Royal Society of Chemistry.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXZ

in morphology are also reflected by a significant increase in therotational correlation time from 42.9 to 167 ns.4.4.4. GMP-Templated Binary (β-Fe2O3/CdS) (SG) and

Ternary (β-Fe2O3/Ag/CdS) (SI) Nanohybrids. Multifunc-tionality of GMP with different phases (β-Fe2O3, Ag, CdS) hasrecently been integrated to produce fluorescent binary (β-Fe2O3/CdS) and ternary (β-Fe2O3/Ag/CdS) nanohybrids.208

The binary hybrid consists of spherical particles with an averagediameter (size distribution) of 2 nm (0.5−4.5 nm) joinedtogether to give a porous structure, which upon aging producesa more organized cluster with increased porosity consisting ofspherical NPs of almost double the diameter of 4 nm (2.5−6.5nm) to form a rodlike structure. The formation of ternaryhybrids results in the production of a relatively higher (∼3times more) fluorescing coiled network of entangled nanowireswith an average thickness (size distribution) of 5 nm (3.5−6.5nm) as compared to the binary system. The specificinteractions among the β-Fe2O3, Ag, and CdS phases withthe different moieties of GMP, specifically −NH, −NH2 ofimidazole and pyrimidine, sugar ring, P−O-5′-sugar, and PO3

2−,have been found responsible for their formation (Scheme 12).The increase in the intensity of the emission of SI is alsoevidenced by an increase in the average lifetime value of theternary complex (52 ns) compared to that of the binarycomplex (30 ns).

The excitation of binary nanohybrids by 340 nm light resultsin the quenching of the emission of the CdS phase with abimolecular quenching rate constant of 2.1 × 1010 dm3 mol−1

s−1. A relatively low emission in the case of binary hybrids isunderstood by thermodynamically driven transfer of electronsfrom the conduction band of CdS to the conduction band ofFe2O3 in contrast to the enhancement of the fluorescence in thecase of ternary hybrids. An examination of fluorescenceanisotropy in both the cases depicts an increase in the valueof anisotropy and rotational correlation time (θ2) upon aging.The presence of CdS in the binary hybrid results in a

reduction of the saturation magnetization value (0.0019 emu/cm2) by an order of magnitude as compared to that of β-Fe2O3

(0.019 emu/cm2) and a change in the magnetic behavior fromsuperparamagnetic to ferromagnetic with coercivity andremanance values of 1200 Oe and 7.9 × 10−5 emu/cm2,respectively (Figure 35). A similar change in magnetic behavioris observed in the case of SI which is associated with relativelyhigher values of Ms (0.0026 emu/cm2), Hc (1273 Oe), and Mr

(1.78 × 10−4 emu/cm2) compared to those of the binaryhybrid. Thus, the presence of silver in the ternary hybridinduces a novel change in morphology associated with theenhanced optical, electronic, and magnetic properties.

Figure 35. (X)M−H curves at ±7 T and 5 K: fresh SG (a), aged SG (b). (Y)M−H curves at ±7 T and 5 K: β-Fe2O3 (C). (Z)M−H curves at ±7 Tand 5 K: fresh SI (a), aged SI (b). Reprinted with permission from ref 208. Copyright 2011 Royal Society of Chemistry.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAA

5. BIOLOGICALLY SYNTHESIZED QUANTIZEDSEMICONDUCTOR NANOSTRUCTURES: CdS ANDZnS

Dameron et al.209 have reported the biosynthesis of quantizedCdS crystallites in yeast Candida glabrata and Schizosacchar-omyces pombe, cultured in the presence of cadmium salts. In thissynthesis short chelating peptides of general structure (γ-Glu-Cys)n-Gly control the nucleation and growth of CdS crystallitesto peptide-capped intracellular particles of 0.2 nm diameter.These particles were found to be relatively more monodisperseas compared to those synthesized chemically.Bio-CdS Q-particles (∼4 nm) synthesized by Klebsiella

pneumoniae are produced on the cell surface in response to thepresence of cadmium ions in the growth medium.210 Theseparticles demonstrated both optical and photoactivity analo-gous to those of chemically synthesized CdS systems. Suchbiosynthetic formation of colloidal particles may overcome thetoxic effect of any cadmium species which may be present inthe bacterium’s local environment and may also have aphysiological role in some organism.A variety of shapes and sizes of unicellular bacteria make

them an important template for biosynthesis of nanomaterialswith varied size and topological features. CdS nanocrystals witha size distribution of 2−5 nm have been synthesized within theEscherichia coli bacterial cell. Recently, genetically engineered E.coli has been used as a biofactory for the synthesis of CdSnanocrystals using two strains, JM109 and R189, of E. coli.211

During the nucleation process phytochelatins (PCs) withrepeating γ-Glu-Cys units served as a binding nucleation site forthe metal ions, which stabilizes the nanocrystal core. JM109strain CdS particles were produced with a size ranging between2 and 5 nm and exhibited excitonic and fluorescence peaks at318 and 384 nm, respectively, whereas with the R189 strainsmaller particles were produced with almost uniform size (3−4nm) associated with blue-shifted excitonic (254 nm) andfluorescence (330 nm) peaks (Figure 36). However, thequantum efficiency of emission of these particles was fairly low(0.007%).Shen et al.212 have synthesized E. coli bacterial templated

CdS nanostructures with varied morphologymonodispersequantum dots (2.3 ± 0.4 nm), nanocrystals (5.3 ± 0.5 nm), andnanoporous hollow microrods (diameter ∼100 nm, length≥200 nm). Their shape and morphology were observed to varywith the Cd/S ratio and reaction time as was revealed byelectron microscopy and were associated with the red-shiftedabsorption spectra.Ahmad et al.213 have synthesized CdS nanocrystals stabilized

by a reductase enzyme secreted by the fungus Fusariumoxysporum with a size distribution of 5−20 nm. These QDsexhibited an absorption edge at 450 nm and are produced inthe hexagonal phase. A similar enzymatic reduction of sulfateions was adopted for the preparation of PbS, ZnS, and MoS2NPs using their respective sulfate-containing salt.The highly organized structure, monodispersity, and

anisotropic shape(s) of viruses and bacteria have also beenexplored as effective tools for the synthesis of semiconductorquantum dots and nanowires.214−217 Mao et al.214 have usedengineered M13 bacteriophage as a biological template for thenucleation and orientation of semiconductor nanowires. Forthis synthesis the engineered viruses were exposed tosemiconductor precursor solutions (ZnCl2 and CdCl2), andthe resultant nanocrystals were templated along the viruses to

form fluorescing nanowires.215−217 ZnS nanocrystals214 werecrystallized along the length of the virus with a size distributionof 3−5 nm, produced in a hexagonal wurtzite or a cubic zincblende structure, depending on the peptide expressed on theviral capsid. Peptides that specifically directed CdS nanocrystal(3−5 nm) growth have also been engineered into the viralcapsid to create virus-based wurtzite CdS nanowires. In thisstudy heterostructured nucleation of ZnS/CdS could also beachieved with a dual-peptide engineered virus to express twodistinct peptides within the same viral capsid.216 This work isan elegant representation of a genetically controlled biologicalsynthesis route for a nanoscale semiconductor heterostructure.Thus, ease of coupling of biological molecules through their

chelation with metal ions of a semiconductor is found to restrictthe size of the clusters and control their electronic propertiesfor fluorescence imaging characteristics.

6. GENERAL DISCUSSIONThe main strategy in synthesis of biotemplated semiconductingnanomaterials and their composites has been to modify thecore material by interacting it with biopolymers. This has beenachieved either by coordination or by electrostatic/weak vander Waals interactions with different biomolecules used ascapping ligands.2,6,128 The subsequent step was nucleation andgrowth in the bottom-up approach to produce nanohybrid(s).Thus, the nanohybrids consist of the inorganics in the core andbiomolecules in the shell. Alternatively, in some studiesinorganic QDs synthesized separately were interacted withthe biotemplate by exploiting their recognition capability.5,95,157

Different characteristic features of the core material(s), such assize, shape, solubility, and functionality, are contributed by theshell, which also influences other physicochemical properties ofthe core in the building blocks. For example, nucleic acidsprovide a number of coordinating sites available on differentnucleosides and nucleotides, such as free −NH2, N1, N3, N7,N9, −CO, −OH, and PO2

2−, and the binding of metal

Figure 36. UV−vis (solid line) and fluorescence (dotted line) spectraof PC-capped CdS nanoparticles in an aqueous solution: (a) fromengineered JM109 (λexc = 320 nm), (b) from engineered R189 (λexc =260 nm). Reprinted with permission from ref 211. Copyright 2008Wiley.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAB

ion(s)/metal(s) through these coordinating sites of thebiotemplate stabilizes and passivates the inorganic nanomateri-als.Metal ions have also been observed to induce polarization in

the core material to enhance supramolecular interactions. Alarge number of variables of biomolecular templates, such astheir hierarchical structure, multifunctionality, varied length ofdifferent sequences, chelating capability, and concentrationvariation, play an important role in affecting the architecturesand physicochemical properties of these nanostructures. Thepresented studies involving various inorganics evidently

demonstrate that biomolecules could serve as effective cappingagents for stabilization and synthesis of a vast range ofnanomaterials of diverse shape(s) with tunable properties.Some of the interactions of DNA scaffolds with nanoma-

terials are presented in Scheme 13.Semiconducting nanomaterials synthesized on the DNA

scaffold were observed not only to be stable but also to haveenhanced optical properties through surface passiva-tion.78,110−114,118−124,126−131 The fluorescing properties of II−VI semiconductors have been extensively explored for FRET tothe dye acceptor labeled ssDNA and dsDNA (Scheme

Scheme 13. Interactions of DNA Scaffolds with Nanomaterials Yielding Varied Morphology

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAC

14),126,128,130,131 which have been used for developing thedetection system on the basis of hybridization. The sequence-

dependent SPR band frequency160−162 and fluorescingcharacteristics of DNA-modified Au163 and Ag166,167 probescould also be explored for sensing. The fluorescence from theseQDs has been explored for (i) sensing the morphology ofnanobiomaterials, (ii) estimation of the concentration of thequencher, and (iii) detection of the complementary target.In some cases semiconducting nanowires formed on DNA

scaffolds have been observed to be electrically conduct-ing,118−120 suggesting their application as a tool for electronic

devices. DNA−iron oxides and cobalt iron oxide nanostruc-tures135 were found to be superparamagnetic with a fairly highMs, suggesting their potential in MRI applications. The selectiverecognition of these materials by biologically relevant DNAsequences and their enhanced biocompatibility make themimportant for biomedical applications.The stability, morphology, and optical properties of Ag and

Au nanostructures have been widely controlled by bindingthem to the nucleic acid templates. The higher salt tolerance ofssDNA−GNPs without any further stabilization suggests163

their better biological utilization. Time-dependent formationsof varied cluster size ranging from Ag1− to Ag4−oligonucleo-tides165 have been observed to exhibit characteristic absorptionand fluorescence spectral features. Different mers of oligonu-cleotides changed their characteristic absorption and emissioncharacteristics. Other interesting features observed include thatdifferent nucleotide sequences produce varied morphology, buttheir length does not bring any change, an increase in [DNA]causes a reduction in the size of the pores,164 and higherconcentrations of salt in DNA produce spherical morphology,but low concentrations of salt produce head-body nanosnow-man particles for bimetallic Au−Ag nanostructures.174 All theseobservations suggest a very complex core−shell structure ofmetal−nucleic acid nanohybrids in which the core metal NPsare functionalized differently with specific oligonucleotides inthe shell. A change in the metal core also influences both themorphology and the optical properties because of a differencein the oscillator strength and absorption cross-sectioncorresponding to the LSPR frequency. For example, an about4-fold higher absorption coefficient of Ag compared to Aumakes it more appropriate for optical probing and SERSdetection. Between DNA-modified Ag/Au171 and Au/Ag172

core−shell nanosystems, the latter system in which gold NPsare used as the core and silver particles are employed as theshell provides higher stability and leads to SERS enhancementby a factor of >1012 in the case of Cy3-modified

Scheme 14. QD-Based FRET Used for the Detection ofDNAa

aKey: row 1, QD-conjugated probe DNA sequence (left) and dye-conjugated analyte DNA sequence (right); row 2, mixing of the probesequence with the analyte sequence followed by excitation of a QDwith blue light, causing green fluorescence from the QD and resultingin the weak fluorescence from the dye due to FRET from the QD; row3, quenching of fluorescence due to a QD associated with a relativelyred shifted stronger fluorescence from the dye after DNA hybrid-ization.

Scheme 15. Different Nanoarchitectures Observed Using an RNA Template

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAD

oligonucleotides with a 5 nm Ag shell, making it capable ofsingle-molecule detection.173

On the other hand, RNA-based nanostructures, owing tosingle-stranded-ness, exhibit more flexibility toward folding intorigid and desired nanoarchitectures.179,180,186,187,191 They haveemerged as an important tool to design self-assembledsuperstructures of varied morphologies and dimensionalities,namely, QDs,184−186,191 nanorods/nanowires/nanofibers,186

nanotubes,187,192 and porous190 and honeycomb191 nanostruc-tures involving supramolecular interactions. Such a one-stepfabrication of controlled structure through self-organizationprovides a convenient means of avoiding complex proce-dure(s). The morphological architectures of these nanohybridsare also obtained by involving similar interaction(s) betweenRNA strands and inorganics as discussed above with DNA.These syntheses are presented in Scheme 15.Although, among the individual nucleotides (AMP/ATP,

GMP/GTP, UMP/UTP, CMP/CTP), only AMP/ATP andGMP/GTP79,196−198 have been found to act as an effectivetemplate for inorganic materials, none of them are able to showan effect similar to that of RNA with regard to nano-architectures along with the optical and electronic properties.It is thus apparent that these moieties when present in themultifunctional 3D structure of RNA display this effect in acooperative manner.The specificity of metal−biotemplate interaction in semi-

conductors further contributes to the control of the nano-architecture as well as the nature of the optical absorption/excitonic band(s) and development of new emissive propertiesin these nanohybrids. These findings are manifested by thedifferent morphologies and absorption and emission character-istics for the same biomolecule with differing metalchalcogenide(s).184−188,190,191 The pH of the solution plays acrucial role in these interactions. First, it may causeprotonation/deprotonation of the binding sites (A, U, G, andC nucleobases, the phosphate group, and 2′-OH) of thebiotemplate to different extents in the case of RNA, whichaffects their coordinating power to influence the growth ofnanostructures. In the case of RNA it might induce thesecondary and tertiary interactions with different phases as well.Second, it may cause hydroxylation of metal ions to modify thesurface of the nanomaterials, which provides additional linkingsites for increased H-bonding interactions between thebiomolecule and nanomaterial(s). The presence of excessmetal ions may also polarize the nanomaterials to enhance thesupramolecular interactions with biomolecules. Such increasedinteractions may attribute to the production of a variety ofnanoarchitectures.184−188,190−192,198

Interactions with DNA and RNA influence the nucleationand growth of NPs to exhibit the size quantization effect alongwith surface passivation to varied extent. This creates bothshallow and deep traps on their surface to eventually influencetheir photophysics.79,185−188,190−192 Under varied experimentalconditions the shallow and deeper traps get populateddifferently to bring a shift in the excitonic absorption andemission bands, thereby influencing the dynamics of the chargecarriers. Such an approach could be utilized to achieve chargeseparation in the irradiated semiconducting systems.Capping of MNPs by biomolecules stabilizes them by

arresting their aggregation and modifying their surface bybinding to different sites.90 A reduction in the cluster size tosubnanodimensions induces in them a molecule-like propertycreating discrete energy levels displaying new characteristic

absorption and fluorescence bands involving interband andintraband transitions.218,219

In integrated nanosystems the presence of a metal in thenanohybrid has been observed to bring a change in themorphology associated with a change in the optical andmagnetic properties of the semiconducting core NP.83,207,208 Inthese nanosystems enhanced surface passivation of the coreaffects its optical absorption as well as fluorescence properties.In biotemplated Ag/CdS nanohybrids, Ag present near thesurface of CdS induces a local field and enhances the density ofsurface states in the fluorophore. The efficiency of fluorescenceshows a dependence on the amount of metal in the compositeand kinetically controls the relaxation of charge between theshallow and deeper traps interlinked to each other in theinterfacial region. At low silver its binding to the differentfunctionalities of the biomolecule introduces more shallowtraps located at relatively higher energy in the hybrid, which actas radiative centers by forming a charge transfer complex. Athigh Ag relatively more deeper traps are generated exhibitingred-shifted emission, most of which are nonradiative centers,causing a decrease in the quantum efficiency of fluorescence(Scheme 16).

The changes in morphology observed in the integratedbinary and ternary nanosystems consisting of MNPs andsemiconductor(s) might be attributed to the increasedfunctionality and interactions of different phases with variousfunctional groups of biomolecule(s). Besides morphologicalchanges, integration under optimized conditions often results inthe modification/enhancement of the physicochemical proper-ties of the core inorganic material(s) due to surface passivation,local field enhancement, and interfacial and surface plasmon−exciton interactions.83,206−208

6.1. Future Prospects and Challenges

On the synthesis and properties of nucleic acid-templatednanostructures, excellent reviews were contributed by Feldheimand Eaton,6 Ma, Sargent, and Kelly,7 and Berti and Burley85 afew years ago. Increasing investigations on these nanosystemsin recent years have demonstrated that the supramolecularapproach has tremendous potential to design vast varieties ofnew nanostructures of varied morphologies and dimension-alities mimicking natural systems. It still remains a challengingtask to rationalize the chemical approach to predict themorphology/dimensionality and electronic properties of suchnanohybrids on the basis of the length/sequence and nature ofthe biopolymer. The formation of organized structures could

Scheme 16. Mechanism Describing the PhotophysicalProcesses Observed in Integrated Biotemplated Metal/Semiconductor Nanohybrids

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAE

provide a basis for controlled fabrication of nanostructures

suited for nanodevices.Synthesis of multicomponent nanohybrids consisting of two

or more nanoscale components attached supramolecularly to

biomolecule(s) is still in its infancy and needs to be explored

extensively to induce a synergistic effect to enhance their

physical and chemical properties. The enhanced properties of

the integrated systems, namely, optical, fluorescence, aniso-

tropy, and magnetic properties, hold immense promise for their

utilization in biosensing, fluorescence imaging, extension of the

sensitization range, nanoelectronics, MRI, and detection

devices.Inorganic NPs functionalized with biomolecules usually

undergo self-organization to produce directed assembly of a

biological moiety encapsulating the inorganic nanostructure(s).

This would thus provide a means to create a synthetic

analogue(s) of biologically fabricated nanomaterials with

enhanced properties for their effective utilization in biomedical

applications. For example, specific and strong complementary

interactions of biomolecules could thus be explored for

designing functional nanomaterials having applications in

medicine, drug delivery, imaging, intracellular monitors, and

biological sensing. Since the toxicity of metal ions present in

these nanostructures limits their applications in biology and

devices, more efforts are needed to develop experimental

protocols for their environmentally benign synthesis to give

them a nontoxic and biocompatible surface with enhanced

physicochemical properties and functional behavior.In summary, the synthetic flexibility and programmability of

nucleic acid-templated nanostructures provides an excellent

tool to material scientists to construct multimodal supra-

molecular structures with an engineered surface and fine-tuned

optical, electronic, and magnetic properties with nanoscale

precision. The fabrication of ordered aggregates with enhanced

optical properties may also find tremendous scope in the areas

of NIR optical and detection devices and photonic activities.

We anticipate a bright future for these nanostructures in

modern nanoelectronics, nanophotonics, development of

chemical and enzymatic assays, cell biology, medicine, and

cancer therapy, providing high physicochemical stability, low

toxicity, multiplex detection, and a long circulation time inside

the biological system to search, track, fix, and destroy

malfunctioning and infected cells.

AUTHOR INFORMATION

Corresponding Author

*E-mail: anilkfcy@iitr.ac.in.

Notes

The authors declare no competing financial interest.

Biographies

Anil Kumar completed his doctorate in physical chemistry withfundamental research in the area of kinetics of catalytic reactions.Thereafter, he held the position of Research Associate in the RadiationLaboratory, University of Notre Dame, Indiana, from 1979 to 1982and collaborated mainly with Prof. P. Neta, a renowned radiationchemist, to investigate the participation of high-valent oxidation statesof silver in redox reactions using radiation chemical techniques. In1983, Dr. Kumar joined the University of Roorkee as Lecturer andinitiated work on the photochemistry of inorganic systems. In 1986 hewas offered the position of Guest Scientist at Hahn-Meitner-Institut,Germany, where he collaborated with Prof. Henglein, a pioneeringradiation chemist, on radiation chemical aspects of nanomaterials until1988. Subsequently, he initiated work on the photochemistry of metaland semiconductor nanosystems in India mainly through projectsfunded by the Department of Science & Technology (DST), NewDelhi. From his early work on these systems, he received the KhoslaResearch Award and a silver medal in 1993−94 and the First KhoslaResearch Prize and a medal in 2002−03. His research contributions onthese and earlier systems were also recognized by The NationalAcademy of Sciences, Allahabad, India, and he was elected as a fellowof this prestigious academy in 2003. Recently, Prof. Kumar has beenworking on biotemplated nanosystems. He was instrumental instarting an M.Tech. program in the area of nanotechnology at theIndian Institute of Technology Roorkee in 2008.

Vinit Kumar received his M.Sc. from the Indian Institute ofTechnology Roorkee. After receiving his M.Sc. degree, he joinedProf. Anil Kumar’s laboratory at the same institute and received hisPh.D. in 2010 in the field of physical chemistry and nanotechnology.During his Ph.D. studies, he worked on the various aspects of thesynthesis of colloidal nanoparticles and their self-assembly usingbiomolecules as templates. In 2011, he joined Prof. Naoki Sugimoto’slaboratory as a postdoctoral research fellow at the Frontier Institute for

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAF

Biomolecular Engineering Research, Konan University, Japan. In Japanhe worked on structural and functional analysis of RNA switches undermolecular crowding conditions. In September 2012, he moved to theNational Cancer Institute, Aviano, Italy, and there he focuses on thedevelopment of new nanotechnologies for cancer diagnosis, treatment,and DNA nanotechnology.

ACKNOWLEDGMENTS

We thank Dr. Reshma Rani, R.A., Sudhir Kumar Gupta, Ms.Mandeep Kaloti, Bhupender Singh, and other graduate studentsfrom our laboratory for going through the manuscript anduseful suggestions.

REFERENCES(1) Prasad, P. N. Nanophotonics; John Wiley & Sons: Hoboken, NJ,2004; p 337.(2) Katz, E.; Willner, I. Angew. Chem., Int. Ed. 2004, 43, 6042.(3) Zhou, M.; Ghosh, I. Pept. Sci. 2006, 88, 325.(4) Sun, Y.; Kiang, C.-H. In Handbook of Nanostructured Biomaterialsand Their Applications in Nanobiotechnology; Nalwa, H. S., Ed.;American Scientific Publishers: Stevenson Ranch, CA, 2005; Vol. 2,Chapter V.(5) Niemeyer, C. M. Angew. Chem., Int. Ed. 2001, 40, 4128.(6) Feldheim, D. L.; Eaton, B. E. ACS Nano 2007, 1, 154.(7) Ma, N.; Sargent, E. H.; Kelly, S. O. J. Mater. Chem. 2008, 18, 954.(8) Roduner, E. Nanoscopic Materials: Size-Dependent Phenomena;Royal Society of Chemistry: London, 2006; Chapter 1.(9) Mann, S. Angew. Chem., Int. Ed. 2008, 47, 5306.(10) Sanchez, C.; Arribart, H.; Guille, M. M. G. Nat. Mater. 2005, 4,277.(11) Ji, B.; Gao, H. Annu. Rev. Mater. Res. 2010, 40, 77.(12) Nelson, D. L.; Cox. M. M. Lehninger Principles of Biochemistry,5th ed.; W.H. Freeman: New York, 2008.(13) Seeman, N. C. Nature 2003, 421, 427.(14) Jaeger, L.; Chworos, A. Curr. Opin. Struct. Biol. 2006, 16, 531.(15) Guo, P. Nat. Nanotechnol. 2010, 5, 833.(16) Nozik, A. J.; Beard, M. C.; Luther, J. M.; Law, M.; Ellingson, R.J.; Johnson, J. C. Chem. Rev. 2010, 110, 6873.(17) Pattantyus-Abraham, A.-G.; Kramer, I. J.; Barkhouse, A. R.;Wang, X.; Konstantatos, G.; Debnath, R.; Levina, L.; Raabe, I.;Nazeeruddin, M. K.; Gratzel, M.; Sargent, E. H. ACS Nano 2010, 4,3374.(18) Salant, A.; aShalom, M.; Tachan, Z.; Buhbut, S.; Zaban, A.;Banin, U. Nano Lett. 2012, 12, 2095.(19) Thakar, R.; Chen, Y.; Snee, P. T. Nano Lett. 2007, 7, 3429.(20) Dennis, A. M.; Rhee, W. J.; Sotto, D.; Dublin, S. N.; Bao, G.ACS Nano 2012, 6, 2917.(21) Demir, R.; Okur, S.; Seker, M. Ind. Eng. Chem. Res. 2012, 51,3309.(22) Klimov, V. I.; Mikhailovsky, A. A.; Xu, S.; Malko, A.;Hollingsworth, J. A.; Leatherdale, C. A.; Eisler, H.-J.; Bawendi, M.G. Science 2000, 290, 314.(23) Dang, C.; Lee, J.; Breen, C.; Steckel, J. S.; Coe-Sullivan, S.;Nurmikko, A. Nat. Nanotechnol. 2012, 7, 335.(24) Mauser, C.; Limmer, T.; Como, E. D.; Becker, K.; Rogach, A. L.;Feldmann, J.; Talapin, D. V. Phys. Rev. B 2008, 77, 153303.(25) Talapin, D. V.; Lee, J.-S.; Kovalenko, M. V.; Shevchenko, E. V.Chem. Rev. 2010, 110, 389.(26) Beard, M. C.; Midgett, A. G.; Law, M.; Semonin, O. E.;Ellingson, R. J.; Nozik, A. Nano Lett. 2009, 9, 836.(27) Urban, J. J.; Talapin, D. V.; Shevchenko, E. V.; Kagan, C. R.;Murray, C. B. Nat. Mater. 2007, 6, 115.(28) Noone, K. M.; Ginger, D. S. ACS Nano 2009, 3, 261.(29) Kim, D. Y.; Choudhury, K. R.; Lee, J. W.; Song, D. W.;Sarasqueta, G.; So, F. Nano Lett. 2011, 11, 2109.(30) Yan, R.; Gargas, D.; Yang, P. Nat. Photonics 2009, 3, 569.

(31) Qian, L.; Zheng, Y.; Xue, J.; Holloway, P. H. Nat. Photonics2011, 5, 543.(32) Kameyama, N.; Suda, M.; Einaga, Y. Phys. Status Solidi A 2009,206, 2851.(33) Madhu, C.; Sundaresan, A.; Rao, C. N. R. Phys. Rev. B 2008, 77,201306(R).(34) Laurent, S.; Forge, D.; Port, M.; Roch, A.; Robic, C.; Elst, L. V.;Muller, R. N. Chem. Rev. 2008, 108, 2064.(35) Bogle, K. A.; Ghosh, S.; Dhole, S. D.; Bhoraskar, V. N.; Fu, L.-f.;Chi, M.-f.; Browning, N. D.; Kundaliya, D.; Das, G. P.; Ogale, S. B.Chem. Mater. 2008, 20, 440.(36) Sounderya, N.; Zhang, Y. Recent Pat. Biomed. Eng. 2008, 1, 34.(37) Medintz, I. L.; Stewart, M. H.; Trammell, S. A.; Susumu, K.;Delehanty, J. B.; Mei, B. C.; Melinger, J. S.; Blanco-Canosa, J. B.;Dawson, P. E.; Mattoussi, H. Nat. Mater. 2010, 9, 676.(38) De, M.; Ghosh, P. S.; Rotello, V. M. Adv. Mater. 2008, 20, 4225.(39) Baker, C. C.; Pradhan, A.; Shah, S. I. In Encyclopedia ofNanoscience and Nanotechnology; Nalwa, H. S., Ed.; American ScientificPublishers: Stevenson Ranch, CA, 2004; Vol. 5, p 449.(40) Jain, P. K.; Huang, X.; El-Sayed, I. H.; El-Sayed, M. A. Acc.Chem. Res. 2008, 41, 1578.(41) Rodríguez-Lorenzo, L.; Rica, R. d. l.; Alvarez-Puebla, R. A.; Liz-Marzan, L. M.; Stvens, M. M. Nat. Mater. 2012, 11, 604.(42) Cortie, M. B.; McDonagh, A. M. Chem. Rev. 2011, 111, 3713.(43) Murphy, C. J.; Gole, A. M.; Stone, J. W.; Sisco, P. N.; Alkilany,A. M.; Goldsmith, E. C.; Baxter, S. C. Acc. Chem. Res. 2008, 41, 1721.(44) Sau, T. K.; Rogach, A. L. Adv. Mater. 2010, 22, 1781.(45) Peng, S.; Lei, C.; Ren, Y.; Cook, R. E.; Sun, Y. Angew. Chem., Int.Ed. 2011, 50, 3158.(46) Doria, G.; Conde, J.; Veigas, B.; Giestas, L.; Almeida, C.;Assuncao, M.; Rosa, J.; Baptista, P. V. Sensors 2012, 12, 1657.(47) Alvarez-Puebla, R. A.; Liz-Marzan, L. M. Angew. Chem., Int. Ed.2012, 51, 11214.(48) Ditlbacher, H.; Lamprecht, B.; Leitner, A.; Aussenegg, F. R. Opt.Lett. 2000, 25, 563.(49) Sokolov, K.; Tam, J.; Travis, K.; Larson, T.; Aaron, J.; Harrison,N.; Emelianov, S.; Johnston, K. Conf. Proc. IEEE Eng. Med. Biol. Soc.2009, 2005.(50) Liz-Marzan, L. M., Kamat, P. V., Eds. Nanoscale Materials;Kluwer Academic Publishers: Boston, MA, 2003.(51) Rotello, V., Ed. Nanoparticles, Building Blocks for Nanotechnology;Springer: New York, 2004.(52) Schmid, G. Nanoparticles: From Theory to Application; Wiley-VCH Verlag GmbH and Co. KGaA: Weinheim, Germany, 2004;Chapter 7.(53) Jayadevan, K. P.; Tseng, T. Y. In Encyclopedia of Nanoscience andNanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers:Stevenson Ranch, CA, 2004; Vol. 8, p 333.(54) Wang, Q.; Ostafin, A. E. In Encyclopedia of Nanoscience andNanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers:Stevenson Ranch, CA, 2004; Vol. 5, p 475.(55) Tan, Y.; Li, Y.; Zhu, D. In Encyclopedia of Nanoscience andNanotechnology; Nalwa, H. S., Ed.; American Scientific Publishers:Stevenson Ranch, CA, 2004; Vol. 8, p 9.(56) Henglein, A. Chem. Rev. 1989, 89, 1861.(57) Burda, C.; Chen, X.; Narayanan, R.; El-Sayed, M. A. Chem. Rev.2005, 105, 1025.(58) Yin, Y.; Alivisatos, A. P. Nature 2005, 437, 664.(59) Manna, L.; Scher, E. C.; Alivisatos, A. P. J. Cluster Sci. 2002, 13,521.(60) Chaudhuri, A. G.; Paria, S. Chem. Rev. 2012, 112, 2373.(61) Boisselier, E.; Astruc, D. Chem. Soc. Rev. 2009, 38, 1759.(62) Murray, C. B.; Norris, D. J.; Bawendi, M. G. J. Am. Chem. Soc.1993, 115, 8706.(63) Dreaden, E. C.; Alkilany, A. M.; Huang, X.; Murphy, C. J.; El-Sayed, M. A. Chem. Soc. Rev. 2012, 41, 2740.(64) Grzelczak, M.; Perez-Juste, J.; Mulvaney, P.; Liz-Marzan, L. M.Chem. Soc. Rev. 2008, 37, 1783.(65) Betard, A.; Fischer, R. A. Chem. Rev. 2012, 112, 1055.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAG

(66) Zacher, D.; Schmid, R.; Woll, C.; Fischer, R. A. Angew. Chem.,Int. Ed. 2011, 50, 176.(67) deKrafft, K. E.; Wang, C.; Lin, W. Adv. Mater. 2012, 24, 2014.(68) Jiang, J.; Yu, J.; Corma, A. Angew. Chem., Int. Ed. 2010, 49, 3120.(69) Lu, G.; Li, S.; Guo, Z.; Farha, O. K.; Hauser, B. G.; Qi, X.;Wang, Y.; Wang, X.; Han, S.; Liu, X.; DuChene, J. S.; Zhang, H.;Zhang, Q.; Chen, X.; Ma, J.; Loo, S. C. J.; Wei, W. D.; Yang, Y.; Hupp,J. T.; Huo, F. Nat. Chem. 2012, 4, 310.(70) Alivisatos, A. P. J. Phys. Chem. 1996, 100, 13226.(71) Stroyuk, A. L.; Kryukov, A. I.; Kuchmii, S. Y.; Pokhodenko, V.D. Theor. Exp. Chem. 2005, 41, 67.(72) Joshi, R. K.; Schneider, J. J. Chem. Soc. Rev. 2012, 41, 5285.(73) Xia, Y.; Yang, P.; Sun, Y.; Wu, Y.; Mayers, B.; Gates, B.; Yin, Y.;Kim, F.; Yan, H. Adv. Mater. 2003, 15, 353.(74) Bent, S. F. J. Phys. Chem. B 2002, 106, 2830.(75) Scott, R. W. J.; Wilson, O. M.; Crooks, R. M. J. Phys. Chem. B2005, 109, 692.(76) Dollefeld, H.; Hoppe, K.; Kolny, J.; Schilling, K.; Weller, H.;Eychmuller, A. Phys. Chem. Chem. Phys. 2002, 4, 4747.(77) Hayashi, K.; Ono, K.; Suzuki, H.; Sawada, M.; Moriya, M.;Sakamoto, W.; Yogo, T. Chem. Mater. 2010, 22, 3768.(78) Coffer, J. L.; Bigham, S. R.; Pinizzotto, R. F.; Yang, H.Nanotechnology 1992, 3, 69.(79) Dooley, C. J.; Rouge, J.; Ma, N.; Invernale, M.; Kelley, S. O. J.Mater. Chem. 2007, 17, 1687.(80) Kumar, A.; Jakhmola, A. Langmuir 2007, 23, 2915.(81) Kang, S.; Jolley, C. C.; Liepold, L. O.; Young, M.; Douglas, T.Angew. Chem., Int. Ed. 2009, 48, 4772.(82) Yeh, H.-C.; Sharma, J.; Han, J. J.; Martinez, J. S.; Werner, J. H.Nano Lett. 2010, 10, 3106.(83) Kumar, A.; Chaudhary, V. Nanotechnology 2009, 20, 095703.(84) Alivisatos, P. Nat. Biotechnol. 2004, 22, 47.(85) Berti, L.; Burley, G. A. Nat. Nanotechnol. 2008, 3, 81.(86) Wengel, J. Org. Biomol. Chem. 2004, 2, 277.(87) Evdokimov, Yu. M.; Zakharov, M. A.; Skuridin, S. G. HeraldRuss. Acad. Sci. 2006, 76, 5.(88) (a) Kumar, A.; Hwang, J.-H.; Kumar, S.; Nam, J.-M. Chem.Commun. 2013, 49, 2597. (b) Dickerson, M. B.; Sandhage, K. H.;Naik, R. R. Chem. Rev. 2008, 108, 4935.(89) Sotiropoulou, S.; Sierra-Sastre, Y.; Mark, S. S.; Batt, C. A. Chem.Mater. 2008, 20, 821.(90) Gugliotti, L. A.; Feldheim, D. L.; Eaton, B. E. Science 2004, 304,850.(91) Simmel, F. C. Angew. Chem., Int. Ed. 2008, 47, 5884.(92) Feldkamp, U.; Niemeyer, C. M. Angew. Chem., Int. Ed. 2008, 47,3871.(93) Heckel, A.; Famulok, M. Biochemie 2008, 90, 1096.(94) Lin, C.; Liu, Y.; Yan, H. Biochemistry 2009, 48, 1663.(95) Li, H.; Carter, J. D.; LaBean, T. H. Mater. Today 2009, 12, 24.(96) Aldaye, F. A.; Palmer, A. L.; Sleiman, H. F. Science 2008, 321,1795.(97) Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2, 275.(98) Suzuki, K.; Hosokawa, K.; Maeda, M. J. Am. Chem. Soc. 2009,131, 7518.(99) Aldaye, F. A.; Sleiman, H. F. J. Am. Chem. Soc. 2007, 129, 4130.(100) Rothemund, P. W. K. Nature 2006, 440, 297.(101) Kuzyk, A.; Schreiber, R.; Fan, Z.; Pardatscher, G.; Roller, E.-M.; Hogele, A.; Simmel, F. C.; Govorov, A. O. Nature 2012, 483, 311.(102) Dohno, C.; Nakatani, K. Chem. Soc. Rev. 2011, 40, 5718.(103) Sacca, B.; Niemeyer, C. M. Chem. Soc. Rev. 2011, 40, 5910.(104) Rajendran, A.; Endo, M.; Sugiyama, H. Angew. Chem., Int. Ed.2012, 51, 874.(105) Willner, O. I.; Henning, A.; Shlyahovsky, B.; Willner, I. NanoLett. 2010, 10, 1458.(106) Houlton, A.; Pike, A. R.; Galindo, M. A.; Horrocks, B. R. Chem.Commun. 2009, 1797.(107) Winfree, E. Natl. Acad. Eng. Bridge 2003, 33, 31.(108) Keren, K.; Krueger, M.; Gilad, R.; Ben-Yoseph, G.; Sivan, U.;Braun, E. Science 2002, 297, 72.

(109) Seelig, G.; Yurke, B.; Winfree, E. J. Am. Chem. Soc. 2006, 128,12211.(110) Bigham, S. R.; Coffer, J. L. Colloids Surf., A 1995, 95, 211.(111) Bigham, S. R.; Coffer, J. L. J. Cluster Sci. 2000, 11, 359.(112) Bigham, S. R.; Coffer, J. L. J. Phys. Chem. 1992, 96, 10581.(113) Li, X.; Coffer, J. L. Chem. Mater. 1999, 11, 2326.(114) (a) Coffer, J. L.; Bigham, S. R.; Li, X.; Pinizzotto, R. F.; Rho, Y.G.; Pirtle, R. M.; Pirtle, I. L. Appl. Phys. Lett. 1996, 69, 3851. (b) Guo,L.; Ma, N. ACS Nano 2012, 6, 689.(115) Barrelet, C. J.; Greytak, A. B.; Lieber, C. M. Nano Lett. 2004, 4,1981.(116) Chen, N.; Qian, X.; Lin, H.; Liu, H.; Li, Y.; Li, Y. Dalton Trans.2011, 40, 10804.(117) Patolsky, F.; Zheng, G.; Lieber, C. M. Nanomedicine 2006, 1,51.(118) Dong, L.; Hollis, T.; Connolly, B. A.; Wright, N. G.; Horrocks,B. R.; Houlton, A. Adv. Mater. 2007, 19, 1748.(119) Kundu, S.; Liang, H. Adv. Mater. 2008, 20, 826.(120) Kundu, S.; Lee, H.; Liang, H. Inorg. Chem. 2009, 48, 121.(121) Patel, A. A.; Wu, F.; Zhang, J. Z.; Torres-Martinez, C. L.;Mehra, R. K.; Yang, Y.; Risbud, S. H. J. Phys. Chem. B 2000, 104,11598.(122) Levina, L.; Sukhovatkin, V.; Musikhin, S.; Cauchi, S.; Nisman,R.; Bazett- Jones, D. P.; Sargent, E. H. Adv. Mater. 2005, 17, 1854.(123) Artemyev, M.; Kisiel, D.; Abmiotko, S.; Antipina, M. N.;Khomutov, G. B.; Kislov, V. V.; Rakhnyanskaya, A. A. J. Am. Chem. Soc.2004, 126, 10594.(124) Ma, N.; Sargent, E. H.; Kelley, S. O. Nat. Nanotechnol. 2009, 4,121.(125) Zayed, J.; Philippe, S. Int. J. Toxicol. 2009, 28, 259.(126) Peng, H.; Zhang, L.; Kjallman, T. H. M.; Soeller, C.; Travas-Sejdic, J. J. Am. Chem. Soc. 2007, 129, 3048.(127) Li, J.; Zhu, J. J. Analyst 2013, 138, 2506.(128) Lee, J.; Choi, Y.; Kim, J.; Park, E.; Song, R. ChemPhysChem2009, 10, 806.(129) Freeman, R.; Finder, T.; Willner, I. Angew. Chem., Int. Ed.2009, 48, 7818.(130) Wang, Q.; Liu, Y.; Ke, Y.; Yan, H. Angew. Chem., Int. Ed. 2008,47, 316.(131) Boeneman, K.; Prasuhn, D. E.; Blanco-Canosa, J. B.; Dawson,P. E.; Melinger, J. S.; Ancona, M.; Stewart, M. H.; Susumu, K.; Huston,A.; Medintz, I. L. J. Am. Chem. Soc. 2010, 132, 18177.(132) Meng, H.; Yang, Y.; Chen, Y.; Zhou, Y.; Liu, Y.; Chen, X.; Ma,H.; Tang, Z.; Liu, D.; Jiang, L. Chem. Commun. 2009, 2293.(133) Byrne, S. J.; Corr, S. A.; Gun’ko, Y. K.; Kelly, J. M.; Brougham,D. F.; Ghosh, S. Chem. Commun. 2004, 2560.(134) Kinsella, J. M.; Ivanisevic, A. J. Am. Chem. Soc. 2005, 127, 3276.(135) Kinsella, J. M.; Ivanisevic, A. Langmuir 2007, 23, 3886.(136) Braun, E.; Eichen, Y.; Sivan, U.; Ben-Yoseph, G. Nature 1998,391, 775.(137) (a) Kumar, A.; Pattarkine, M.; Bhadbhade, M.; Mandale, A. B.;Ganesh, K. N.; Datar, S. S.; Dharmadhikari, C. V.; Sastry, M. Adv.Mater. 2001, 13, 341. (b) Nykypanchuk, D.; Maye, M. M.; Lelie, D.;Gang, O. Nature 2008, 451, 549.(138) (a) Ford, W. E.; Harnack, O.; Yasuda, A.; Wessels, J. M. Adv.Mater. 2001, 13, 1793. (b) Polsky, R.; Gill, R.; Kaganovsky, L.; Willner,I. Anal. Chem. 2006, 78, 2268.(139) (a) Fang, C.; Fan, Y.; Kong, J. M.; Zhang, G. J.; Linn, L.;Rafeah, S. Sens. Actuators, B 2007, 126, 684. (b) Itoh, H.; Maeda, H.;Yamada, S.; Hori, Y. ChemCatChem 2012, 4, 1737.(140) Gu, Q.; Cheng, C.; Haynie, D. T. Nanotechnology 2005, 16,1358.(141) Becerril, H. A.; Ludtke, P.; Willardson, B. M.; Woolley, A. T.Langmuir 2006, 22, 10140.(142) (a) Rotaru, A.; Dutta, S.; Jentzsch, E.; Gothelf, K.; Mokhir, A.Angew. Chem., Int. Ed. 2010, 49, 5665. (b) Watson, S. M. D.; Wright,N. G.; Horrocks, B. R.; Houlton, A. Langmuir 2010, 26, 2068.(143) (a) Finkelstein, A. E.; Walz, D. T.; Batista, V.; Mizraji, M.;Roisman, F.; Misher, A. Ann. Rheum. Dis. 1976, 35, 251. (b) Arvizo, R.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAH

R.; Bhattacharyya, S.; Kudgus, R. A.; Giri, K.; Bhattacharya, R.;Mukherjee, P. Chem. Soc. Rev. 2012, 41, 2943 and references therein.(c) Chaloupka, K.; Malam, Y.; Seifalian, A. M. Trends Biotechnol. 2010,28, 580.(144) Thakor, A. S.; Jokerst, J.; Zavaleta, C.; Massoud, T. F.;Gambhir, S. S. Nano Lett. 2011, 11, 4029.(145) Cho, W.-S.; Cho, M.; Jeong, J.; Choi, M.; Cho, H.-Y.; Han, B.S.; Kim, S. H.; Kim, H. O.; Lim, Y. T.; Chung, B. H.; Jeong, J. Toxicol.Appl. Pharmacol. 2009, 236, 16.(146) Chen, H.; Dorrigan, A.; Saad, S.; Hare, D. J.; Cortie, M. B.;Valenzuela, S. M. PLoS One 2013, 8, e58208.(147) Alkilany, A. M.; Murphy, C. J. J. Nanopart. Res. 2010, 12, 2313.(148) (a) Eckhardt, S.; Brunetto, P. S.; Gagnon, J.; Priebo, M.; Giese,B.; Fromm, K. M. Chem. Rev. 2013, 113, 4708. (b) Li, X.; Wang, L.;Fan, Y.; Feng, Q.; Cui, F.-Z. J. Nanomater. 2012, DOI: 10.1155/2012/548389.(149) Chen, Y.-S.; Hung, Y.-C.; Liau, I.; Huang, G. S. Nanoscale Res.Lett. 2009, 4, 858.(150) Goodman, C. M.; McCusker, C. D.; Yilmaz, T.; Rotello, V. M.Bioconjugate Chem. 2004, 15, 897.(151) Kim, S. T.; Saha, K.; Kim, C.; Rotello, V. M. Acc. Chem. Res.2013, 46, 681.(152) Das, S.; Debnath, N.; Mitra, S.; Datta, A.; Goswami, A.Biometals 2012, 25, 1009.(153) Lewinski, N.; Colvin, V.; Drezek, R. Small 2008, 4, 26.(154) Rosi, N. L.; Giljohann, D. A.; Thaxton, C. S.; Lytton- Jean, A.K. R.; Han, M. S.; Mirkin, C. A. Science 2006, 312, 1027.(155) Saha, K.; Agasti, S. S.; Kim, C.; Li, X.; Rotello, V. M. Chem. Rev.2012, 112, 2739.(156) Wang, Z.; Tang, L.; Tan, L. H.; Li, J.; Lu, Y. Angew. Chem., Int.Ed. 2012, 51, 1.(157) Zhang, J.; Liu, Y.; Ke, Y.; Yan, H. Nano Lett. 2006, 6, 248.(158) Sharma, J.; Chhabra, R.; Cheng, A.; Brownell, J.; Liu, Y.; Yan,H. Science 2009, 323, 112.(159) Yao, H.; Yi, C.; Tzang, C.-H.; Zhu, J.; Yang, M. Nanotechnology2007, 18, 015102.(160) Kim, J.-Y.; Lee, J.-S. Nano Lett. 2009, 9, 4564.(161) Storhoff, J. J.; Elghanian, R.; Mirkin, C. A.; Letsinger, R. L.Langmuir 2002, 18, 6666.(162) Krpetic, Z.; Singh, I.; Su, W.; Guerrini, L.; Faulds, K.; Burley,G. A.; Graham, D. J. Am. Chem. Soc. 2012, 134, 8356.(163) Xu, L.; Zhu, Y.; Ma, W.; Chen, W.; Liu, L.; Kuang, H.; Wang,L.; Xu, C. J. Phys. Chem. C 2011, 115, 3243.(164) Wei, G.; Zhou, H.; Liu, Z.; Song, Y.; Wang, L.; Sun, L.; Li, Z. J.Phys. Chem. B 2005, 109, 8738.(165) Petty, J. T.; Zheng, J.; Hud, N. V.; Dickson, R. M. J. Am. Chem.Soc. 2004, 126, 5207.(166) Gwinn, E. G.; O’Neill, P.; Guerrero, A. J.; Bouwmeeste, D.;Fygenson, D. K. Adv. Mater. 2008, 20, 279.(167) Sengupta, B.; Ritchie, C. M.; Buckman, J. G.; Johnsen, K. R.;Goodwin, P. M.; Petty, J. T. J. Phys. Chem. C 2008, 112, 18776.(168) Pal, S.; Deng, Z.; Ding, B.; Yan, H.; Liu, Y. Angew. Chem., Int.Ed. 2010, 49, 2700.(169) Park, H.-G.; Joo, J. H.; Kim, H.-G.; Lee, J.-S. J. Phys. Chem. C2012, 116, 2278.(170) Hutter, E.; Pileni, M.-P. J. Phys. Chem. B 2003, 107, 6497.(171) Cao, Y. W.; Jin, R.; Mirkin, C. A. J. Am. Chem. Soc. 2001, 123,7961.(172) Lim, D.-K.; Kim, I.-J.; Nam, J.-M. Chem. Commun. 2008, 5312.(173) Lim, D.-K.; Jeon, K.-S.; Kim, H. M.; Nam, J.-M.; Suh, Y. D.Nat. Mater. 2010, 9, 60.(174) Lee, J.-H.; Kim, G.-H.; Nam, J.-M. J. Am. Chem. Soc. 2012, 134,5456.(175) Timper, J.; Gutsmiedl, K.; Wirges, C.; Broda, J.; Noyong, M.;Mayer, J.; Carell, T.; Simon, U. Angew. Chem., Int. Ed. 2012, 51, 7586.(176) Guo, P. J. Nanosci. Nanotechnol. 2005, 5, 1964.(177) Leontis, N. B.; Lescoute, A.; Westhof, E. Curr. Opin. Struct.Biol. 2006, 16, 279.

(178) Shu, D.; Moll, W.-D.; Deng, Z.; Mao, C.; Guo, P. Nano Lett.2004, 4, 1717.(179) Afonin, K. A.; Bindewald, E.; Yaghoubian, A. J.; Voss, N.;Jacovetty, E.; Shapiro, B. A.; Jaeger, L. Nat. Nanotechnol. 2010, 5, 676.(180) Severcan, I.; Geary, C.; Chworos, A.; Voss, N.; Jacovetty, E.;Jaeger, L. Nat. Chem. 2010, 2, 772.(181) Sigel, R. K. O.; Sigel, H. Acc. Chem. Res. 2010, 43, 974.(182) Ennifar, E.; Walter, P.; Dumas, P. Nucleic Acids Res. 2003, 31,2671.(183) Famulok, M.; Ackermann, D. Nat. Nanotechnol. 2010, 5, 634.(184) Ma, N.; Dooley, C. J.; Kelley, S. O. J. Am. Chem. Soc. 2006,128, 12598.(185) Kumar, A.; Kumar, V. J. Phys. Chem. C 2008, 112, 3633.(186) Kumar, A.; Jakhmola, A. J. Phys. Chem. C 2009, 113, 9553.(187) Kumar, A.; Singh, B. Chem. Commun. 2011, 47, 4144.(188) Kumar, A.; Singh, B. Dalton Trans. 2013, 42, 11455.(189) Berezin, M. Y.; Akers, W. J.; Guo, K.; Fischer, G. M.;Daltrozzo, E.; Zumbusch, A.; Achilefu, S. Biophys. J. 2009, 97, L22.(190) Kumar, A.; Singh, B. RSC Adv. 2012, 2, 9079.(191) Kumar, A.; Singh, B. J. Phys. Chem. C 2013, 117, 5386.(192) Kumar, A.; Kumar, V. Chem. Commun. 2009, 5433.(193) Carter, C. J.; Dolska, M.; Owczarek, A.; Ackerson, C. J.; Eaton,B. E.; Feldheim, D. L. J. Mater. Chem. 2009, 19, 8320.(194) Kim, J. H.; Estabrook, R. A.; Braun, G.; Lee, B. R.; Reich, N. O.Chem. Commun. 2007, 4342.(195) Cao, Y. W. C.; Jin, R.; Mirkin, C. A. Science 2002, 297, 1536.(196) Green, M.; Smyth-Boyle, D.; Harries, J.; Taylor, R. Chem.Commun. 2005, 4830.(197) Hinds, S.; Taft, B. J.; Levina, L.; Sukhovatkin, V.; Dooley, C. J.;Roy, M. D.; MacNeil, D. D.; Sargent, E. H.; Kelley, S. O. J. Am. Chem.Soc. 2006, 128, 64.(198) Kumar, A.; Kumar, V. Inorg. Chem. 2009, 48, 11032.(199) Gao, G.; Wu, H.; Zhang, Y.; Luo, T.; Feng, L.; Huang, P.; He,M.; Cui, D. CrystEngComm 2011, 13, 4810.(200) Kumar, A.; Gupta, S. K. J. Mater. Chem. B 2013, 1, 5818.(201) Zhao, W.; Gonzaga, F.; Li, Y.; Brook, M. A. Adv. Mater. 2007,19, 1766.(202) Kumar, A.; Mital, S. Photochem. Photobiol. Sci. 2002, 1, 737.(203) Kumar, A.; Mital, S. J. Colloid Interface Sci. 2001, 240, 459.(204) Kumar, A.; Mital, S. Int. J. Photoenergy 2004, 6, 61.(205) Kumar, A.; Gupta, S. K. J. Nanopart. Res. 2013, 15 (1466), 1.(206) Jaganathan, H.; Ivanisevic, A. J. Mater. Chem. 2011, 21, 939.(207) Kumar, A.; Chaudhary, V.; Kumar, V. Eur. J. Inorg. Chem. 2013,2013, 269.(208) Kumar, A.; Singhal, A. J. Mater. Chem. 2011, 21, 481.(209) Dameron, C. T.; Reese, R. N.; Mehra, R. K.; Kortan, A. R.;Carroll, P. J.; Steigerwald, M. L.; Brus, L. E.; Winge, D. R. Nature1989, 338, 596.(210) Homes, J. D.; Richardson, D. J.; Saed, S.; Evansgowing, R.;Russell, D. A.; Sodea, J. R. Microbiology 1997, 143, 2521.(211) Kang, S. H.; Bozhilov, K. N.; Myung, N. V.; Mulchandani, A.;Chen, W. Angew. Chem., Int. Ed. 2008, 47, 5186.(212) Shen, L.; Bao, N.; Prevelige, P. E.; Gupta, A. J. Phys. Chem. C2010, 114, 2551.(213) Ahmad, A.; Mukherjee, P.; Mandal, D.; Senapati, S.; Khan, M.I.; Kumar, R.; Sastry, M. J. Am. Chem. Soc. 2002, 124, 12108.(214) Mao, C.; Solis, D. J.; Reiss, B. D.; Kottmann, S. T.; Sweeney, R.Y.; Hayhurst, A.; Georgiou, G.; Iverson, B.; Belcher, A. M. Science2004, 303, 213.(215) Lee, S.-W.; Mao, C.; Flynn, C. E.; Belcher, A. M. Science 2002,296, 892.(216) Mao, C.; Flynn, C. E.; Hayhurst, A.; Sweeney, R.; Qi, J.;Georgiou, G.; Iverson, B.; Belcher, A. M. Proc. Natl. Acad. Sci. U.S.A.2003, 100, 6946.(217) Sweeney, R. Y.; Mao, C.; Gao, X.; Burt, J. L.; Belcher, A. M.;Georgiou, G.; Iverson, B. L. Chem. Biol. 2004, 11, 1553.(218) Shen, Z.; Duan, H.; Frey, H. Adv. Mater. 2007, 19, 349.(219) Shang, L.; Dong, S.; Nienhaus, G. U. Nano Today 2011, 6, 401.

Chemical Reviews Review

dx.doi.org/10.1021/cr4007285 | Chem. Rev. XXXX, XXX, XXX−XXXAI