Efficient production of thermostable Clostridium thermosulfurogenes β-amylase by Bacillus brevis

JOORNAI. Or FER/dZENTATION AND BIOENOtNEERn~6 VOI. 73, No. 2, 112-115. 1992

Efficient Production of Thermostable Clostridium thermosulfurogenes fl-Amylase by Bacillus brevis

MAKOTO MIZUKAMI, 1,2 HIDEO YAMAGATA, I* KENJI SAKAGUCHI, 2 .~D SHIGEZO UDAKA I

Department of Food Science and Technology, Faculty of Agriculture, Nagoya University, Chikusa-ku, Nagoya 464,1 and Nihon Shokuhin Kako Co. Ltd., 3-4-1, Marunouchi, Chiyoda-ku, Tokyo 100, 2 Japan

Received 15 July 1991/Accepted 21 November 1991

The Bacillus brevis host-vector system was used for production of the thermostable Clostridium thermosulfurogenes ~-amylase. The promoter and translation initiation regions of the cell wall protein gene operon (cwp) of B. brevis were used to express the ~-amylase gene in B. brevis 47. B. brevis 47K, a previously isolated mutant that secreted human a-amylase efficiently was shown to be also a good host for the ~-amylase production. When the Clostridium signal peptide was used to direct secretion, 0.3 g of the ~-amylase with a correct NH2-terminus was secreted per liter of medium. When the signal peptide of a B. brevis cell wall protein was used, a very large amount (1.6 g//) of the enzyme was secreted, which is about 60 times larger than that secreted by C. thermosulfurogenes, but the NH2-terminus of the secreted enzyme was heterogeneous. Both enzymes secreted by B. brevis showed almost the same specific activity, thermostability, and ability to bind and to digest raw starch, as those of the C. thermosulfurogenes enzyme.

B-Amylase (EC 3.2.1.2) is an exo-type enzyme that hydrolyzes the a-l,4-glucosidic linkages from the non- reducing end of starch and produces maltose with B-ano- meric configuration. The B-amylase of C. thermosulfurogenes, an anaerobic bacterium, is unique among B- amylases reported because of its very high thermostability (1). The gnzyme shows a high optimum temperature (70°C) for enzyme activity and is stable up to 80°C for several hours. Other B-amylases characterized to date are neither active nor stable at temperatures above 65°C. Because of this feature, this enzyme is considered to be useful for industrial application. However, the enzyme pro- ductivity of C. thermosulfurogenes is very low. Efficient expression of the cloned B-amylase gene in other fast- growing bacteria is desired for the future industrial use of the enzyme.

We developed a novel system for efficient production of heterologous proteins using B. brevis as a host (2). B. brevis secretes vast amounts of proteins into the medium (3). The proteins secreted are composed mainly of two cell wail proteins, outer wall protein (OWP) and middle wall protein (MWP) (4). The genes for OWP and MWP con- stitute a cell wall protein operon named cwp (5). The promoter region of the operon and the signal peptide-encoding region of the MWP gene were used to construct expression-secretion vectors (2). Many bacterial and mam- malian proteins such as a-amylases of Bacillus stearothermophilus (6) and Bacillus licheniformis (7), human epidermal growth factor (8), and human salivary a-amylase (9), were produced efficiently with this system.

Cloning and determination of the nucleotide sequence of the B-amylase gene were described previously (10). In this paper, we describe highly efficient production of C. thermosulfurogenes B-amylase by B. brevis.

MATERIALS A N D METHODS

Bacteria, plasmids, and media B. brevis 47-5 is aura-

* Corresponding author.

cil-requiring mutant isolated from strain 47 (3). B. brevis 47K is a mutant from 47-5 which produces human a- amylase more efficiently (9). Expression-secretion vector pNU200 containing the replication origin of pUBll0 , the erythromycin resistance gene and the promoter and signal peptide-encoding region of the cell wall protein gene of B. brevis 47 was described previously (2). T3MES medium (pH6.0) contained 4g of yeast extract (Difco, Detroit, Michigan, USA), 20g of Polypepton (Nihon Pharma- ceutical, Tokyo), 0.1 g of uracil, 20 g of glucose and 21.3 g of 2-(N-morpholino)ethanesulfonic acid (MES, Dojin, Kumamoto) per liter. Erythromycin was added at 10/~g/ ml when necessary. Transformation of B. brevis was carried out with Tris-PEG method (11).

Construction of the B-amylase expression vectors pMM1 was constructed by inserting the 3.6 kilobase pair (kb) MflI fragment containing the C. thermosulfurogenes B-amylase gene isolated from pNKI (10) into the BamHI site of pNU200. The NcoI site was introduced into the MWP signal peptide-encoding region of pMM1 by replac- ing the A located 13 base pair (bp) upstream from the signal peptide cleavage site by C with the aid of oligonucleotide-directed mutagenesis. This substitution does not change the encoded amino acid sequence. Plasmid pMM2 was constructed from pMM1 by inserting synthetic double strand DNA between the introduced NcoI site and the Avail site located 34 bp downstream from the 5' terminus of the mature t-amylase-encoding sequence. Thus, the complete MWP signal sequence is directly followed by the mature B-amylase sequence on pMM2. Next, BspHI sites were introduced at the translation initiation sites by chang- ing AGATGA to TCATGA in the B-amylase gene on pMM1, and TTATGA to TCATGA in the MWP gene on pMM2 with oligonucleotide-directed mutagenesis. Both plasmids were cut at the BspHI site and a SphI site which is located 335 bp downstream from the initiation codon of the B-amylase gene. The BspHI-SphI fragment on pMM2 was exchanged by the corresponding fragment from pMM1 to obtain pMM3. 5 '-CATGGCTTTCGCTAGCA- TCGCTCCAAACTTCAAAGTTTTCGTTATGG-3 ' and

112

VoL 73, 1992 PRODUCTION OF THERMOSTABLE ,0-AMYLASE BY B. BREVIS 113

5'-GACCCATAACGAAAACTTTGAAGTTTGGAGCGA- TGCTAGCGAAAGC-3' used to construct pMM2, and 5'-GAACACAAGGTCATGAAAAAGGTC-3' and 5'-GG- AAAATAAAAATTCATGATGATI'GGAGC-3' used to construct pMM3 were synthesized at the Center for Gene Re- search of Nagoya University.

Purification of d-amylase produced by B. brevis and C. thermosulfurogenes The d-amylase from C. thermosulfurogenes was purified after the procedure described by Shen et al. (12). For the purification of the enzyme produced by B. brevis, the procedure was slightly modified. B. brevis 47K carrying pMM1, pMM2 or pMM3 was grown for 4 d at 37°C in 1 I of T3MES medium. After centrifugation, proteins contained in the supernatant were precipitated by addition of (NH4)2SO4 to 80%. Precipitated proteins were dissolved into 100 ml of 50 mM imidazole buffer (pH 6.0) containing 5 mM CaCI2, and then incu- bated at 70°C for 30 min. After centrifugation at 7500 g for 20min at 4°C, the supernatant was applied to a DEAE-cellulose column (Whatman, DE52, 27 x 300 mm) previously equilibrated with imidazole buffer. Proteins in the unadsorbed fraction were precipitated by (NH4)2SO4 (80%) and then redissolved into 5 ml of imidazole buffer. The solution was subjected to gel filtration using a Sephacryl S-200 column (Pharrfiacia, 16x700mm). d- Amylase positive fractions were pooled, concentrated to 7 ml with 80% (NH4)2SO 4 as above and dialysed against the same buffer. The NH2-terminal sequence was determined by a gas-phase protein sequencer (model 477 A; Applied Biosystems).

Enzyme assay The enzyme was assayed in a reaction mixture (0.5ml) containing boiled soluble starch [1% (w/v)] and sodium acetate buffer (50 raM, pH 6.0). The reaction was carried out at 70°C for 10 min. Reducing sugar released by enzymatic hydrolysis of soluble starch was determined by the dinitrosalicylic acid method (13). One unit of d-amylase was defined as the amount of enzyme that produces 1 pmol of reducing sugar as maltose per minute. Protein was determined by the method of Lowry et al. (14) with bovine serum albumin as a standard.

Raw starch adsorption and digestion Twenty mg of corn starch was washed 2 times with 50 mM acetate buffer, pH 6.0, and then suspended in 200/zl of acetate buffer containing 18.56pg of the enzyme. The suspension was kept for 15 min at 4°C. After centrifugation at 1400g for 10 min at 4°C, the enzyme activity of the supernatant was determined and then the adsorption percentage was calcu- lated. To determine the activity to digest raw starch, 50 mg of corn starch was suspended in 2 ml of acetate buffer containing 1.5 U of the enzyme. The suspension was kept for 40 h at 37°C with slow shaking and then the released reducing sugar was determined by the dinitrosalicylic acid method.

RESULTS AND DISCUSSION

Structures of the fl-amylase expression vectors Three plasmids pMMI, pMM2 and pMM3 were constructed to express efficiently the Clostridium d-amylase gene in B. brevis with the aid of the cwp promoter (Fig. 1. Detailed construction procedures are described in Mate- rials and Methods). Plasmid pMM1 was constructed by inserting a C. thermosulfurogenes DNA fragment containing the d-amylase gene into the BamHI site located downstream of the cwp promoter of pNU200 (2). The in- sert corltained 560bp and 1428bp untranslated regions

pMMI:

0,6kb 0.56kb 1.6kb 1.4kb

q l :;: . . . . . . . . ;

pMM2: :: i [mC.~m~-.- -anlv

p M M 3 : - - - ~ D '~sP ~ ..... ~-Am, W J - -

FIG. 1. Schematic representation of plasmids constructed. All plasmids were derived from pNU200 which contains the promoter region of the cell wall protein operon (cwp) of B. brevis. Only the structures of the inserted C. thermosulfurogenes DNA in conjunction with the cwp protnoter are shown. Thin lines denote pNU200. Open boxes indicate the promoter region of the cwp operon followed by the 5' region of the middle wall protein (MWP) gene of B. brevis. Thick lines and hatched boxes denote the untranslated region and the d- amylase gene (d-Amy) of C. thermosulfurogenes. P, promoter; SD, ribosome binding site; SP, signal peptide-encoding region. On pMM 1, the ,0-amylase gene has its own ribosome binding site and the signal sequence. On pMM2, the ribosome binding site and signal sequence of MWP are utilized. On pMM3, the ribosome binding site of the MWP gene and the original signal sequence of the .B-amylase are used.

located upstream and downstream of the d-amylase gene, respectively. Plasmid pMM2 was constructed from pMM1 to utilize the signal peptide of MWP as well as the cwp promoter. On pMM2, the mature d-amylase-encoding sequence was directly connected to the MWP signal peptide- encoding region. Plasmid pMM3 was constructed to use the original signal peptide of the d-amylase under control of the cwp promoter and the MWP ribosome binding site. The d-amylase gene was recombined with the MWP gene at their initiation codon, ATG, using the BspHI sites introduced in the both genes. Plasmid pMM3 differs from pMM2 only in the signal peptide-encoding sequence.

Production of thermostable //-amylase in B. brevis B. brevis harboring the plasmids were grown in T3MES medium at 37°C. MES-buffer was added to keep the pH of the culture medium neutral. The time course of extracellular d-amylase production is shown in Fig. 2. Among the three plasmids, pMM1 gave the least effÉcient production of d-amylase. The 560 bp region located between the cwp promoter and the d-amylase gene might interfere with transcription and/or translation. B. brevis 47-5 carrying pMM1 or pMM2 produced the enzyme less efficiently than B. brevis 47K carrying the same plasmid. This indicates that the mutation (s) carried by 47K facilitated not only the production of human a-amylase as described previously (9), but also that of Clostridium d-amylase. Therefore, B. brevis 47K should be useful for production of other heterologous proteins.

B. brevis 47K carrying pMM3 produced 520 units of the enzyme per ml of medium. Plasmid pMM2 directed higher production than pMM3, indicating that the signal peptide of MWP directed secretion of the d-amylase more efficiently than the signal peptide of the Clostridium d-amylase in B. brevis. The amount of extracellular d-amylase produced by B. brevis 47K carrying pMM2 continued to increase for 6 d and stayed almost constant thereafter. Maximum level of d-amylase was 2,600units/ml. The enzyme was the most abundant protein in the culture medium after 6 d

114 MIZUKAMI ET AL. J. FERMENT. BIOENG.,

8"

Q . 7 '

6 E r. 18"

1 2

3000

2000'

1000'

E

r o

E

L U

• ! ! • ! •

! ! ' !

D O

v i • ~ •

2 4 6

D a y s

FIG. 2. Time course of the production of,B-amylase by B. brevis. Bacteria were grown in T3MES at 37°C. Portions were taken at inter- vals and assayed for extracellular fl-amylase activity. Symbols: [], B. brevis 47K carrying pMM2; ×, B. brevis 47-5 carrying pMM2; ©, B. brevis 47K carrying pMM3; ", B. brevis 47K carrying pMM1; A, B. brevis 47-5 carrying pMMI. Cell growth (optical density at 660 nm) and the pH of the medium of B. brevis 47K carrying pMM2 are shown in the upper part of the figure.

(Fig. 3). This amount of enzyme is 60 times higher than that reported by Shen et al. (46 uni ts /ml) , which was at- tained by using the hyper productive mutant of C. thermosulfurogenes (15). The amount , 2,600 units, corresponds to 1.6rag of the purified enzyme (see below). To our knowledge, such highly efficient product ion of an extracellular enzyme of an anaerobic bacter ium has never been reported.

Enzyme purification and NH2-terminal sequence analysis fl-Amylases produced by B. brevis 47K carrying pMM 1, pMM2 and pMM3, and by C. thermosulfurogenes were purified as described in Materials and Methods. The results of purification of the enzyme produced by B. brevis 47K carrying pMM2 are summarized in Table 1. Heat t reatment at 70°C for 30 min was an effective process for purification of the thermophil ic enzyme produced in B. brevis. The same procedure was also effective for purifica- t ion of thermophil ic f l - isopropylmalate dehydrogenase produced in Escherichia coli (16). The purified enzymes

1 2 3 4

9 4 k

67 k

4 3 k

FIG. 3. SDS-polyacrylamide gel electrophoresis of the culture supernatant of B. brevis 47K carrying pMM2. Lanes: l, molecular weight marker proteins; 2, fl-amylase purified from C. thermosulfurogenes; 3 and 4, culture supernatant of B. brevis 47K carrying pMM2 after 6 d of incubation at 37°C (l and 2pl, respectively).

gave a single band on sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (Fig. 4).

The 10 amino acid sequences of the NH2-termini of fl- amylases produced by B. brevis 47K carrying pMM1 and pMM3 were determined. The sequences were the same as that of mature/~-amylase of C. thermosulfurogenes (Ser- I le-Ala-Pro-Asn-Phe-Lys-Val-Phe-Val) , indicating that the Clostridium signal peptide was correctly cleaved in B. brevis. On the other hand, analysis of the NH2-terminal sequence of the enzyme produced by B. brevis 47K carrying pMM2 suggested that the M W P signal peptide was cleaved at irregular positions. The major cleavage product seemed to have an NH2-terminal sequence Ala-Phe-Ala-fol lowed by the correct NH2-terminal sequence of the mature fl-amylase. Ala-Phe-Ala is the COOH-termina l sequence of M W P signal peptide. Since pMM2 directed the most efficient product ion of the fl-amylase in B. brevis, the M W P signal peptide should be recognized efficiently by the B. brevis secretory machinery. However, recognit ion of the cleavage site by signal peptide cleaving enzyme seemed to be affected by the mature fl-amylase fused to the signal peptide. Nevertheless, the fl-amylase produced showed the same enzymatic propert ies as those of Clostridium enzyme irrespective of its irregular NH2-terminus (see below).

Properties of the enzyme produced by B. brevis The specific activities of the purified enzyme were 1,600

TABLE 1. Purification of fl-amylase produced by B. brevis 47 K containing pMM2

Steps Total Total Specific activity Yield protein activity (mg) (units) (units/mgprotein) (%)

Culture broth 7250 453000 63 100 (NH4)2SO4 ppt. (80%) 1220 276000 227 61 Heat treatment (70°C, 30min) 426 229000 538 51 DEAE Cellulose (DE52) 104 69000 669 15 Sephacryl S-200 37 59800 1630 13

1 2 3 4 5 1.0

9 4 k . .

~ , ~ 2 . . . , : ~ ~ ~ !~:" ..'.:,~ '

FIG. 4. SDS-polyacrylamide gel electrophoresis of the purified`o- amylases, fl-Amylases purified from culture supernatants of C. thermosulfurogenes (lane 2), B. brevis 47K carrying pMMI (lane 3), B. brevis 47K carrying pMM2 (lane 4), and B. brevis 47K carrying pMM3 (lane 5) were electrophoresed on 10~-polyacrylamide gel and stained with Coomassie bril l iant blue. Lane ! is molecular weight marker proteins.

0.4

08

' - 0.6

0.2 O

0.0

VOL. 73, 1992 PRODUCTION OF THERMOSTABLE ,0-AMYLASE BY B. BREVIS 115

45 55 65 75 5 Temperature (*C)

FIG. 5. Effect of temperature on the activity of fl-amylases. The enzyme activity was assayed as described under Materials and Methods. Symbols; D, fl-amylase produced by C. thermosulfurogenes; <3 and • , fl-amylase produced by B. brevis 47K carrying pMM2 and pMM3, respectively.

u n i t s / m g prote in i r respect ive o f the enzyme sources. This value is lower than that repor ted by Shen et al. (4215 u n i t s / m g , ref. 12). The reason for the d iscrepancy is not clear. F igure 5 shows the effect o f t empera tu re on the act ivi ty o f the purified p-amylases . The f l-amylases produced by B. brevis showed similar t empera tu re op t ima as that o f Clostr idium enzyme (70°C). The CIostridium fl- amylase is known to adsorb and digest raw starch (17). The enzyme p roduced by B. brevis also showed these activities. U n d e r the condi t ions descr ibed in Mater ia ls and Methods , 98% o f the enzyme was adsorbed on raw corn starch. The value was c o m p a r a b l e with that o f the Clostr idium fl- amylase (17). Both o f the enzymes p roduced by B. brevis and CIostr idium released abou t 2 m m o l o f reducing sugar f rom excess starch af ter 40 h incuba t ion at 37°C.

Thus the f l -amylase p roduced by B. brevis showed a lmos t the . same enzymat ic proper t ies as those o f CIostri- d ium enzyme. The B. brevis hos t -vec tor system should be useful for p roduc t i on o f large a m o u n t s o f the active enzyme. This opens possibil i t ies for industr ia l appl ica t ion o f this un ique the rmos tab le f l -amylase.

REFERENCES

1. Hyun, H. H. and Zeikus, J. G.: General biochemical characterization of thermostable extracellular p-amylase from CIostridium thermosulfurogenes. Appl. Environ. Microbiol., 49, 1162-1167 (1985).

2. Udaka, S., Tsukagoshi, N., and Yamagata, H.: Bacillus brevis, a host bacterium for efficient extracellular production of useful proteins. Biotechnol. Genetic Eng. Rev., 7, 113-146 (1989).

3. Udaka, S.: Extracellular production of proteins by microorgan- ism. Part 1. Screening for protein producing bacteria. Agric. Biol. Chem., 40, 523-528 (1976).

4. Ohmizu, H., Tsukagoshi, N., Udaka, S., Kaneda, N., and Yagi, K.: Major proteins released by a protein-producing bacterium, Bacillus brevis 47, are derived from cell wall protein. J. Bio- chem., 94, 1077-1084 (1983).

5. Tsuboi, A., Uchihi, R., Tabata, R., Takahashi, Y., Hashiba, H., Sasaki, T., Yamagata, H., Tsukagoshi, N., and Udaka, S.: Characterization of the genes coding for two major cell wall proteins from protein-producing Bacillus brevis 47: complete nucleo-

tide sequence of the outer wall protein gene. J. Bacteriol., 168, 365-373 (1986).

6. Tsukagoshi, N., Iritani, S., Sasaki, T., Takemura, T., Ihara, H., Idota, Y., Yamagata, H., and Udaka, S.: Efficient synthesis and secretion of a thermophilic a-amylase by protein-producing Bacil- lus brevis 47 carrying the Bacillus stearothermophilus amylase gene. J. Bacteriol., 164, 1182-1187 0985).

7. Yamagata, H., Adachi, T., Tsuboi, A., Takao, M., Sasaki, T., Tsukagoshi, N., and Udaka, S.: Cloning and characterization of the 5' region of the cell wall protein gene operon in Bacillus brevis 47. J. Bacteriol., 169, 1239-1245 (1987).

8. Yamagata, H., Nakahama, K., Suzuki, Y., Kakinuma, A., Tsukagoshi, N., and Udaka, S.: Use of Bacillus brevis for efficient synthesis and secretion of human epidermal growth factor. Proc. Nat. Acad. Sci. USA, 86, 3589-3593 0989).

9. Konishi, H., Sato, T., Yamagata, H., and Udaka, S.: Efficient production of human a-amylase by a Bacillus brevis mutant. Appl. Microbiol. Biotechnol., 34, 297-302 (1990).

10. Kitamoto, N., Yamagata, H., Kato, T., Tsukagoshi, N., and Udaka, S.: Cloning and sequencing of the gene coding thermophilic p-amylase of Clostridium thermosulfurogenes. J. Bacte- riol., 170, 5848-5854 (1988).

II. Takahashi, W., Yamagata, H., Yamaguchi, K., Tsukagoshi, N., and Udaka, S.: Genetic transformation of Bacillus brews 47, a protein-secreting bacterium, by plasmid DNA. J. Bacteriol., 156, 1130-1134 (1983).

12. Shen, G.-J., Saha, B. C., Lee, Y.-E., Bhatnagar, L., and Zeikus, J .G. : Purification and characterization of a novel thermostable ,0-amylase from CIostridium thermosulfurogenes. Biochem. J., 254, 835-840 (1988).

13. Murao, S., Ohyama, K., and Arai, M.: `0-Amylase from Bacillus polymyxa no. 72. Agric. Biol. Chem., 43, 719-726 (1979).

14. Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randall, R.J. : Protein measurement with the Folin phenol reagent. J. Biol. Chem., 193, 265-275 (1951).

15. Hyun, H.H. and Zeikus, J.G.: Regulation and genetic en- hancement of `0-amylase production in Clostridium thermosulfurogenes. J. Bacteriol., 164, 1162-1170 (1985).

16. Nagahari, K., Koshikawa, K., and Sakaguchi, K.: Cloning and expression of the leucine gene from Thermus thermophilus in Es- cherichia coil Gene, 10, 137-145 (1980).

17. Saha, B. C. and Shen, G.-J.: Behavior of a novel thermostable`0, amylase on raw starch. Enzyme Microb. Technol., 9, 598-601 (1987).

Documents

Efficient production of thermostable Clostridium thermosulfurogenes β-amylase by Bacillus brevis