Cloning, Structural Analysis, and Expression of the …Cloning, Structural Analysis, and Expression of the Human Fast Twitch Skeletal Muscle Troponin C Gene* (Received for publication,

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 265, No. 21, Issue of July 25, pp. 12520-12526,199O Printed in U.S.A.

Cloning, Structural Analysis, and Expression of the Human Fast Twitch Skeletal Muscle Troponin C Gene*

(Received for publication, January 3, 1990)

Reinhold GahlmannSn and Larry KedesQ (1 From the Program in Molecular Biology and Genetics, Center for Molecular Medicine and Departments of $§Biochemktry and JMedicine, University of Southern California School of Medicine, Los Angeles, California 90033

The gene encoding human fast skeletal muscle troponin C (TnC) was cloned, mapped, and sequenced. The locations of intron positions in this gene were compared to those in the related genes for mouse slow skeletal TnC and vertebrate and nonvertebrate cal- modulins. We detected strikingly similar purine-rich DNA sequences on the coding strand in the basal promoter of the genes for fast and slow troponin C and chicken calmodulin II which may represent conserved regulatory elements in genes of the vertebrate troponin C/calmodulin gene family. We mapped the transcriptional start site of the gene and analyzed the expression of TnC test genes in the myogenic cell lines C2, LS, andHSc2(2-1) and in the human fibroblast line HuT12. Constructs comprising 4.7 or 6.2 kilobase pairs of 6’- flanking sequence (including the genuine transcriptional start site) upstream of the chloramphenicol acetyltransferase gene as reporter expressed the hybrid gene in C2 cells but not in nonmuscle cells. Surpris- ingly, no expression was found in cell lines L8 and HQc2(2-1) despite the fact that all three muscle cell lines vigorously express the endogenous TnC fast mRNA after differentiation. The discrepancy between the expression of endogenous genes and the test gene in these cell lines indicates different requirements for regulatory elements in different myogenic cells.

Troponin C (TnC)’ is the calcium-binding component of the troponin complex that mediates contraction of vertebrate skeletal and heart muscle in response to increasing calcium levels in the sarcoplasm (reviewed in Leavis and Gergely, 1984; Zot and Potter, 1987; Grabarek and Gergely, 1989). Troponin C interacts with troponin T and troponin 1 in the troponin complex. Binding of calcium to troponin C changes

* This work was supported in part by grants from the National Institutes of Health and Veterans Administration (to L. K.) and by a grant-in-aid from the American Heart Association, Greater Los Angeles Affiliate (to R. G.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

7 Supported by a research fellowship from the American Heart Association California Affiliate and with funds contributed by the San Mateo San Francisco Chapter. Parts of this work were done during the tenure of a Senior Investigatorship of the American Heart Association, Greater Los Angeles Affiliate.

I\ To whom correspondence should be addressed: Dept. of Biochem- istry, University of Southern California School of Medicine, 2011 Zonal Ave.. Los Angeles. CA 90033. Tel.: 213-224-7151.

‘The adbreviations Used are: TnC, troponin C; kbp, kilobase pair(s); bp, base pair(s); CAT, chloramphenicol acetyltransferase; Pipes, piperazine-NJ’-bis(2-ethanesulfonic acid); UTR, untranslated region; Pyr, pyrimidine.

the conformation of the troponin complex and its interaction with tropomyosin and actin in the thin filament. Calcium- induced steric and kinetic changes seem to be prerequisites for muscle contraction (Payne and Rudnick, 1989; Grabarek and Gergely, 1989).

The two isoforms of troponin C, fast and slow, have different binding affinities for calcium. Both isoforms have two high affinity sites in the carboxyl-terminal half of the proteins in common. Fast skeletal muscle troponin C has two additional low affinity binding sites in the amino-terminal half of the protein while one (the amino-terminal) of these two sites seems to be nonfunctional in the slow skeletal troponin C protein (Van Eerd and Takahashi, 1975; Van Eerd and Tak- ahashi, 1976; Collins et al., 1977; Putkey et aZ., 1989). The expression of the two troponin C isoform proteins is devel- opmentally regulated and is controlled on the transcriptional or posttranscriptional level (Gahlmann et al., 1988). Expres- sion of the fast skeletal muscle troponin C isoform gene is highly fiber-type specific while the gene encoding the slow skeletal muscle isoform is expressed in skeletal muscle and cardiac muscle and at low levels also in some nonmuscle cells (Gahlmann et al., 1988). Troponin C protein isoform substi- tution experiments in isolated skinned limb muscle fibers and heart trabeculae have demonstrated that tension development and maximal contractile force generation in an individual striated muscle fiber is different dependent on which of the two troponin C isoform proteins is present (Moss et al., 1986; Babu et aZ., 1988). These results indicate that troponin C isoform expression is critical for striated muscle function.

Troponin C is evolutionarily related to a number of calcium- binding proteins including calmodulin, myosin light chain, and parvalbumin; they are referred to as members of the troponin C superfamily (Kretsinger, 1980; Carpenter et al., 1984). Some of them have been found only in certain tissues or at certain developmental stages (Carpenter et al., 1984) while calmodulin is ubiquitously distributed in eukaryotes and in different cell types (Waisman et al., 1975; Smoake et al., 1974; Means et al., 1982).

In order to study the mechanisms controlling the tissue- specific expression of troponin C isoforms we have cloned the two human troponin C genes. Here we report the cloning and structural analysis of the human fast skeletal muscle troponin C gene and define its transcription-initiation site. We believe that this is the first gene that was isolated for this isoform from any source. We present a structural comparison of troponin C and calmodulin genes and describe similar purine- rich basal promoter elements in vertebrate calmodulin and TnC genes. Finally, the expression of troponin C test constructs in myogenic cell lines was assessed and compared to the endogenous expression of troponin C isoforms in these lines.

12520

Human Fast Skeletal Troponin C Gene Expression 12521

MATERIALS AND METHODS

Restriction enzymes, T4 DNA ligase, T4 DNA polymerase, Esch- erichia coli DNA polymerase I, and E. coli DNA polymerase large fragment (Klenow polymerase) were purchased from New England Biolabs, Bethesda Research Laboratories, or Amersham Corp. Radi- olabeled nucleotides were purchased from Amersham Corp. or Du Pont-New England Nuclear. Nitrocellulose filters (BA85) were nur- chased from Sihleicher & Schuell.

Plasmid DNA preparations, restriction enzyme digests, agarose- gel electrophoresis, isolation of DNA from gels, Southern blotting, Northern blotting, plaque lifts, nick translations, and hvbridizations were performed according to. standard protocols (Maniatis et al., 1982). Random nrimine DNA labeling was nerformed with the Mul- tiprime DNA Labeling System (Ameriham Corp.). Ml3 single strand templates were generated by the method described by Messing (1983). Oligonucleotides were synthesized on an Applied Biosystems 380A DNA synthesizer.

Cloning and Sequencing Analysis-Human genomic DNA (HeLa) was digested with restriction endonuclease EcoRI and the fragments were separated by electrophoresis on an agarose gel. DNA fragments of sizes between 12 and 18 kilobase pairs (khp) were electroeluted and ligated to X EMBL4 EcoRI vector arms (Stratagene, La Jolla, CA). The recombinant X DNA was packaged using Gigapack extracts (Stratagene) and E. coli VCS 257 cells were infected with the recombinant phage. Plated phage was screened with a human fast twitch skeletal troponin C cDNA P&I-PuuII fragment (Gahlmann et al., 1988). Four hybridizing clones were isolated from approximately 2 x 10’ recombinants and purified to homogeneity. DNA was prepared from all four clones. Each clone contained EcoRI DNA fragments of identical size (14 khp) that hybridized to the troponin C probe. The insert of one of the isolated clones was subcloned into pBR322 and mapped by restriction endonuclease analysis (Fig. 1). An internal BamHI fragment comprising the complete gene (Fig. 1) was subcloned into the vector pBluescript KS(+) (Stratagene). Sequencing analysis was performed after subcloning of specific fragments into M13mp18 or 19 with Ml3 sequencing primers or by using double strand DNA and specific oligonucleotide primers. Most of the sequence presented in Fig. 2 was analyzed on both strands or, alternatively, multiple times using overlapping clones of a one-directional deletion series.

DNA sequences were managed with the GEL (Grymes et al., 1986), SEQ (Brutlag et al., 1982), and IFIND (Ginsburg, 1987) programs (IntelliGenetics, Inc., Mountain View, CA). In some cases, the nro- grams BESTFIT, GAP, and SEQED’(Ginsburg, 1987) provided by the University of Wisconsin Genetics Computer Group were used. All programs were run at default settings. Published sequences were retrieved from the GenBank genetic sequence data bank or from the European Molecular Biology Laboratory data library for sequence comparisons.

Plasmid Constructions-A gene/cDNA hybrid (Fig. 4) was con- structed by using a human fast skeletal troponin C cDNA subclone comprising the first 463 nucleotides of the full length cDNA in pGEM3 (Gahlmann et al., 1988). This cDNA fragment contained a unique restriction site for BstEII within the 5’-UTR (8 bp upstream of the translational start site) and a single PstI site in the adjacent polylinker. The 5’-terminal fragment flanked by these two sites was replaced by a genomic 781-bp length P&I-BstEII fragment that comprised 57 hp of the 5’-untranslated region and 724 bp of 5’- flanking sequences. The resulting construct comprises the 5’ part of the TnC gene up to exon V in which the introns are eliminated.

The promoter/CAT construct (Fig. 7a) was generated as follows. Starting from clone pHFTnCR18 we deleted the sequences of approximately 8-kbp length between the BstEII site at the 5’ end of the gene and the Sal1 site in the vector (see Fig. la) and joined the two ends via a Hind111 linker. Both the BstEII and the Sal1 site were regenerated by the linker in the deletion construct (pHFTnC-Prom) of approximately 9.5-kbu lenath. The bacterial CAT nene includine SV40- splicing and polyadeny‘iation signals was isola&d from clone pHCA485CAT (Minty and Kedes, 1986), modified by linker addition so that Hind111 sites were present on both ends of the fragment and cloned into the Hind111 site of clone pHFTnC-Prom. In the resulting promoter/CAT construct (nHFTnC6200CAT) 6.2 khn of 5’-flankine ._ sequences up to the BstEII site within the 5’-UTR of the gene are located upstream of the bacterial reporter gene. Clones were selected that contain the insert in the orientation presented in Fig. 7a. A derivative of this construct (pHFTnC4700CAT) was generated by deleting the distal 5’-flanking region comprised in the 1.5-kbp EcoRI- BglII fragment.

A subclone of clone pHFTnC6200CAT was used as a probe in the Sl nuclease protection analysis. A SmaI fragment between positions -23 and -498 (bp) relative to the transcriptional start site was realaced bv a BalII linker. The resulting ulasmid contained the BglII- Z&d111 f&me& (shown in Fig. 5) wh:ch was labeled as a probe for the Sl nuclease protection analysis.

RNA Isolation-Tissue samples were pulverized on dry ice and resuspended in 3-4 volumes of lysis buffer (8 M guanidinium HCl, 10 mM sodium acetate, pH 5.0, 1 mM dithiothreitol) and homogenized immediately with a Brinkman Polytron for 30 s. Debris was sedi- mented and the clear supernatant was drawn 10 times through a 21- gauge needle to shear the high molecular weight DNA. The RNA was selectively pelleted with 0.5 volumes of ethanol at -20 “C overnight and collected at 10,000 rpm for 10 min. The RNA pellet was resuspended in 2-4 volumes of lysis buffer and purified by phenol and chloroform extractions followed by ethanol precipitation.

Cell nellets from cultured cell lines were lvsed in 3-4 volumes of lysis buffer by vortexing and RNA was prepared as described above.

Adult human skeletalmuscle was obtained from a patient undergo- ina a below-knee amnutation. Fetal muscle was obtained from a 24- wick-old fetus. The experiments were performed according to Na- tional Institutes of Health guidelines and approved by the human subjects committee at Stanford University.

Primer Extension Analysis-Primer extension analysis was performed in modification of a procedure by Bodner and Karin (1987). 25 pg of total RNA from human adult and fetal skeletal muscle was resuspended in 10 ~1 of 10 mM Tris, pH 7.9,l mM EDTA, 0.25 M KC1 containing 0.2 ~1 of RNasin ribonuclease inhibitor (Promega) and 5 ng of the 5’-32P-labeled oligonucleotide primer TGCTGGTCC- GTCATGGTT which is complementary to the human fast troponin C mRNA (bases 61-78) as indicated in Fig. 4 and which comprises the translational start site (underlined in Fig. 4). The primer was annealed to the RNA at 48 “C for 1 h. 24 ~1 of primer extension buffer was added containing 9.5 mM Tris, pH 8.7; 9.5 mM MgCl?; 3 mM dithiothreitol; 340 ng/pl actinomycin D; 0.25 mM dATP, dCTP, dGTP, and dTTP each; 0.02 fig/r1 avian myeloblastosis virus reverse transcriptase (Seikagaku America, Inc.); and 0.015 @g/&l RNasin. The primer was extended for 1 h at 42 “C. The reaction was stopped by adding 80 ~1 of 25 XIIM EDTA, 250 mM NaCl, 5 ~1 of RNase A (10 mg/ml), and 1 ~1 (2 wg) of sonicated salmon DNA and incubated at 31°C for 45 min. The sample was extracted with phenol/chloroform, nrecinitated. and resusnended in seauencine loading buffer. The Hamile was separated on an 8% nolvacrvlamide, urea sequencing gel. A sequencing- ladder was used-as- size marker. This marker was eenerated bv usine the same (however unlabeled) oligonucleotide that had been used as-a primer in the primer extension experiment and by using double strand DNA of the gene-cDNA hybrid construct (shown in Fig. 4) as a template.

Sl Nuclease Protection Analysis-The probe was prepared from a linearized plasmid by a two-step replacement reaction with phage T4 DNA polymerase (Maniatis et-al., 1982). Exonuclease digestion was oerformed with 2 units of enzvme and 1 ua of DNA for 3 min at 37 “C!. Subsequent polymerization was at 31°C for 30 min with 20 PCi of [o-32P]dCTP (s. at. >400 ci/mM) and 100 PM each of dATP, dGTP, and dTTP, followed by a 20-min chase with 100 pM dCTP. The probe was digested with the restriction endonuclease Hind111 releasing the labeled BglII-Hind111 fragment that includes the putative transcriptional start site as depicted in Fig. 5. Sl nuclease analyses followed essentially the protocol of Maniatis et al. (1982). Hybridization of a total of 100 pg of RNA (sample plus tRNA) to 70 ng of DNA (containing 900 pg of the BglII-Hind111 fragment labeled as described above) was performed in 30 ~1 of 80% (v/v) formamide, 10 mM piperazine-N,N’-bis(2-ethanesulfonic acid) (Pipes; pH 6.4), 1 mM EDTA. After denaturation at 80 “C for 5 min, hybridization was carried out at 50 “C for 18 h. Sl nuclease digestion was performed after addition of 200 ul of incubation buffer in 260 mM NaCl, 40 mM sodium acetate (pH 4.6), 1 mM ZnSOd, 100 pg of sonicated calf thymus DNA/ml with 50 units of Sl nuclease (Sigma) for 30 min at 37 ‘C. Carrier tRNA was added and undigested nucleic acids were precipi- tated with isopropanol and analyzed on an 8% acrylamide, urea sequencing gel.

Transfection and Chloramphenicol Acetyltransferase Assays- Transfection of cells with DNA and chloramphenicol acetyltransferase assays were essentially performed as described by Minty and Kedes (1986). Differentiated cells of the myogenic cell lines L8 (Yaffe and Saxel, 1977a) and H9c2(2-1) (Kimes and Brandt, 1976) were transfected 2 days after differentiation in fusion medium (2% horse serum in Dulbecco’s minimal essential medium). The medium was

12522 Human Fast Skeletal Troponin C Gene Expression

changed 2-5 h before the transfection and the calcium phosphate DNA precipitate was added directly to the fresh medium. The medium was changed after ‘7 h and the cells were harvested after an additional 48 h. Undifferentiated C2 myoblasts (Blau et al., 1983), a subclone of the line C2 established bv Yaffe and Saxel (1977b). were transfected at very low confluency and harvested 48 h later.’ ‘At this stage the cells were less than 50% confluent and no morphological changes (fusion) were detectable. Expression in differentiated C2 cells (myotubes) were assessed after transfection of high confluency myoblasts. The medium was changed to low serum fusion medium 16 h after transfection. Fusion was clearly visible after 24 h in fusion medium and cells were harvested 24 h later. HuT12 fibroblasts (Leavitt et al., 1987) were transfected at low density and the medium was replaced 16 h later. The cells were harvested at high confluency 48 h later.

We did not use cotransfected constructs, such as the fl-galactosidase reporter gene under the control of a constitutive promoter, as internal controls. Competition between such control constructs and the test constructs has been detected by us and others when the fi- actin (Muscat et al., 1988), SV40 (Muscat et al., 1988), or Rous sarcoma virus promoter (Mar et al., 1988) were used. In pilot experiments we observed competition between the test construct pHFTnC6200CAT and a p-actin-/3-galactosidase construct. There- fore, we opted to omit internal standards entirely. Plasmids were purified over three CsCl gradients and only preparations of highly purified plasmids were used. Chloramphenicol acetyltransferase assays were performed and one representative result was quantitated by scintillation counting of the thin-layer chromatography plates. We attempted to ascertain the validity of our results by repeating experiments with separate plasmid preparations. Highly purified plasmids were prepared in parallel. We observed some differences in expression levels between individual plasmid preparation, in particular regarding the maximal expression of SVZCAT (positive control) relative to the cardiac promoter construct pHCA485CAT (see Fig. ‘7~). We have observed similar differences in the relative expression of these two constructs in C2 cells with different plasmid preparations before (Minty et al., 1986; Minty and Kedes, 1986). However, the results for one particular plasmid preparation was highly reproducible. For all transfections within the same experiment we used the same set of plasmids. This ascertained the comparability of the relative expression levels within each experiment. Representative results are presented.

RESULTS

Cloning and Structural Analysis of the Human Fast Skeletal Troponin C Gene-Using a cDNA clone as a probe the human fast skeletal troponin C gene was cloned from genomic DNA

as a 14-kbp EcoRI DNA fragment. The fragment was subcloned into the vector pBR322 and mapped by restriction endonuclease analysis (Fig. la). The position of the troponin C gene within this clone was first determined by hybridization analysis of restriction fragments with cDNA fragments or oligonucleotides as probes (data not shown). The complete gene and 5’- and 3’-flanking sequences are contained within a 5.1-kbp BamHI DNA fragment (Fig. la, marked by bracket). We determined the nucleotide sequence of the gene and some flanking sequences; however, the core of intron 1, which has a length of 2.5 kbp as determined by restriction endonuclease analysis, was not sequenced. The position of exons and introns in the gene and the transcriptional start site, which was mapped as described below, are indicated in Fig. la. Intron and exon sizes are detailed in Fig. lb. The gene is composed of six exons between 52 and 162 nucleotides long which are interrupted by five introns ranging in size from 88 (intron 3) to 2.5 kbp (intron 1). Intron 1 is located immediately downstream of the translational start codon ATG. The remaining four introns are also contained within the coding region of the gene. All introns are flanked by the consensus dinucleo- tides GT and AG at the donor and acceptor site, respectively. The complete result of the sequencing analysis is presented in Fig. 2. The sequence of the previously published full length cDNA (Gahlmann et al., 1988) and corresponding regions in the genomic sequence are identical and are underlined in Fig. 2. The cDNA sequence terminates with the hexamer TGTTCC followed by a stretch of adenine residues representing the polyadenylic acid tail. The corresponding hexamer in the gene is followed by four adenine residues. It is therefore not possible to define exactly the polyadenylation site at the 3’ end of the gene. The predominant transcriptional start sites (mapped as described below) are marked by asterisks in Fig. 2. The sequence at the transcriptional start site (GTCATCTTT) matches the consensus sequence PyrPyr- CAPyrPyrPyrPyrPyr pointed out by Corden et al. (1980) except for position one (guanidine f Pyr). A putative TATA box (TACAAA) is located 31 bp upstream of the transcriptional start site. No canonical CCAAT box (Breathnach and Chambon, 1981) is present within the first 200 bp of the start

I I a Barn”, BamHl

b lntron

sire (bp) 67 52 144 115 137 162

FIG. 1. a, restriction map of the human fast-twitch skeletal muscle troponin C gene. The map of the 14-kbp EcoRI restriction frasment that was cloned from human eenomic DNA and subcloned into vector pBR322 is presented. The inter&l BamHI fragment that contains the-complete gene and that was used for the sequencing analysis is marked by the bracket. Exons and introns are depicted by black and open boxes, respectively. The transcriptional start site is marked by a bent arrow. b, exon and intron sizes of the human fast skeletal troponin C gene. Exons are depicted by open boxes, introns are indicated by thin lines. All numbers were determined by nucleotide sequencing of the corresponding regions (see Fig. 2) except for the length of intron 1 which was estimated based on restriction endonuclease analyses.

Human Fast Skeletal Troponin C Gene Expression

site. Within the first 967 bp of 5’-flanking sequences we detected no CarG box elements. The CarG box is an important regulatory element controlling muscle and nonmuscle actin gene expression (Minty and Kedes, 1986; Muscat et al., 1988; Carroll et al., 1988, Ng et al., 1989). Between bp -549 and -555 we detected the M-CAT sequence CATTCCT which is a regulatory element in the chicken cardiac troponin T gene (Mar and Ordahl, 1988). There are four potential MyoD binding sites CANNTG (Lassar et aZ., 1989) within the 967 bp of 5’-flanking sequence,

Comparison of Conserved Sequences and Intron Positions in Troponin C and Calmodulin Genes-We compared the published exon sequences of rat, chicken, and Drosophila calmodulin genes and of the mouse slow skeletal troponin C gene (Nojima and Sokabe, 1987; Simmen et al., 1985a, 1985b; Smith et al., 1987; Parmacek and Leiden, 1989; Nojima, 1989) with the human fast skeletal troponin C gene and determined whether intron positions have been conserved during evolution of these closely related genes. The result is summarized in Fig. 3a. Most vertebrate calmodulin and troponin C genes

are composed of six exons and five introns. The rat calmodulin II gene with only four introns represents the only known exception (Nojima, 1989). The Drosophila calmodulin gene is composed of only four exons interrupted by three introns (Smith et al., 1987). Based on the alignment, the position of intron 4 in the vertebrate calmodulin genes is shifted by 1 bp relative to the position of intron 4 in the two known troponin C isoform genes. The intron positions in the coding regions of chicken and rat calmodulin genes do not correlate well with the positions of the four calcium binding sites encoded by this gene: introns 3, 4, and 5 are located at different positions within the calcium binding domains (Simmen et al., 1985a, 1985b; Smith et al., 1987; Nojima and Sokabe, 1987; Nojima, 1989). The same holds true for both troponin C genes (Par- macek and Leiden, 1989; this report).

Since calmodulin and TnC genes are evolutionarily closely related (Baba et al., 1984), we compared the 5’-flanking region of the human fast TnC gene with published sequences for the mouse slow TnC (Parmacek and Leiden, 1989), rat calmodulin I-III (Nojima and Sokabe, 1987; Nojima, 1989), chicken calmodulin (Simmen et al., 1985a, 1985b; Epstein et al., 1989), and Drosophila calmodulin gene (Smith et al., 1987). The alignments of the human fast TnC sequence between bp -968 and +l to the complete mouse slow TnC 5’-flanking sequence (bp -806 to +l) using the BESTFIT program (Ginsburg, 1987) selected a best region of sequence similarity (78%) corresponding to sequences -41 to -63 bp in the human fast TnC gene and to sequences -86 to 108 bp in the mouse slow TnC promoter. A similar sequence is present in the chicken calmodulin gene promoter between bp -63 and -96 (70% similar). The corresponding comparisons between the sequence element of the human fast TnC gene and rat calmodulin genes indicated highly GC-rich (90%) regions to be most similar (Fig. 3b). The related sequence elements in the genes for troponin C and chicken calmodulin II are highly purine- rich containing 91, 96, and 87% purine residues within the core of 23 bp common to the human fast TnC, chicken calmodulin, and mouse slow TnC promoter, respectively (see Fig. 3b). The majority of these purines are guanidine residues, representing 70,78, and 65% of the nucleotides within the 23- bp region of similarity, respectively. This GAG stretch (guanidine-rich region interrupted by mostly adenosine residues) is underlined in Fig. 2.

Mapping of the Transcriptional Start Site-The 5’-flanking sequence of the human fast TnC gene contains no canonical TATA or CCAAT elements. Thus we used both primer extension analysis and a nuclease Sl protection assay to determine the transcriptional start site of the gene. We used an IS-bp oligonucleotide that was complementary to base pairs 61 to 78 in the coding cDNA sequence to prime extension on fast skeletal mRNA templates. We used total RNA isolated from human adult and fetal skeletal muscle in this assay. A double strand DNA fragment in an intronless gene construct (see “Material and Methods”) was used as a sequencing template with the same primer and used as a size marker. In this construct all introns were missing including intron 1 which would have been located in the center of the primer binding site and, if present, would likely prevent annealing of the primer. We observed two major extension products (marked by arrows in Fig. 4) which terminate at adjacent bases corresponding to guanidine and thymidine within the marker sequence. We concluded that these two bases represent the major transcriptional start sites of the human fast TnC gene and are designated by asterisks in Fig. 2. The more 5’ base was designated base +l in the sequence. This result from the primer extension analysis was confirmed in an Sl nuclease


b -24 -E

I I GGAGCTGGGGGCGGAGG

-40 //II //II I /i/II -8 / I GTTGGGGCGGGCGGCGGTGGCGGCGGCGCGCGC

-80 I l///I I II I///I I II I I II -19

I I I I I I I I Ill II l/ll/Il II II TGACGGGGAGAGGGGTGGGGGGAGGGAGCGGCGC I I

-96 I/j1 //ll/~Il II I i l l -63 GGGACCAGGGAGGGGGTGGAGGA I

-108

Human Fast TnC

Mouse Slow TnC

Rat Calmodulln I, Ill, (II ’ )

Chicken Calmodulin II

Drosophila Calmodulin

RF.? CAti il

RAT CAM III

HUMAN TNC FAST

CHICKEN CAM II

MOUSE TNC SLOW

FIG. 3. a, schematic presentation of intron positions in the human skeletal troponin C gene in the mouse slow skeletal troponin C gene and in the rat, chicken, and Drosophila calmodulin genes. The intron positions are indicated by arrows. The cDNAs were aligned using the IFIND program (IntelliGenetics, Inc.). The intron positions within the aligned cDNAs were compared based on the published data from the corresponding genes. The mouse slow skeletal troponin C gene (Parmacek and Leiden, 1989), rat calmodulin genes I-III (Nojima and Sokabe, 1987; Nojima, 1989), and the chicken calmodulin II gene (Simmen et al., 1985a, 1985b) have comparable intron positions for ail five introns. Intron 3 (m) is missing in the rat calmodulin II gene (Nojima, 1989). The position of intron 4 in the rat and the chicken calmodulin gene (indicated by an &z&k next to the arrows marking the intron) is shifted by 1 bp relative to the two troponin C genes. The Drosop~i~ calmoduiin gene (Smith et al., 1987) contains only three introns which correspond to introns 1, 3, and 5 in the vertebrate calmodulin and troponin C genes. b, sequence similarities between vertebrate calmodulin and TnC gene promoters. The sequence similarities were detected using the BESTFIT program (Ginsburg, 1987) as described in the text. Numbering of the sequences is based on the position of the transcriptional start sites (+l) as defined e~erimentally for the genes compared (see “Results” for references). Identical base positions in the human fast TnC sequence as compared to the sequences of the genes for chicken calm~ulin, mouse slow TnC, and rat calmodulin are indicated by vertical lines.

protection assay that was performed with a ~g~I-~i~dIII DNA fragment containing the transcriptional start site as a probe. This probe of SS-bp length comprised a core sequence which was flanked by a BgfiI and a Hind111 linker not present in the gene (see Fig. 5). This probe was annealed to 20 or 50 pg of total human adult skeletal muscle RNA and Sl nuclease protection analysis was performed as outlined under “Mate- rial and Methods.” As expected from the result of the primer extension analysis, a specific fragment with a length of 59 bases was detectable on the autoradiogram of an analytical gel (Fig. 5). The signal was stronger when 50 pg (as compared to 20 fig) of total RNA was employed in this assay providing additional evidence that the signal is specific. No protection of a band of this size was detected in control lanes. Further- more, no protection of a fragment of 77 bp was detected which would have indicated a transcriptional start site upstream of the site mapped by primer extension analysis.

Expression of Slow and Fast Skeletal Troponin C-Three myogenic cell lines, C2, L8, and H9c2(2-l), were tested for endogenous expression of troponin C mRNAs. Cells of the three lines were grown to high density and kept in differentiation medium until morphological changes characteristic for differentiation of these cells were observed. RNA was isolated

and analyzed by Northern blot analysis. Probes specific for slow and fast TnC were used to detect mRNA for each isoform as described previously (Gahlmann et al., 1988). In addition, a human skeletal cy-actin probe was used under low stringency hybridization conditions that allowed us to assess mRNA levels for muscle and nonmuscle actin isoforms in the three cell lines (Erba et al., 1986). Thus, we could establish the degree of differentiation of the cell lines and determine whether the cells were differentiated when harvested for mRNA analysis. The result of this experiment is shown in Fig. 6. We detected mRNA for both slow and fast TnC in all three cell lines. Both isoforms seemed to be coexpressed in these cells at roughly equivalent levels. We detected two signals for actin mRNA. The faster migrating band (bottom arrow in Fig. 6) was present in all three cell lines and at high levels compared to a slower migrating actin isoform mRNA which was preaent in low abundance and visible clearly only after longer exposures for differentiated H9c2(2-1) and L8 cells (top arrow in Fig. 6). The faster migrating band corresponds to muscle-specific ol-actin isoform mRNAs while the slower migrating band corresponds to nonmuscle actin mRNAs which are present in differentiated cells at very low levels (Erba et al., 1986; Minty et al., 1981). Our result indi-

Human Fast Skeletal Troponin C Gene Expression 12525

a

I PSI1

3’.TTGGT&TGCCTGGTCGT-5

I 1 BstEll SaulA

200 bD

b I 2 3 - -=- Z--S- - -i-.-z B-.1_ === ==Z = s-- --= -- k--- =--- ==I-

z-z

FIG. 4. a, mapping of the transcriptional start site by primer extension analysis. The primer (5’-)TGCTGGTCCGTCATGGTT (-3’) which is complementary to base pairs 61 to 78 in the cDNA sequence for human fast skeletal troponin C and which includes the translational start site (underlined) was annealed to 25 pg of total cellular RNA from human adult skeletal muscle (lanes 1 and 3) and from skeletal muscle RNA of a 24-week-old human fetus (lane 2). The primer was extended and products were analyzed as described under “Materials and Methods.” A size marker was generated by using a gene-cDNA hybrid in which the junction was located at a B&E11 site within the 5’-UTR of the cDNA (gene). Accordingly, no introns were present in this construct which allowed us to anneal this DNA with t.he same primer that was used for the primer extension analysis, to perform a standard sequencing reaction, and to use the resulting sequencing ladder as a size marker for the primer extension products on the analytical gel. b, the lanes of the sequencing ladder on the gel between lanes 2 and 3 read (from left to right): adenine, cytosine, guanine, and thymine. The primer employed in the primer extension reaction was labeled at the 5’ end with [Y-~*P]ATP as compared to the unlabeled primer used in the sequencing reaction. This causes the slight shift in mobility of the sequencing markers on the sequencing gel as compared to the primer extension products. The two bases in the sequencing marker closest to the longest extension product are indicated by asterisks.

cated that the cell lines were highly differentiated and that the ratios of TnC to a-actin mRNAs were similar in all three lines. In summary, all three cell lines expressed slow and fast skeletal muscle troponin C mRNA.

Expression of Human Fast Troponin C Promoter-CAT Con- structs in Myogenic Celki-We tested the potential of 5’- flanking sequences of the human fast skeletal troponin C gene to stimulate transcription when linked to the bacterial CAT- reporter gene in the same three myogenic cell lines and in the human fibroblast line HuT12. The construct pHFTn- C6200CAT (Fig. 7a) contains approximately 6.2 kbp of 5’- flanking sequences from the left border of the EcoRI fragment

a /M-. 59 ““cleoldes -Bj I . InRNA

FIG. 5. Mapping of the transcriptional start site by nuclease Sl analysis. a, an 86-bp probe was generated by using a BgLII- Hind111 fragment present within a DNA construct and was labeled using T4 DNA polymerase (see “Materials and Methods”). A schematic presentation of the probe and expected products when this probe was employed in the Sl nuclease protection assay or as size markers on the gel are presented. The probe contains human fast skeletal troponin C genomic sequences flanking the putative transcriptional start site and is abutted by BgnI and HindIII linkers. The sizes of the probe used as a marker before and after a B&E11 digest (86 and 80 bp, respectively) are indicated. If the transcriptional start site corresponded to that identified by primer extension analysis (Fig. 4) then the size of the DNA fragment protected in an Sl nuclease analysis is 59 base pairs. Transcripts starting upstream would protect a 77-bp fragment (BglII-HindIII fragment minus the linker seg- ments). b, 20 (lane 1) and 50 pg (lane 2) of total adult human skeletal muscle RNA were used in an Sl nuclease protection assay as described under “Materials and Methods.” Transfer RNA (lane 3) and total RNA of myoblasts of the myogenic mouse cell line C2 (lane 4) were used as negative controls. A BglII-BstEII fragment (lane 5) and the BgLII-Hi&II fragment used as a probe (lane 6) were used as size markers. In addition, a standard sequencing reaction using unrelated DNA as a template was run on the same gel. The positions of DNA fragments of 60, 70, 80, 90, and 100 bp are marked on the gel. The position of a specific signal in lanes I and 2 due to a fragment of 59 base pairs length is marked by an arrow.

as depicted in Fig. 1 to the BstEII site 52 bp downstream of the transcriptional start site. This region is inserted upstream of the bacterial CAT gene in a truncated pBR322 vector. The construct was tested for expression in the four cell lines as described under “Material and Methods.” Timing of the transfection and of the harvesting of the cells were modified from line to line to optimize for differentiation of the cells. In all cases expression was assessed under conditions that revealed expression of the endogenous genes in comparable experiments (see above). In addition, the human striated muscle- specific cardiac a-actin CAT construct pHCA485CAT was used as a positive control. The construct pSV2CAT was used


H9 L8 c2 a

fast TnC

A c t I n

FIG. 6. Northern blot analysis of troponin C expression in the myogenic cell lines C2, L8, and H9c2(2-1). 10 pg of total RNA from L8 and H9c2(2-1) cells that were kept for 4 days in fusion medium and approximately 0.5 I.cg of poly(A)-RNA from C2 myotubes were separated in duplicate on 1% agarose-formaldehyde gels and transferred onto nitrocellulose filters (Maniatis et al., 1982). RNA on these filters was hybridized to specific cDNA probes for slow and fast skeletal muscle troponin C. The fast troponin C-specific probe included the first 463 nucleotides of the full length cDNA in pGEM3. The slow-specific probe included the 510-nucleotide coding region and part of the 3’-UTR in a BglII-BstXI cDNA fragment subcloned in the same vector. Both sequences have been used previously in hybridization experiments, and we found that at a stringency of 0.2 X SSC (1 x SSC = 0.15 M NaCl, 0.015 M sodium citrate), 0.1% SDS at 65 “C essentially no cross-hybridization between the two troponin C isoforms is detectable when the probe is used for the detection of rabbit troponin C RNAs in a Northern blot experiment. (Gahlmann et al., 1988). Both probes were “P-labeled by random priming, hybridized to the filter-bound RNAs at 55 “C in 5 X SSC, 50 mM sodium phosphate, pH 6.5,0.1% SDS, 5x Denhardt’s, and 10% (w/v) dextran sulfate for 60 h, and washed at a final stringency of 0.2 x SSC, 0.1% SDS at 65 “C. Signals presented in the figure for slow and fast troponin C mRNA were taken from the same autoradiography in each case. The RNA bound to one of the filters was rehybridized to a human skeletal a-actin probe (PuuII-XbaI fragment from pHMa A-l) that hybridizes to all actin isoform mRNAs of higher eukaryotes at lower stringencies (Erba et al., 1986). The probe hybridized in 4 X SSC at 65 “C for 21 h and the filters were washed at a final stringency of 0.5 X SSC at 50 “C. The actin signals presented were obtained on the same autoradiogram after exposures for 16 h at -80 “C. In addition to the specific signals for cu-actin mRNA (bottom arrow) we obtained a faint signal corresponding to nonmuscle actin mRNA in H9c2(2-1) and L8 cells (top arrow).

n B

b

I) mm

*c (I,. l e

as internal standard for expression levels in muscle uersus nonmuscle cells. The promoterless CAT construct pHCAOCAT served as negative control. These three plasmids have been described in detail previously (Minty and Kedes, 1986). The result of the transfection experiment is presented in Fig. 7, b and c. We observed significant expression of the troponin C-CAT construct only in C2 cells. The expression levels of the troponin C construct in this experiment and in additional experiments (data not shown) was approximately 30% of the level observed for the human cardiac actin-CAT construct. Neither the two myogenic cell lines L8 and H9c2(2- 1) nor the fibroblast line HuT12 allowed expression signifi- cantly higher than for the promoterless CAT construct (pHCAOCAT) while the positive controls revealed high expression levels.

We previously had observed expression of muscle cY-actin II n

55

20 n

1ocl l-l

61 I I __ I-III

promoter-CAT constructs in proliferating myoblasts of C2 1 I I - I 1 I I I I A 1 1 1 I cells (Minty et al., 1986). We therefore compared the levels of

1 2 3 4 1 2 3 4 C2C12 Myoblasls c2c12 MyoluLws

troponin C-CAT expression between myoblasts and differentiated myotubes. This experiment was performed using the

FIG. 7. Expression of troponin C promoter-CAT constructs

modified troponin C-CAT construct pHFTnC4700CAT as a in muscle and nonmuscle cells. a, map of pHFTnC6200CAT and pHFTnC4700CAT. The construction of plasmid pHFTnC6200CAT

reporter gene. In this construct the distal EcoRI-BglII frag- is described under “Materials and Methods.” The construct contains ment of approximately 1.5-kbp length (-6200 to -4700 rela- 6.2 kbp of 5’-flanking sequences from the human fast troponin C


tive to the transcriptional start site) had been deleted and replaced by a linker. Activities of pHFTnC6200CAT and pHFTnC4700CAT were indistinguishable in C2 myotubes (data not shown). The constructs pHCA485CAT and pSV2CAT were again used as internal controls. The quanti- tation of the results indicates that the expression levels of troponin C-CAT are similar in differentiated and undifferentiated C2 cells corresponding to approximately 30% of the levels observed for pHCA485CAT.

12527

al., 1988; Carroll et al., 1988; Ng et al., 1989) and the thyroid hormone-responsive elements of the myosin heavy chain genes (Izumo and Mahdavi, 1988) are cases in point.

Our comparison of 5’-flanking sequences of the fast and slow skeletal TnC genes and in vertebrate calmodulin genes revealed several sequence similarities in the basal promoter regions. Common to the two currently known vertebrate TnC genes and the chicken calmodulin gene is a guanidine-rich sequence (GAG stretch) located between base pairs -35 and -115 in each case. This element and additional polypurine tracts in the 5’-flanking region of the chicken calmodulin II gene have been pointed out previously (Epstein et al., 1989). There are several examples of such purine sequence elements in promoters of eukaryotic genes which confer nuclease Sl hypersensitivity to such promoters in vitro and in uiuo (Mace et al., 1983; Schon et al., 1983; Evans et al., 1984; Nick01 and Felsenfeld, 1984; Finer et al., 1984; Ruiz-Carrillo, 1984; Hoff- man-Liebermann et al., 1986; Finer et al., 1987; Evans et al., 1988; Young et al., 1989). The purine-rich tracts located in vertebrate TnC and calmodulin genes were detected in two- way sequence comparisons. This may indicate that they are not only purine-rich per se but rather represent a specific class of purine-rich sequences with potential impact on gene expression. These sequences may confer important structural changes to the basal promoter or may represent binding sites for common transcriptional factors. Examples for transcriptional factors that bind to purine-rich elements are Spl (Ka- donaga et al., 1986) which can interact with the sequence GGGGGAGGGG in the human cardiac actin promoter in vitro (Gustafson and Kedes, 1989) and a transcriptional factor that interacts with a purine-rich element in the herpes sim- plex virus 1 immediate early genes (LaMarco and McKnight, 1989). Putative Spl binding sites in the GC-rich promoter regions of rat calmodulin genes have been described previously (Nojima, 1989). Our search for muscle-specific regulatory elements in the 5’-flanking sequence of the human fast TnC gene revealed the presence of a M-CAT sequence element at bp -555 upstream of the transcriptional start site. The presence of similar sequence elements in multiple muscle genes has been described previously (Nikovits et al., 1986) and the importance of the M-CAT sequence CATTCCT for the expression of the chicken cardiac troponin T gene has been confirmed (Mar and Ordahl, 1988).

DISCUSSION

We have isolated and sequenced the human fast skeletal troponin C gene. The gene is composed of six exons and five introns. The positions of the five introns within this gene were compared to the positions of introns in the related rat, chicken, and Drosophila calmodulin genes (Nojima and SO- kabe, 1987; Simmen et al., 1985a, 1985b; Smith et al., 1987) and in the mouse slow troponin C gene (Parmacek and Leiden, 1989). We observed that the positions of all introns are highly conserved among vertebrate troponin C and calmodulin genes. Gilbert (1978) suggested that introns may be located between separate domains thereby facilitating their reshuffling or du- plication during evolution. As discussed earlier (Simmen et al., 1985a, 1985b; Nojima and Sokabe, 1987; Smith et al., 1987) this hypothesis does not apply to the calmodulin family since introns 3, 4, and 5 are located in the core of the regions encoding calcium binding sites and at different positions within each calcium binding domain. The same holds true for both troponin C genes (Parmacek and Leiden, 1989; this report).

The structural analysis of TnC (Parmacek and Leiden, 1989; this report) and calmodulin genes (Simmen et al., 1985a, 1985b) and the comparison of their proteins (Baba et al., 1984) have confirmed the very close relationship between these two members of the troponin C superfamily. This per- spective may be useful for the understanding of mechanisms that regulate tissue-specific expression of troponin C and calmodulin genes. Calmodulin and troponin C isoform genes reveal marked differences in their patterns of developmental and tissue-specific expression (Smoake et al., 1974; Waisman et al., 1975; Wilkinson, 1980; Dhoot and Perry, 1979; Dhoot and Perry, 1980; Toyota and Shimada, 1981; Gahlmann et al., 1988). Still, some multigene families with tissue-specific expression of various isoforms carry common subsets of regulatory elements in their promoters. The CarG boxes of actin genes (Minty and Kedes, 1986; Mohun et al., 1987; Muscat et

gene upstream of the bacterial CAT gene in pBR322 between the EcoRI and the Sal1 site of the vector. In construct pHFTnC4700CAT the EcoRI-BglII fragment distal to the transcriptional start site (indicated by the bracket) was replaced by a linker. Approximately 4.7 kbp of immediately 5’-flanking sequences of the human fast troponin C gene remained in this construct. b, autoradiography of CAT assays with cellular extracts of differentiated C2 (lanes 1-4), L8 (lanes 5-8), and H9c2(2-1) cells (lanes 9-12) and HuT12 fibroblast cells (lan&l3-16) after transfection with 20 pg of pHFTnC6200CAT (lanes 1,5,9, and 13), pHCAOCAT, a promoterless CAT construct (lanes 2,6,10, and 14), pHCA485CAT (lanes 3,7,11,15), and pSV2CAT (lanes 4,8,12 and 16). The three control plasmids were described previously bv Mintv and Kedes (1986). The same set of four ulasmids __ _ was used for the transfections into the four different cell lines. In c: A, relative expression levels of promoter test constructs in the three myogenic cell lines C2, L8, and H9c2(2-1) and in the fibroblast cell line HuT12. CAT assays presented in b were quantitated by scintillation counting of corresponding regions in thin-layer chromatography plates. The expression was normalized to pSV2CAT (100% activity). B, comparison of expression of constructs pSVZCAT, pHCA485CAT, and pHFTnC4700CAT in C2 myoblasts and myotubes. Expression levels were quantitated and normalized to SVBCAT as described above.

It is possible that sequence elements in intragenic regions or 3’ of the gene are required for gene activation in L8 and H9c2(2-1) cells and are missing in the CAT constructs we tested. Intragenic regulatory elements have been described for the quail fast troponin I gene (Yutzey et al., 1989) and for the muscle creatine kinase gene of the mouse (Sternberg et al., 1988; Buskin and Hauschka, 1989). An enhancer is located 24 kbp downstream of the myosin light chain 1 promoter in the rat. This enhancer confers muscle-specific expression to the MLC % gene while sequences close to the MLC promoters appeared not to contain tissue-specific regulatory elements (Donoghue et al., 1988).

Lack of complete correspondence between expression of endogenous muscle genes and transfected constructs is not uncommon (Daubas et al., 1988; Billeter et al., 1988). For example, endogenous expression was observed from the myosin light chain 1 (fast) gene promoter in all differentiated muscle cell lines and primary muscle cells tested whereas the corresponding CAT construct was expressed only in primary muscle cells but not in any myogenic cell line (Daubas et al., 1988; Billeter et al., 1988). It has thus been proposed that differences in the levels of regulatory factors among cell lines may account for such discrepancies. This may also explain


the markedly different expression patterns for transfected fast troponin C in the three myogenic lines C2, L8, and H9c2(2-1). Similarly, putative regulatory elements important for fast TnC expression in L8 and H9c2(2-1) cells may be superfluous in C2 cells. One possibility is that C2 cells over- express a muscle-specific factor that can stimulate transcrip-

Approach, pp. 115-146, (Bishop, M. J. and Rawlings, C. J., ed) pp. 115-146, IRL Press, Oxford, 1987

Grabarek, Z., and Gergely, J. (1989) Biomed. Biochim. Acta 48. 297-305 Gz7m;s R. A., Travers, P., and Engelberg, A. (1986) Nuckw Aads Res. 14,

Gustafson, T. A., and Kedes, L. (1989) Mol. Cell. Biol. 9,3269-3283 Hoffman-Liebermann, B., Liebermann, D., Troutt, A., Kedes, L. H., and Cohen,

S. N. (1986) Mol. Cell. Biol. 6, 3632-3642 Isumo, S., and Mahdavi, V. (1988) Notwe 334,539-542 K&odoy3ga, J. T., Jones, K. A., and Tlian, R. (1986) Trends B&hem. Sci. 11,

Kimes, B. W., and Brandt, B. L. (1976) Exp. Cell. Res. 98,367-381 Kretsinger, R. H. (1980) CRC Crit. Rev. Biochem. 8,119-174 LaMarco, K. L., and McKnight, S. L. (1989) Genes & Deu. 3, 1372-1383 Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka,

S. D., and Weintraub, H. (1989) Cell S&823-831 Leavis, P. C., and Gergely, J. (1984) CRC Crit. Reu. Biochem. 16,235-305 Leavitt, J., Ng, S.-Y., Varma, M., Latter, G., Burbeck, S., Gunning, P., and

Kedes, L. (1987) Mol. Cell. Biol. ‘7,2467-2476 Mace, H. A., Pelham, H. R. B., and Travers, A. A. (1983) Nature 304, 555-

557

tion on its own when present at high concentration. Such a factor may be missing or scarce in other cell types and expression may require the action of auxiliary factors that bind to intragenic regions missing in the test construct. Spe- cies-related differences of L8 and H9c2(2-1) cells (rat cell lines) and C2 (a mouse cell line) may also contribute to the observed expression patterns and we have initiated experiments to test these possibilities. Precocious (over)expression of the same putative factor may explain the high expression levels observed for the TnC test gene in C2 myoblasts. If this hypothesis is correct, proliferating C2 cells would represent an ideal model system for the purification and characteriza- tion of such a factor.

Acknowledgments-We thank Lena Arcinas and Peter Evans for excellent technical support.

REFERENCES Baba, M. L., Goodman, M., Berger-Cohn, J., Demaille, J. G., and Matsuda, G.

(1984) Mol. Biol. Euol. 1, 442-455 Babu, A., Sonnenblick, E., and Gulati, J. (1988) Science 240, 74-76 Billeter, R., Quitschke, W., and Paterson, B. M. (1988) Mol. Cell. Biol. E&1361-

1365 Blau, H. M., Chiu, C. P., and Webster, C. (1983) Cell 32,1171-1180 Bodner, M., and Karin, M. (1987) Cell 50, 269-275 Breathnach, R.! and Chambon, P. (1981) Organization and expression of

eucaryotic spht genes coding for proteins. Annu. Rev. B&hem. 60,349-383 Brutlaa. D.. Clayton. J.. Friedland. P., and Kedes, L. (1982) Nucleic Acids Res.

- - , - - - - _ Buskin, J. N., and Hauschka, S. D. (1989) Mol. Cell. Biol. 9, 2627-2640 Carpenter, C. D., Bmskin, A. M., Harding P. E., Keast, M. J., Anstrom, J.,

Tyner, A. L., Brandhorst, P. B., and Klem, W. H. (1984) Cell 36,663-671 Carroll, S. L., Bergsma, D. J., and Schwartz, R. J. (1988) Mol. Cell. Biol. 8,

‘)Al-!&W Collins, J. H., Graeser, M. L., Potter, J. D., and Horn, M. J. (1977) J. Biol.

Chem. 252,63?-‘=fiv ,Y-““Yl

Corden, J., Wasyl: yk B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C., and ^A.‘. - Chambon, P. (lvwo, science ac -99,1405-1414 Daubas, P., Klarsfeld, A., Garnel r, I., Pinset, C., Cox, R., and Buckingham, M.

(1988) Nucleic Acids Res. l&l L251-1271 Dhoot, G. K., and Perry, S. V. (1~ 979) Nature 278. 714-718 Dhoot, G. K., and Perry, S. V. (1980) Exe. Cell Rek 127,75-87 Donoghue, M., En nst, H., Wentworth, B, Nadal-Ginard,B., and Rosenthal, N.

( 1988) Genes & Deu. 2. 1779-1790 EPI stein; P. N., Christenson, M. A., and Means, A. R. (1989) Mol. Endocrinol.

-3,193-202 E$;&,H. P., Gunning, P., and Kedes, L. (1986) Nucleic Acids Res. 14, 5275-

--- - Evans, T., Schon, E., Gora-Maslak, G., Patterson, J., andEfstratiadis, A. (1984)

NucleicAcids Res. 12,8043-8058 Evans, T., DeChiaram, T., and Efstratiadis, A. (1988) J. Mol. Biol. 199,61-81 Finer, M. H., Fodor, E. J. B., Boedtker, H., and Doty, P. (1984) Proc. Natl.

Acad. Sci. U. S. A. 81,1659-1663 Finer, M. H., Aho, S., Gerstenfeld, L. C., Boedtker, H., and Doty, P. (1987) J.

Biol. Chem. 262.13323-13332 Gahlmann, R., Wade, R., Gunning, P., and Kedes, L. (1988) J. Mol. Biol. 201,

379-391 Gilbert, W. (1978) Nature 2'71,501 Ginsburg, M. in Nucleic Acid and Protein Sequence Analysis; a Practical

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Mofecufor, Cloning: A @wrorory Manual. Cold Sprmg Harbor Laboratory, Cold Sprmg Harbor,

Mar, J. H., and Ordahl, C. P. (1988) Proc. Natl. Acad. Sci. U. S. A. 86, 6404- 6408

Mar, J. H., Antin, P. B., and Ordahl, C. P. (1988) J. Cell Bill. 107,573-585 Means, A. R., Tash, J. S., and Chafouleas, J. G. (1982) Physiol. Rev. 62, l-39 Messing, J. (1983) Methods Enzymol. 101, 20-78 Minty, A., and Kedes, L. (1986) Mol. Cell. Biol. 6, 2125-2136 Minty, A. J., Caravatti, M., Robert, B., Cohen, A., Daubas, P., Weydert, A.,

Gras, F., and Buckingham, M. (1981) J. Biol. Chem. 256,1008-1014 Minty, A., Blau, H., and Kedes, L. (1986) MO!.. Cell. Bin1 6,2137-2148 Mohun, T., Garrett, N., and Treisman, R. (1987) EMBO J. 6,667-673 Moss, R. L., Lauer, M. R., Giulian, G. G., and Graeser, M. L. (1986) J. Biol.

Chem. 261,6096-6099 Muscat, G. E. O., Gustafson, T. A., and Kedes, L. (1988) Mol. Cell. Biol. 8,

4120-41.1.1 Ng, S.-Y., Gunning, P., Liu, S.-H., Leavitt, J., and Kedes, L. (1989) Nucleic

Acids Res. 17,601-615 Nickel, J. M., and Felsenfeld, G. (1983) Cell 36, 467-477 Nikovits, W., Jr., Kuncio, G., and Ordahl, C. P. (1986) Nucleic Acids Res. 14,

x477-.?%ul --.. --“” Nojima, H. (1989) J. Mol. Biol. 208,269-282 Nojima, H., and Sokabe, H. (1987) J. Mol. Biol. 193,439-445 Parmacek, M. S., and Leiden, J. M. (1989) J. Biol. Chem. 264, 13217-13225 Payne, M. R., and Rudnick, S. E. (1989) Trends Biochem. Sci. 14,357-360 Putkey, J. A., Sweeney, H. L., and Campbell, S. T. (1989) J. Biol. Chem. 264,

12370-12378 Ruis-Carrillo, A. (1984) Nucleic Acids Res. 12,6473-6492 Schon, E., Evans, T., Welsh, J., and Efstratiadis, A. (1983) Cell 36,837-848 Simmen, R. C. M., Tanaka, T., Ts’uj, K. F., Putkey, J. A., Scott, M. J., Lai, E.

C., and Means, A. R. (1985a) J. Blol. Chem. 260,907-912 Simmen, R. C. M., Tanaka, T., Ts’ui, K. F., Putkey, J. A., Scott, M. J., Lai, E.

C., and Means, A. R. (198513) J. Bml. Chem. 262,4928-4929 Smith, V. L., Doyle, K. E., Maune, J. F., Munjaal, R. P., and Beckingham, K.

(1987) J. Mol. Biol. 196,471-485 Smoake, J. A., Song, S. Y., and Cheung, W. Y. (1974) Biochim. Biophys. Acta

341.402-411 Sternberg, E. A., Spiss, G., Pew

N. (1988) Mol. ( Toyota, N., and Sl Var

1, W. M., Vizard, D., Weil, T., and Olson, E. Till. Biol. 8, 2896-2909 nimada, Y. (1981) J. Cell Btil. 91,497-504

L Eerd, J. P., and Takahashi, K. (1975) Biochem. Biophys. Res. Commun. 64,122-127

Van Eerd, J. P., and Takahashi, K. (1976) Biochemistry 16, 1171-1180 Waisman, D. M., Stevens, F. C., and Wang, J. H. (1975) B&hem. Biophys.

Res. Commun. 65 Q~.LQw _ , “ . _ 1 - -

Wilkinson, J. M. (--.-, ~. 1980) Eur. J. Biochem. 103.179-188 Yaffe, D., and Saxel, 0. (1977a) Differ&iat& 7,l59-166 Yaffe, D., and Saxel, 0. (197713) Nature 270, 725-727 Young, M. F., Findlay, D. M., Domin es P Burbelo, P. D., McQuillan, C.,

Kopp, J. B., Gehron Robey, P., an f$J ’ :’ Termme, J. D. (1989) J. Biol. &em. 264,450-456

Yutzey, K. E., Kline, R. L., and Konieczny, S. F. (1989) Mol. Cell. Biol. 9,1397- 1405

Zot, A. S., and Potter, J. D. (1987) Annu. Rev. Biophys. Biophys. Chem. 16, 535-559

Documents

Cloning, Structural Analysis, and Expression of the …Cloning, Structural Analysis, and Expression of the Human Fast Twitch Skeletal Muscle Troponin C Gene* (Received for publication,