of 134 /134
Morphologische und entwicklungsgenetische Studien zur Blattentwicklung und Blattevolution bei Gymnospermen am Beispiel Sciadopitys verticillata (THUNB.) SIEBOLD & ZUCC. Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie der Ruhr-Universität Bochum angefertigt im Lehrstuhl für Evolution und Biodiversität der Pflanzen vorgelegt von Diplom-Biologin Nicole Hille aus Dortmund Bochum 2008

Morphologische und entwicklungsgenetische Studien zur ... · Morphologische und entwicklungsgenetische Studien zur Blattentwicklung und Blattevolution bei Gymnospermen am Beispiel

  • Author
    others

  • View
    4

  • Download
    0

Embed Size (px)

Text of Morphologische und entwicklungsgenetische Studien zur ... · Morphologische und...

  • Morphologische und entwicklungsgenetische Studien zur

    Blattentwicklung und Blattevolution bei Gymnospermen

    am Beispiel Sciadopitys verticillata (THUNB.) SIEBOLD & ZUCC.

    Dissertation

    zur Erlangung des Grades

    eines Doktors der Naturwissenschaften

    der Fakultt fr Biologie und Biotechnologie

    der Ruhr-Universitt Bochum

    angefertigt im

    Lehrstuhl fr Evolution und Biodiversitt der Pflanzen

    vorgelegt von

    Diplom-Biologin

    Nicole Hille

    aus

    Dortmund

    Bochum 2008

  • Referent: Prof. Dr. Th. Sttzel

    Korreferent: Prof. Dr. R. Tollrian

  • Das Gras wchst nicht schneller

    wenn man daran zieht.

    Afrikanisches Sprichwort

  • fr meine Eltern

  • INHALTSVERZEICHNIS

    i

    INHALTSVERZEICHNIS

    INHALTSVERZEICHNIS ............................................................................................ i ABBILDUNGSVERZEICHNIS ..................................................................................... iv ABKRZUNGSVERZEICHNIS .................................................................................... vi 1 EINLEITUNG ...................................................................................................... 1

    1.1 Der pflanzliche Bauplan ........................................................................................................ 1

    1.1.1 Das Meristem ............................................................................................................... 1

    1.1.2 Bltter & Kurztriebe ..................................................................................................... 3

    1.1.3 Ausgangspunkt: Doppelnadel-Problematik ................................................................ 4

    1.2 Entwicklungsgenetische Lsungsanstze ............................................................................ 8

    1.2.1 Pflanzliche Knox-Gene ................................................................................................ 10 1.2.2 Knox-Expression & der pflanzliche Bauplan ............................................................... 13

    1.3 in-situ-Hybridisierung ............................................................................................................ 16 1.4 Ziel der Arbeit ....................................................................................................................... 17

    2 MATERIAL & METHODEN ..................................................................................... 19

    2.1 Pflanzenmaterial .................................................................................................................... 19

    2.1.1 Materialsammlung ....................................................................................................... 19

    2.1.2 Anzucht der Keimlinge ................................................................................................ 20

    2.2 Morphologisch-anatomische Methoden ............................................................................... 20

    2.2.1 Fixierung ...................................................................................................................... 20

    2.2.2 Mikrotomtechnik .......................................................................................................... 20

    2.2.3 Rasterelektropnenmikroskopie (REM) ......................................................................... 23

    2.3 Molekulargenetische Methoden ........................................................................................... 24

    2.3.1 Allgemeines . ................................................................................................................ 24

    2.3.1.1 Primerdesign ................................................................................................... 24

    2.3.1.2 Sequenzanalyse .............................................................................................. 24

    2.3.2 Material fr Molekulargenetische Methoden ............................................................... 24 2.3.2.1 Oligonukleotide ............................................................................................... 26

    2.3.2.2 Plasmide ......................................................................................................... 27

    2.3.2.3 Bakterienstmme ............................................................................................ 27

    2.3.2.4 Kits .................................................................................................................. 28

    2.3.2.5 Lsungen......................................................................................................... 28

    2.3.3 Isolierung von RNA & DNA aus Pflanzen .................................................................... 29

    2.3.4 Konzentrationsbestimmung von Nukleinsuren .......................................................... 30

  • INHALTSVERZEICHNIS

    ii

    2.3.5 cDNA-Synthese ........................................................................................................... 30

    2.3.6 PCR - Amplifikation von DNA-Fragmenten .................................................................. 31

    2.3.7 Agarose-Gelelektrophorese ......................................................................................... 32

    2.3.8 Isolierung von DNA-Fragmenten aus Agarosegelen .................................................. 32

    2.3.9 Ligation von DNA-Fragmenten..................................................................................... 32

    2.3.10 Kultivierung von E. coli .............................................................................................. 33 2.3.11 Prparation von Plasmid-DNA aus E. coli.................................................................. 34 2.3.12 Verdau von DNA mittels Restriktionsendonukleasen................................................. 34

    2.3.13 DNA-Fllung (Phenolextraktion)................................................................................. 34

    2.3.14 in-vitro-Transkription: Herstellung Digoxigenin-markierter RNA-Sonden .................. 35 2.3.15 Expressionsnachweis im Gewebe in-situ-Hybridisierung ...................................... 36

    2.3.15.1 Fixieren & Schneiden des Gewebes ............................................................. 37

    2.3.15.2 Prhybridisierung .................... .................................................................... 38

    2.3.15.3 Hybridisierung .............................................................................................. 40

    2.3.15.4 Waschen nach der Hybridisierung................................................................ 41

    2.3.15.5 Detektion des Signals ................................................................................... 41

    2.3.15.6 Reaktionsstop ................................................................................................ 42

    2.3.16 Heterologe Expression in E. coli ............................................................................... 42

    2.4 Dokumentation ...................................................................................................................... 43

    2.4.1 Mikroskopie & Bilderfassung ....................................................................................... 43

    2.4.2 Digitalfotografie ........................................................................................................... 44

    2.4.3 Bildbearbeitung ........................................................................................................... 44

    3 ERGEBNISSE ..................................................................................................... 45

    3.1 Morphologisch-anatomische Ausgangsbasis ...................................................................... 45

    3.1.1 Morphogenese ............................................................................................................ 45 3.1.1.1 Sciadopitys verticillata - Kladodienentwicklung ............................................. 45 3.1.1.2 Abies homolepis - Nadelentwicklung ............................................................. 47

    3.1.2 Leitbndelanschluss ................................................................................................... 49 3.1.2.1 Sciadopitys verticillata .................................................................................... 49 3.1.2.2 Abies homolepis ............................................................................................. 50 3.1.2.3 Pinus sylvestris ............................................................................................... 51

    3.1.2 Anatomie der Sciadopitys-Kladodien ......................................................................... 52 3.1.3 Untersuchungen an Sciadopitys-Keimlingen .............................................................. 53

    3.2 Primerdesign ......................................................................................................................... 60

    3.3 Vorwort zu Methodenetablierung .......................................................................................... 63

    3.3.1 Nukleinsuregewinnung aus Gymnospermen ............................................................ 63

    3.3.2 KNAT1 Arabidopsis thaliana .................................................................................... 64 3.3.3 HBK1 Picea abies ..................................................................................................... 67

    3.4 Molekulargenetische Anstze im Sciadopitys-Modell........................................................... 69

    3.4.1 Funktionalittstest mit PhyN1 ...................................................................................... 69 3.4.2 Test zur Synthese von cDNA ....................................................................................... 70

    3.4.3 SvKnox Suche nach Knox-Genen mit degenerierten Primern ................................. 70

  • INHALTSVERZEICHNIS

    iii

    3.4.4 Sondenherstellung fr SvKnox .................................................................................... 75

    3.5 Expressionsnachweis fr SvKnox ......................................................................................... 77

    3.5.1 in-situ-Hybridisierung Methodisch ........................................................................... 77 3.5.1.1 Fixieren & Schneiden des Gewebes .............................................................. 78

    3.5.1.2 Prhybridisierung ........................................................................................... 80

    3.5.1.3 Hybridisierung ................................................................................................ 81

    3.5.1.4 Waschschritte ................................................................................................. 82

    3.5.1.5 Detektion des Signals ..................................................................................... 82

    3.5.1.6 Reaktionsstop ................................................................................................. 84

    3.5.2 in-situ-Hybridisierung Inhaltlich ................................................................................ 84 3.5.2.1 Expression in vegetativen Knospen ............................................................... 85

    3.5.2.2 Expression in Blttern ..................................................................................... 88

    3.5.3 Heterologe Expression von SvKnox ............................................................................ 91

    3.6 Knox-Suche in Phyllocladus trichomanoides ....................................................................... 92

    4 DISKUSSION ...................................................................................................... 94

    4.1 Morphologische Ausgangssituation ..................................................................................... 94

    4.2 Keimlingsentwicklung ........................................................................................................... 99

    4.3 Methodenetablierung ............................................................................................................ 100

    4.4 Knox & Sciadopitys ............................................................................................................... 101 4.5 Ursprung des Gymnospermenblattes .................................................................................. 105

    4.6 Ausblick ................................................................................................................................ 106

    5 ZUSAMMENFASSUNG .......................................................................................... 108 6 LITERATURVERZEICHNIS ...................................................................................... 110 7 ANHANG ........................................................................................................... 116

    DANKSAGUNG

    LEBENSLAUF

    ERKLRUNG

  • ABBLIDUNGSVERZEICHNIS

    iv

    ABBILDUNGSVERZEICHNIS

    Abb. 1: Schematische Darstellung zum pflanzlichen Grundbauplan. ....................... 2

    Abb. 2: Schematische Darstellung der Triebdifferenzierung bei Gymnospermen. ... 3

    Abb. 3: S. verticillata, Theorien zur Doppelnadel-Problematik. .................................. 4

    Abb. 4: S. verticillata, Habitus. ................................................................................... 5

    Abb. 5: Morphologische Gegenberstellung von S. verticillata & A. homolepis. ....... 7

    Abb. 6: Thuja plicata, Schematische Darstellung des Sprossquerschnittes. ............ 8

    Abb. 7: Schema zur unterschiedlichen Einflussnahme von KNOX-Transkriptions-

    faktoren auf die Wachstumsregulierung. ....................................................... 11

    Abb. 8: Schematischer Aufbau eines KNOX-Proteins. ............................................... 12

    Abb. 9: Schematische Darstellung zum Scheitelmeristem (SAM). ............................. 14

    Abb. 10: S. verticillata, Kladodienentwicklung. ............................................................ 46

    Abb. 11: S. verticillata, Langtriebachse mit Schuppenblttern. ................................... 47

    Abb. 12: A. homolepis, Nadelentwicklung. .................................................................. 48

    Abb. 13: S. verticillata, Leitbndelanschluss der Kladodien. ....................................... 49

    Abb. 14: A. homolepis, Leitbndelanschluss eines Nadelblattes. ............................... 50

    Abb. 15: P. sylvestris, Leitbndelanschluss eines Kurztriebes. ................................... 51

    Abb. 16: S. verticillata, Kladodium im Querschnitt. ...................................................... 52

    Abb. 17: S. verticillata, reifer Same. ............................................................................. 54

    Abb. 18: Keimungsreihe I: Fotodokumentation der Keimungsreihe K4. ...................... 56

    Abb. 19: Keimungsreihe II: Schema & Lichtmikroskopische Aufnahmen (K4). ........... 57

    Abb. 20: Keimungsreihe III: Fotodokumentation lterer Keimlinge aus K2. ................. 58

    Abb. 21: Mikroskopische Aufnahmen zur Anlage der Primordien am Vegetations-

    kegel. ............................................................................................................. 59

    Abb. 22: Aminosurenalignment zu Knox-Gensequenzen der Klasse 1. .................... 62

    Abb. 23: A. thaliana, cDNA-Synthese von KNAT1 & Klonierungskontrolle durch

    Restriktion. ..................................................................................................... 65

    Abb. 24: A. thaliana, Primertest mit KNAT1-Fragment. ................................................ 66

    Abb. 25: P. abies, Schema zum Primertest fr dP-SvKnox und HBK1-Teilfragment. .. 68

    Abb. 26: P. abies, Restriktionskontrolle fr 359 bp-Insert. ........................................... 68

    Abb. 27: S. verticillata, Primertest mit PhyN1-Fragment (579 bp) & Kontrolle der

    cDNA-Synthese. ............................................................................................. 69

    Abb. 28: S. verticillata, cDNA-Synthese mit dP-SvKnox & Klonierungskontrolle. ........ 71

    Abb. 29: Schema der ermittelten Sciadopitys-Sequenz im Vergleich zur KNOX-

    Proteinsequenz von P. abies (HBK1). ............................................................ 74

  • ABBLIDUNGSVERZEICHNIS

    v

    Abb. 30: S. verticillata, Testgel zur Sondenherstellung. ............................................... 75

    Abb. 31: S. verticillata, in-vitroTranskription & Dot Blot. ............................................. 77

    Abb. 32: Sciadopitys-Gewebe nach Proteinase K-Behandlung. ................................. 80

    Abb. 33: Detektionslsung: Gewebe mit Rckstnden des Frbesubstrats. ............... 83

    Abb. 34: S. verticillata, in-situ-Hybridisierung an Lngsschnitten vegetativer

    Knospen 6 Monate alter Keimlinge (I). .......................................................... 86

    Abb. 35: S. verticillata, in-situ-Hybridisierung an Lngsschnitten vegetativer

    Knospen 6 Monate alter Keimlinge (II). ......................................................... 87

    Abb. 36: S. verticillata, in-situ-Hybridisierung an Lngsschnitten des terminalen

    Sprossabschnittes 10 Wochen alter Keimlinge. ............................................ 89

    Abb. 37: S. verticillata, in situ-Hybridisierung an Querschnitten von Keimblttern. .... 90

    Abb. 38: Heterologe Expression von SvKnox. .............................................................. 91

    Abb. 39: P. trichomanoides, cDNA-Synthese mit dP-SvKnox & Klonierungskontrolle. 92

    Abb. 40: Schema der ermittelten Phyllocladus-Sequenz. ............................................ 93

    Abb. 41: Sciadopitys-Kladodium und Nadelbltter im schematischen Querschnitt. ... 95

    Abb. 42: Schema zur Transformationsreihe & Variabilitt triebdifferenzierter

    Systeme. ........................................................................................................ 97

    Abb. 43: Schema zu genetischen Interaktionen am Scheitelmeristem. ....................... 99

    Abb. 44: Schematische Darstellung ausgewhlter Typen von Expressionsmustern

    im Scheitelmeristem. ...................................................................................... 104

    Abb. 45: Demonstration hypothetischer Expressionsmuster an REM-Aufnahmen

    von A. homolepis & P. trichomanoides. ......................................................... 105

    ---

    A1: Aminosurenalignment zu Knox-Gensequenzen der Klassen 1&2. ................. 117

    A2: Verifizierung der aus SvKnox abgeleiteten Aminosurensequenz eines

    Homodomnen-Proteins der KNOX-Familie & der dazugehrigen

    Nukleotidsequenz. ............................................................................................ 118

    A3: S. verticillata, Astrablau-Safranin gefrbte Blattquerschnitte. .......................... 119

    A4: S. verticillata, in-situ-Hybridisierung an Querschnitten von Primrblttern. ...... 120

  • ABKRZUNGSVERZEICHNIS vi

    ABKRZUNGSVERZEICHNIS

    AK Antikrper AP Alkalische Phosphatase AS Aminosure(n) BP Brevipedicellus, KNAT1 bp Basenpaare BSA Bovine (Rinder-) Serum

    Albumin C Cuticula cDNA komplementre DNA DEPC Diethyl-Pyrocarbonat DIG Digoxigenin DNA Desoxyribonukleinsure DNase Desoxyribonuklease (d)NTP (Desoxy-)Ribonukleosid

    Triphosphat dP degenerierter Primer ds DNA doppelstrngige DNA E Epidermis E. coli Escherichia coli EDTA Ethylendiamintetraacetat Em Embryo En Endosperm (primres) Es Embryosack FAA (FAE) Formalin-Alkohol-Eisessig for forward (5-3-Orientierung) H Hypodermis Ha Haare HBK Homeobox of KNOX class Hi Hilum HK Harzkanal Hy Hypokotyl IPTG Isopropylthiogalactosid K Kladodium kb Kilobasen KN1 Knotted1 KNAT Knotted-like aus A. thaliana KNOX Knotted1-like homeobox Ko Kotyledon/Keimblatt Kp Kladodienprimordium Ks Knospenschuppe KSp Kladodienspur KT Kurztrieb(achse) LB Leitbndel LS Leitbndelscheide LT Langtrieb(achse) M Marker MIA Multiple Image Alignment mRNA Messenger RNA

    NBT/BCIP Nitroblau-Tetrazoliumsalz/

    5-Bromo-4-Chloro-3-Indolylphosphat

    NCBI National Center for Biotechnology Information

    Np Nadel(blatt)primordium NSp Nadel(blatt)spur OD Optische Dichte P Primrblatt p. a. per analysis, zur Analyse Pa Papillen PBS Sodium-Phosphat-Puffer PCR Polymerase-Kettenreaktion PFA Paraformaldehyd(-Fixierung) Pp Palisadenparenchym pW Primrwurzel Pwo Pyrococcus woesei Ra Radicula/Keimwurzel REM Rasterelektronenmikroskopie rev. reverse (3-5-Orientierung) RNA Ribonukleinsure (RNS) RNase Ribonuklease rpm Umdrehungen pro Minute S Stomata SAM shoot apical meristem (Scheitelmeristem) Sb Schuppenblatt SDS-PAGE Natriumdodecylsulfat-

    Polyacrylamid-Gelelektrophorese

    Sp Schwammparenchym SR Stomatareihe Su Suspensor T Testa TALE Three Amino Acid Loop

    Extension (PYP) TBE Tris-Borat-EDTA-Puffer Taq Thermus aquaticus u unit (funktionelle Einheit) . N. ber Nacht UTP Uridintriphosphat VK Vegetationskegel Wh Wurzelhals X-Gal 5-Brom-4-chlor-3-indolyl--D-

    galactopyranosid ZSp Zweigspur

  • EINLEITUNG 1

    1 EINLEITUNG

    1.1 Der pflanzliche Bauplan

    Pflanzen sind ohne die Mglichkeit eines spontanen Standortwechsels im Unterschied zu

    Tieren gezwungen, sich den jeweiligen Standortbedingungen mit allen Vor- und

    Nachteilen anzupassen. Bei Pflanzen gleicher genetischer Konstitution kann die

    phnotypische Ausprgung standortbedingt sehr variabel ausfallen. Im Verlauf der

    pflanzlichen Entwicklung wird nur ein grundlegender Bauplan angelegt, der sich aus

    Wurzel und Spross (= Sprossachse + Bltter) bzw. den drei universellen vegetativen

    Grundorganen Wurzel, Sprossachse und Blatt zusammensetzt (Abb. 1). Die pflanzliche

    Entwicklung zeichnet sich durch die Fhigkeit zur kontinuierlichen Anlage neuer Organe

    aus, die auf der Aufrechterhaltung der meristematischen Aktivitt in bestimmten

    Bereichen des Pflanzenbauplans, den so genannten Meristemen, beruht. Ein Teil dieser

    meristematischen Zellen bleibt das Pflanzenleben lang undifferenziert, whrend ein Teil

    der Zellen ausdifferenziert und die Anlage lateraler Organe (z. B. Bltter) initiiert. Die

    Grundlagen fr ein besseres Verstndnis der Diversitt und Komplexitt im Laufe der

    Evolution (z. B. der Bauplne der Landpflanzen) werden unter dem Schlagwort evo-

    devo bzw. evodevotics (evolutionary developmental biology) als einer neuen Disziplin,

    zusammengefasst (THEISSEN et al, 2000; RAFF, 2000 & RAFF, 2007). Die Anstze liegen

    darin die morphologischen Vernderungen im Organismus ber die Zeit mit

    verschiedenen Disziplinen und aus verschiedenen Ansatzrichtungen zu betrachten und

    zu einer gemeinsamen Aussage zu verbinden. Fr Einblicke in die Evolution und deren

    Formenvielfalt ist u. a. das Verstndnis so genannter Entwicklungskontrollgene mit

    entscheidend (SINGER & ASHTON, 2007).

    1.1.1 Das Meristem

    Der grundlegende Pflanzenbauplan wird schon im Zuge der Embryogenese festgelegt

    und nicht verndert. Die ersten Organisationsschritte konzentrieren sich auf die

    Festlegung der Hauptachsen (apikal-basal, dorsal-ventral, proximal-distal) und die

    Formierung der zwei wichtigsten pflanzlichen Meristeme, des Spross- und des

    Wurzelmeristems. Das Sprossmeristem ist Ursprung aller oberirdischen vegetativen und

  • EINLEITUNG 2

    generativen Organe, das Wurzelmeristem bringt die unterirdischen Pflanzenteile hervor.

    Eine bedeutende Aufgabe der Meristeme liegt in der postembryonalen Organisation der

    morphogenetischen Prozesse. Meristeme zeichnen sich durch zwei Eigenschaften aus,

    die essentiell fr ein kontinuierliches Wachstum des Pflanzenkrpers sind. Sie bringen

    nicht nur immer neue Bltter, Blten und Triebgewebe hervor, sondern sind darber

    hinaus auch gleichzeitig zur Selbstorganisation und Selbsterhaltung befhigt.

    Im Bereich des Sprossscheitels bzw. des Scheitelmeristems, kurz SAM (shoot apical

    meristem), differenziert ein Teil der meristematischen Zellen, mit Determinierung neuer

    Organe, aus und wird anschlieend durch neu gebildete undifferenzierte Zellen

    kompensiert bzw. wieder aufgefllt. Die Anlage lateraler Organe, wie z. B. Bltter,

    unterliegt dabei einem genauen Muster (Phyllotaxis). Die Blattform ist im bergang aus

    dem juvenilen zum adulten Stadium sehr variabel. Bltter und Blten sind in ihrem

    Wachstum begrenzte Strukturen, whrend z. B. Seitenzweige (z. T.) undeterminiert

    bleiben. Histologisch lsst sich das Scheitelmeristem hherer Pflanzen in zwei Zonen

    unterteilen. Die zentrale Zone umfasst die sich nur sehr langsam teilenden Initialzellen,

    die Ausgangspunkt aller anderen meristematischen Zonen und der Selbsterhaltung sind.

    Die periphere Zone zeichnet sich durch eine schnellere Zellteilung aus und bildet den

    Ausgangspunkt der Organogenese (JACKSON et al., 1994; HAKE & JACKSON, 1995; ORI et

    al., 2000; vergleiche 1.2.2: Abb. 9).

    Abb. 1: Schematische Darstellung zum pflanzlichen Grundbauplan. (nach GIFFORD & FOSTER, 1989,verndert). Pflanzenkrper einer stark schematisierten Dikotylen mit Wurzel, Sprossachse und Blttern. Sprossachse und Bltter werden zusammengefasst als Spross bezeichnet. Das Meristem des Sprossscheitels (Scheitelmeristem) dient der Anlage aller oberirdischen Organe, das Wurzelmeristem dient der Anlage von Wurzeln. Seitenverzeigungen gehen aus axillren Meristemen hervor und inserieren jeweils in den Achseln von (Trag-)Blttern.

  • EINLEITUNG 3

    1.1.2 Bltter & Kurztriebe

    Die meisten Bltter der rezenten Gymnospermen werden umgangssprachlich als Nadeln

    bezeichnet, sind in Gre und Form jedoch variabel. Die nadelfrmigen, lnglichen und

    mehr oder weniger stark abgeflachten Bltter finden sich hauptschlich bei Koniferen

    (z. B. Pinaceae und Taxaceae). Bei Sprosssystemen unterscheidet man generell solche,

    die immer einheitlich aufgebaut sind und daher als nicht triebdifferenziert anzusprechen

    sind von triebdifferenzierten Systemen bei denen man zwischen Lang- und Kurztrieben

    unterscheidet. Bei Triebdifferenzierung ist das Vorkommen von Blttern an lteren

    Zweigen (nach Abwurf der Langtriebbltter) auf die Kurztriebachse beschrnkt. Bei den

    Gymnospermen Abies (Abb. 2 A) und Torreya findet man z. B. undifferenzierte

    Sprosssysteme. Alle Triebe inklusive ihrer Benadelung sind hier gleich gestaltet.

    Abb. 2: Schematische Darstellung der Triebdifferenzierung bei Gymnospermen. A: gleich gestaltete Seitenaustriebe mit terminaler, vegetativer Knospe und spiralig an der Achse stehenden Nadeln. B: Kurztriebe in Form blattartig verbreiterter Kladodien (= Phyllokladien), Schuppenbltter der einzelnen Teilphyllokladien erkennbar. C: von Schuppenblttern eingehllte, reduzierte Kurztriebachsen stehen in Achseln von spiralig angeordneten, schuppenfrmigen Tragblttern des Langtriebes; an lteren Zweigen ausschlielich Kurztrieb-Nadeln vorhanden. D: Schirm im Aufriss; terminale, vegetative Knospe umgeben von sog. Kladodien bzw. Kurztrieben, die in Achseln spiralig angeordneter Schuppenbltter des Langtriebes stehen und umgangssprachlich als Doppelnadeln bezeichnet werden.

    A

    C D

    B

  • EINLEITUNG 4

    Bei Pinus sylvestris als Vertreter mit Triebdifferenzierung findet man, sptestens an im

    zweiten Jahr unbenadelten Langtriebachsen, stark gestauchte 2-nadelige Kurztriebe. Die

    Kurztriebachse selbst ist nicht sichtbar in eine Niederblattscheide eingehllt, erkennbar

    sind bei Pinus ausschlielich die Kurztriebnadeln (Abb. 2 C). In der Gattung Phyllocladus

    kommen Kurztriebe in Form blattartig verbreiterter, photosynthetisch aktiver

    Flachsprosse vor an deren Randbereichen die eigentlichen Bltter bis auf kleine

    Schuppenbltter reduziert sind (Abb. 2 B). Ein weiteres Beispiel fr eine Langtrieb-

    Kurztrieb-Differenzierung findet sich in der Gattung Sciadopitys mit charakteristisch

    schirmfrmig angeordneten nadelartigen Kurztrieben, die auch als Doppelnadeln

    bezeichnet werden (Abb. 2 D).

    1.1.3 Ausgangspunkt: Doppelnadel-Problematik

    Fr ein evolutives Verstndnis ist die Betrachtung von als sehr ursprnglich geltenden

    Taxa mit Hilfe klassischer botanischer Methoden interessant. Im Zusammenhang mit der

    Suche nach neuen Erkenntnissen fr ein besseres Verstndnis von der Funktion und

    Evolution der Gymnospermenbltter scheint eine weitere Betrachtung von Sciadopitys

    verticillata (THUNB.) SIEBOLD & ZUCC., als einem sehr ursprnglichen und damit sicherlich

    phylogentisch aussagekrftigen Taxon, viel versprechend. Die Natur der Doppelnadeln

    bzw. der Organcharakter der photosynthetisch aktiven Flachsprosse (Kladodien) bei

    S. verticillata war wiederholt Thema verschiedener Arbeiten (ROTH, 1962; TROLL, 1937;

    SCHNEIDER, 1913; GBEL, 1913, STRASBURGER, 1872; MOHL, 1871; ENGELMANN, 1868;

    DICKSON, 1866). So lassen sich zur Klrung der morphologischen Natur der nadelartigen

    Kladodien bzw. der Blattentwicklung und deren mgliche phylogenetische Folgen grob

    zwei Ansichten trennen (Abb. 3).

    Abb. 3: S. verticillata, Theorien zur Doppelnadel-Problematik. A: Verwachsungstheorie-ENGELMANN(1868); VON MOHL (1871); STRASBURGER (1872) & SCHNEIDER (1913); Vegetationspunkt des Kurztriebes erschpft sich in der Bildung der beiden kongenital verwachsenen Blattanlagen, die basal-interkalar in gemeinsamer Basis wachsen (Pfeil), Hauptanteil der Doppelnadel: Blattgewebe. B: Phyllokladientheorie- DICKSON (1866); TROLL (1937); ROTH (1962); der Vegetationskegel des Sprosses/phylloiden Stengels (DICKSON, 1866) baut die gesamte Doppelnadel auf, Hauptanteil der Doppelnadel: Achsengewebe; terminale Doppelspitze gedeutet als zwei Blattrudimente des Kurztriebes.

  • EINLEITUNG 5

    Die entsprechenden Untersuchungen zum Organcharakter der Sciadopitys-Kladodien

    befassen sich stets mit der Frage welcher Anteil Blatt und welcher Anteil Sprossachse

    ist. Gegenwrtig lsst sich als Ausgangsbasis stark vereinfacht festhalten, dass die

    Zuordnung der Doppelnadeln rein anatomisch und morphologisch ber ihre Stellung klar

    zu Gunsten des Sprosscharakters zu treffen ist (z. B. ROTH, 1962). Die Doppelnadeln

    sind demnach, aktuell als photosynthetisch aktive Flachsprosse anzusehen, weil sie in

    der Achsel von Tragblttern inserieren und sind folglich auch als nicht blatthomolog zu

    betrachten (Abb. 4).

    Abb. 4: S. verticillata, Habitus. A: Solitrpflanze im Botanischen Garten Marburg. B: mit Schuppenblttern besetzter Langtrieb, der terminal die charakteristisch schirmfrmig angeordneten Kladodien (K) bzw. Doppelnadel-artigen Kurztriebe trgt. C: Aufsicht auf vegetative Knospe im Zentrum des Schirms. Vegetationskegel und junge Blattanlagen unter Knospenschuppen (Ks) geschtzt verborgen. D: Vegetative Knospe in lateraler Ansicht, spiralig angeordnete Schuppenbltter (Sb) des Langtriebs durch gestauchte Internodien terminal gehuft, Kladodien aus Schuppenblattachseln entfernt (Pfeil).

  • EINLEITUNG 6

    Inwiefern an diesen Doppelnadel-artigen Kurztrieben bzw. Kladodien noch Blattanteile

    vorhanden sind ist spekulativ. Im Kontext dieser Arbeit interessiert besonders, ob eine

    Umgestaltung eines kompletten Kurztriebes bzw. einer Kurztriebachse hin zu einer

    Struktur, die dann insgesamt als Blatt anzusprechen ist, nicht nur mglich sein kann,

    sondern darber hinaus, ob dies (noch) nachweisbar ist. Letzteres hiee stark

    vereinfacht, dass in Teilen, die Blatt sind, hauptschlich blattspezifische Gene aktiv sind

    und in Sprossen demnach eher die Aktivitt sprossspezifischer Gene zu erwarten ist.

    Die umgangssprachliche Bezeichnung Doppelnadel fr die Sciadopitys-Kladodien ist mit

    Sicherheit nicht zuletzt das Resultat der sehr blatthnlichen Umgestaltung der

    Kurztriebe. Wie weit die hnlichkeit der angesprochenen Kladodien mit normalen Nadeln

    morphologisch, anatomisch und morphogenetisch (bereits) geht, bleibt allerdings offen.

    Einzig das Vorkommen von Tragblttern schliet die Deutung als Blatt aus und besttigt

    gleichzeitig den Sprosscharakter. Wrden die Tragbltter der Kladodien komplett

    reduziert werden und fehlen, knnte man ihnen aufgrund ihrer Lage und

    Entstehungsweise sowie ihres blattartigen anatomischen Aufbaus (STRASBURGER 1872;

    ROTH, 1962) ohne weiteres reinen Blattcharakter zusprechen und sie fr ganz

    gewhnliche Nadelbltter halten. Aufgrund dieser Tatsache gibt der bei Sciadopitys

    gefundene Sachverhalt Anlass dazu, die nadelartigen Kurztriebe als ein einzelnes

    Stadium (Momentaufnahme) einer Transformationsreihe anzusehen, bei der ein axillrer

    Kurztrieb sekundr in ein typisches Blatt umgewandelt wird. Als mgliche Folge wren

    die umgewandelten Kurztriebe morphologisch nicht mehr von Blttern zu unterscheiden.

    Die im Fall von Sciadopitys nur hypothetisch anzunehmende Reduktion von Tragblttern

    kommt in anderen Pflanzenfamilien durchaus vor. Eine Reduktion bis zum vollstndigen

    Fehlen (Ablast) ist von den Tragblttern der Blten bei Asteraceen und Eriocaulaceen

    (Syngonanthus) bekannt. Innerhalb der Familie der Asteraceae ist die Reduktion von

    Tragblttern der Einzelblten (Spreuschuppen) im Bereich des Bltenstandes in einigen

    Gattungen verbreitet und ein auf Gattungsniveau bestimmungsrelevantes Merkmal. Man

    findet Reduktionen aber auch bei den mnnlichen Teilzapfen der Gymnospermengattung

    Cephalotaxus, sowie bei den Teilkladodien von Phyllocladus. Bei Phyllocladus sind

    Tragbltter soweit reduziert, dass man sie nur noch in frhen Entwicklungsstadien

    nachweisen kann. Tragblattreduktionen sind also weder ungewhnlich, noch auf

    bestimmte Pflanzengruppen begrenzt.

    Ausgehend von der Datenlage lsst sich im Fall von Sciadopitys als gedanklicher

    Ausgangspunkt fr weitere Untersuchungen gegenwrtig eine Zwischenstellung

    annehmen. Vorstellbar ist auerdem, dass dies als die Folge einer standortbedingten

  • EINLEITUNG 7

    Vernderung und einer daraus resultierenden Anpassung deutbar ist. Es gibt zahlreiche

    Beispiele dafr, dass wieder bentigte Organe auf anderem Wege durch analoge

    Bildungen ersetzt werden. Es ist aber nicht zwangslufig mglich, eine auf demselben

    Weg identisch wieder gewonnene Struktur von einer nie verloren gegangenen zu

    unterscheiden. Dies kann auch als Grundgedanke dienen die Entstehungsweise von

    Blttern (einiger anderer als ursprnglich immergrn gefhrter Taxa) vor dem

    Hintergrund umgewandelter Kurztriebe neu zu hinterfragen. Morphologisch und

    anatomisch hat die Nadel von Abies (z. B. A. homolepis) hnlichkeit mit dem Kladodium

    von Sciadopitys (Abb. 5). Bis auf das Fehlen einer dem Tragblatt vergleichbaren Struktur

    ist auch die Ontogenie sehr hnlich. So stellt sich die Frage, ob es Nadelbltter gibt, die

    sich in dieser Weise phylogenetisch von Kladodien herleiten lassen und ob Abies ein

    solches Beispiel ist oder nicht. Sind Bltter also phylogenetisch mehrfach unabhngig

    voneinander einmal direkt und einmal ber Umwege (transformierte Spross(-Systeme))

    entstanden?

    Die Beantwortung der Frage nach dem Organcharakter ist nicht immer einfach, sollte

    aber dennoch stets inhaltlich erfolgen. Bei Sichtung der Rohdaten ist abzuwgen in wie

    weit die Mglichkeit besteht, dass die Morphologie durch Funktionalitt berlagert wird

    und histologisch mglicherweise das Funktionelle berwiegt. Beispiele fr derartige

    funktionelle berlagerungen finden sich u. a. in den Podocarpaceen-Gattungen

    Acmopyle und Falcatifolium (KNOPF, persnliche Mitteilung) sowie in den Cupressaceae

    (z. B. Thuja). Am Beispiel der Gymnosperme Thuja zeigt sich, dass die Form einer der

    Abb. 5: Morphologische Gegenberstellung von S. verticillata & A. homolepis. A: S. verticillata, terminales Ende eines Kladodiums im Bereich der ausgebuchteten Spitze (Pfeil), Oberseite des Kladodiums mit Lngsfurche (oben) und zwei Stomatareihen (SR) auf der Kladodien-Unterseite (unten). B: A. homolepis, Nadelspitze mit terminaler Ausbuchtung (Pfeil), adaxiale Seite ohne Lngsfurche (oben), abaxial (unten) mit deutlich sichtbaren, lngsverlaufenden Stomatareihen.

  • EINLEITUNG 8

    Selektion unterliegenden Struktur immer mit deren Funktion in Einklang steht, wobei

    letztere sogar die Morphologie dominieren kann. Dies ist besonders deutlich, wenn

    bekannte und klar erkennbare morphologische Grundstrukturen durch funktionelle

    Anpassungen berformt werden. Ein Beispiel findet sich im anatomischen Aufbau der

    Kantenbltter von dorsiventral abgeflachten und plagiotrop ausgerichteten Zweigen bei

    z. B. Thuja plicata oder Platycladus orientalis (Cupressaceae). Hier ist das blicherweise

    auf der morphologischen Blattoberseite lokalisierte Palisadenparenchym durch die

    Ausrichtung der Zweige und entsprechend dem Lichteinfall im Bereich der

    morphologischen Blattunterseite und dort besonders im Bereich der Licht exponierten

    Kante des Blattes ausgebildet (Abb. 6 & TETZLAF, 2005). Schwieriger wird es, wenn die

    funktionelle berformung soweit geht, dass die morphologische Grundstruktur dadurch

    noch strker oder gar vollstndig verschleiert wird. Es bietet sich also ber den

    morphologischen Ansatz hinaus an, die Nachweisbarkeit angenommener Organe ber

    den Einsatz von Genen zustzlich zu berprfen.

    1.2 Entwicklungsgenetische Lsungsanstze

    Blickt man zurck auf die vielen morphologisch-anatomisch geprgten Arbeiten mit

    ihrem groen Beitrag zur Basis der Grundlagenforschung, zeigt sich, dass sich viele

    evolutionsbiologische Fragestellungen/Fragen zur Biodiversitt hervorragend ber rein

    anatomisch-morphologisch gewonnene Erkenntnisse lsen lassen. Die Erfahrung zeigt,

    dass auf diese Weise gewonnene Ergebnisse sich meist auch genetisch zustzlich

    sttzen lassen. Fr die Flle in denen ber einen gewissen Punkt hinaus (z. B. durch

    funktionelle berlagerung) rein morphologisch-anatomisch keine zufrieden stellenden

    Abb. 6: Thuja plicata, Schematische Darstellung des Sprossquerschnitts. Das eigentlich auf der morphologischen Blattoberseite zu erwartende Palisadenparenchym ist bei den gezeigten Kantenblttern auf der morphologischen Blattunterseite und dort in stark Licht exponierten Bereichen zu finden.

  • EINLEITUNG 9

    Antworten (mehr) zu erwarten sind, bietet es sich an bereits bestehende Ergebnisse mit

    Entwicklungsgenetik zu kombinieren. Der bei Sciadopitys in Form der geschilderten

    Kurztriebe vorliegende Sachverhalt ist also ein Fall fr den weiterfhrende genetische

    Untersuchungen lohnend erscheinen.

    ltere Angaben aus der Literatur und historischen Zeichnungen, bei denen subjektive

    Einflsse des Autors nie gnzlich auszuschlieen sind, bieten in Kombination mit (aktuell)

    erfassten Rohdaten (REM, Digitalfotografie etc.) diesbezglich keine richtige Klrung. So

    werden auch definitive Aussagen zum Ansatz der vermuteten Transformationsreihe

    dieser Kladodien nicht plausibler oder nachvollziehbarer. Ausgehend von der aus

    morphologischer Sicht stellungsbedingten Sprossnatur der Kladodien, erscheint es

    interessant diese unter Zuhilfenahme so genannter Organidentitts- oder

    Entwicklungsgene erneut zu betrachten. Entwicklungsgene sind in der Lage anhand

    ihres Expressionsmusters oder ber Nachweis des von ihnen kodierten Transkriptions-

    faktors die Organidentitt z. B. in Gewebeschnitten anzeigen zu knnen. Ein solcher

    Versuchsansatz macht schon vor Erscheinen der Organanlagen Einblicke mglich.

    Hinweise zu einem derart frhen Zeitpunkt knnten essentiell sein, wenn es wie hier mit

    Sichtbarwerden junger Organanlagen fr Aussagen zur Identitt mglicherweise schon

    zu spt ist. Die Kombination aus Histologie und Genetik bzw. die Methode des

    Expressionsnachweises im Gewebe (siehe 1.3) findet in den letzten Jahren verstrkt fr

    Angiospermen, und zunehmend auch fr Untersuchungen an einzelnen Gymnospermen-

    Taxa Anwendung (z. B. SUNDS-LARSSON, 1998; GUILLET-CLAUDE et al., 2004 & BELMONTE

    et al., 2007). Je nach Auswahl der eingesetzten Entwicklungsgene werden so Aussagen

    zur pflanzlichen Morphogenese inklusive der Organdifferenzierung mglich. Die relativ

    groe Diskrepanz in der Anzahl der molekulargenetisch untersuchten Angiospermen und

    damit einhergehenden verffentlichten Sequenzen im Vergleich zu Gymnospermen

    erklrt sich erstens durch die in Angiospermen anteilmig groe Zahl wirtschaftlich

    hochinteressanter Nutzpflanzen wie z. B. Zea mays (Mais). Zweitens steigern ein im

    Vergleich zu Gymnospermen oftmals sehr viel krzerer Generationswechsel (z. B.

    Arabidopsis) und ein (methodisch) einfacherer Gewebeaufschluss (Vorkommen weniger

    stark verholzter Strukturen z. B. im Knospenbereich, etc.) die Attraktivitt der

    Angiospermen fr genetische Anstze. Ein kompletter Generationszyklus (Aussaat bis

    Ausreifen der neuen Samengeneration) dauert bei A. thaliana gerade einmal ca.

    sechs bis acht Wochen. Die Samen von S. verticillata bentigen allein fr die Keimung

    schon fast doppelt so lange (3 bis 4 Monate). Die Sciadopitys-Keimlinge bilden innerhalb

    ihres ersten Lebensjahres zustzlich zu den beiden Kotyledonen nur zwei weitere Bltter,

    die Primrbltter, aus (http://www.schirmtanne.de/sciadopitys_verticillata.php).

  • EINLEITUNG 10

    Gensequenzen einer aus molekularer Sicht scheinbar eher unpopulren Gymnosperme

    wie Sciadopitys, gerade in Bezug auf Entwicklungsgene (!), sind in Gen-Datenbanken

    aktuell nicht vorhanden.

    1.2.1 Pflanzliche Knox-Gene

    Knox-Gene gehren zur groen Gruppe der Homobox-Gene. Homobox-Gene bzw.

    von ihnen kodierte Homodomnen-Proteine wurden im tierischen Organismus, speziell

    Drosophila, erstmals entdeckt (GEHRING, 1987). Der Name ergibt sich aus einer Mutation,

    die homologe Strukturen betraf. Ein klassisches Beispiel ist eine Mutation im

    Antennapedia-Gen, die zur Folge hat, dass anstelle von Antennen Beine ausgebildet

    wurden (MC GINNIS & KRUMLAUF, 1992).

    Bekannt und benannt wurden pflanzliche Knox-Gene im Zusammenhang mit der

    Entdeckung des knotted1 (kn1)-Gens aus einer Mutante von Zea mays. Kn1, das erste

    aus einer Pflanze isolierte Gen, das ein Homobox-Motiv enthlt wird bei normaler

    Expression nur im Scheitelmeristem und sehr jungen Teilen der Sprossachse, nicht

    jedoch in Blttern exprimiert (HAKE et al., 1989; VOLLBRECHT et al., 1991). In der

    berexpressions-Mutante (gain-of-function) zeigte sich eine ektopische Expression in

    Blttern (HAKE & ORI, 2002), die knotenartige Auswchse im Bereich der Blattspreiten zur

    Folge hatte (SMITH et al., 1992). Das Kn1-Gen wird seitdem fr die Isolierung immer

    neuer Vertreter der Knox (knotted1-like homeobox)-Gen-Familien aus Mais und vielen

    anderen Spermatophyten wie beispielsweise den Angiospermen Arabidopsis (STM:

    LONG et al., 1996; KNAT: LINCOLN et al., 1994) und Oryza (OSH1: MATSUOKA et al., 1993)

    oder der Gymnosperme Picea abies (SUNDS-LARSSON et al., 1998) etc. genutzt. Das

    Gen ist damit Ausgangspunkt einer Vielzahl von Arbeiten zu verschiedenen durch

    Knox-Gene gesteuerte morphogenetische Prozess (Abb. 7). Die Knox-Gene bieten sich

    im Zusammenhang mit der angesprochenen Morphogenese-Thematik als Werkzeuge

    fr die Analyse von Meristemfunktion und die daraus resultierende Diversitt pflanzlicher

    Bauplne besonders an. Sie eignen sich in vielen Fllen als hervorragende Zeiger

    morphogenetischer Ereignisse (SINHA et al., 1993; LINCOLN et al., 1994). Die Produkte

    dieser regulatorischen Gene sind, abhngig von deren rumlichen und zeitlichen

    Expressionsmustern, in vielen Bereichen der Organentwicklung beteiligt. Ihnen kommt

    demnach als Transkriptionsfaktoren eine wichtige (regulatorische) Kontrollfunktion

    speziell bei der spezifischen Zelldifferenzierung zu (z. B. HAKE & JACKSON, 1995). Neben

    KNOX gehren auch die Familien BELL, HD-Zip, PHD-finger, GLABRA2 und PALE zur

    groen Gruppe der Homobox-Gene (CHAN et al., 1998).

  • EINLEITUNG 11

    Allen gemeinsam ist ein als Homodomne bezeichneter 61 Aminosuren umfassender

    konservierter Bereich, der von der Homobox kodiert wird. Funktionell ist die

    Homodomne ber das helix-turn-helix-Motiv fr die Protein-DNA-Interaktion

    verantwortlich (VOLLBRECHT, 1991 & GEHRING et al., 1994). Homodomnen-Proteine

    funktionieren als DNA-abhngige Transkriptionsregulatoren (GEHRING et al., 1994). Als

    Transkiptionsfaktoren stellen sie nur eine Komponente in einer langen Signalkaskade

    (vom Kern ausgehend) dar. Sie regulieren ber sequenzspezifische DNA-Bindungen

    andere Gene, aktivieren und/oder unterdrcken (JAYNES & O FARRELL, 1989)

    Transkriptionsenzyme, Signalmolekle bzw. -proteine. Neben der Regulation anderer

    Transkriptionsfaktoren verfgen sie ber die Fhigkeit zur Autoregulation, indem sie an

    regulatorische Sequenzmotive ihrer eigenen Gene binden und so ihre eigene Expression

    steuern (HAYASHI & SCOTT, 1990). Die hnlichkeit in der Aminosurensequenz der

    Homodomne und weitere ebenfalls mehr oder weniger stark konservierte

    Proteinmotive auerhalb der Homodomne sind ausschlaggebend fr die Unterteilung

    in die oben angefhrten sechs verschiedenen Homobox-Gen-Familien. Darber hinaus

    dienen die zustzlichen, konservierten Domnen der Festlegung der verschiedenen

    Homobox-Gene selbst (CHAN et al., 1998).

    Abb. 7: Schema zur unterschiedlichen Einflussnahme von KNOX-Tanskriptionsfaktoren auf die Wachstumsregulierung (nach HAY et al., 2004; verndert). KNOX greift regulierend in das Hormongleichgewicht ein und so mglicherweise indirekt auf die Zellwandstruktur (Gibberilinsure und Auxin aktivieren die Expression der Zellwand-lsenden Proteine, der Expansine). KNOX reguliert direkt die Biosynthese der Zellwand wodurch die Zelldifferenzierung unterdrckt wird. KNOX aktiviert die Cytokinin-Biosynthese, die ihrerseits die Zellteilung aktiviert. KNOX unterdrckt die Gibberilin-Biosynthese, die mglicherweise die Anordnung des Cytoskelets reguliert, dass die Zelldifferenzierung kontrolliert. Vernderte Zellteilung und Regulierung der Expression der KNOX-Gene knnten zusammenhngen.

  • EINLEITUNG 12

    Die Proteine der Knox-Familie zeigen einen ihnen eigenen, gleichen Aufbau (Abb. 8).

    Strukturell zeichnen sich alle KNOX-Proteine neben ihrer nahe dem C-Terminus

    lokalisierten Homodomne durch den Besitz zwei spezieller, konservierter Motive

    N-terminal (upstream) der Homodomne aus. Dabei handelt es sich um die ELK- und

    die KNOX-Domne (BRGLIN, 1997). Die ELK-Domne (VOLLBRECHT et al., 1991) ist ein in

    allen Mitgliedern der Knox-Familie hochkonservierter Bereich, der nach seinen ersten

    drei Aminosuren benannt ist. Funktionell ist das ELK-Motiv an

    Protein-Protein-Bindungen beteiligt (BRGLIN, 1997). Das Sequenzelement der

    ELK-Domne kommt nur bei Vertretern pflanzlicher TALE-Proteine vor (SUNDAS-

    LARSSON et al., 1998). Als KNOX-Domne wird ein ca. 100 Aminosuren umfassender,

    stark konservierter Bereich N-terminal von ELK bezeichnet. Das Motiv ist ebenfalls

    wichtig fr Protein-Protein-Interaktionen (MLLER et al., 2001). Ein kleiner, weniger

    konservierter Bereich zwischen der KNOX- und ELK-Domne wird als GSE-Box

    bezeichnet (BRGLIN, 1997). Die Homodomne beinhaltet drei -Helix-Motive. Aufgrund

    des Vorkommens von drei zustzlichen Aminosuren (PYP) im Bereich (loop) zwischen

    dem Helix I- und dem Helix II-Motiv wird sie zur Familie der so genannten TALE (three

    amino acis loop extension) Superclass gezhlt. Zur TALE-Familie der Homodomnen

    in Pflanzen zhlt neben KNOX auch BEL-like (BELL) (BERTOLINO et al., 1995;

    BRGLIN, 1997). Das dritte -Helix-Motiv (Helix III) (GEHRING et al., 1994;

    KERSTETTER et al., 1994), die sogenannte recognition helix, ist fr die Erkennung und

    den sequenzspezifischen Kontakt mit DNA zustndig. Als sequenzspezifische

    DNA-Bindeproteine regulieren Homodomnen-Proteine die Expression spezifischer

    Gruppen von Zielgenen (AFFOLTER et al., 1990 & HAYASHI & SCOTT, 1990). Obwohl die

    verschiedensten Homodomnen strukturidentisch sind, knnen sie unterschiedliche

    DNA-Bindungsbereiche erkennen (KERSTETTER et al., 1994).

    Knox-Gene werden abhngig von bestimmten Aminosureresten innerhalb der

    Homodomne, Intronposition(en) und Expressionsmustern in zwei unterschiedliche

    Klassen, Knox-Gene der Klasse 1 und Klasse 2 eingeteilt (KERSTETTER et al., 1994;

    Abb. 8: Schematischer Aufbau eines KNOX-Proteins. (Darstellung nach SAKAMOTO et al., 2001;verndert). KNOX-Protein mit den fr nahezu alle pflanzlichen KNOX-Proteine typischen Motiven der KNOX, ELK- und Homodomne, sowie der GSE-Box. Die zur TALE-Gruppe zhlende Homodomne setzt sich aus drei -Helices, mit Helix-turn-Helix-Motiv fr die DNA-Bindung inklusive eines charakteristischen PYP-Motivs (PYP-loop) zusammen.

  • EINLEITUNG 13

    REISER et al., 2000). Ein Vorkommen bestimmter Klassen von Knox-Genen ist nicht nur fr

    mono- und dikotyle Angiospermen (s. o.), Moose (CHAMPAGNE & ASHTON, 2001) und

    Farne (SANO et al., 2005), sondern auch fr Gymnospermen durch SUNDAS-LARSSON

    et al. (HBK, 1998) gezeigt worden. Die Homodomne beider Klassen zeigt einen hohen

    Grad an bereinstimmung, hauptschlich im Helix III-Motiv. Vermutlich interagieren sie

    mit hnlichen DNA-Sequenzen, aber schon kleinste Strukturvernderungen (auerhalb

    der Helix III und im N-terminalen Abschnitt der Homodomne) fhren dazu, dass sich

    das DNA-Bindeverhalten und/oder die Protein-Interaktion fr beide Klassen

    unterscheiden (CHAN et al., 1998). Whrend Klasse 1-Gene hauptschlich fr die

    Identittsgebung und Meristemregulation zustndig sind (vergleiche 1.2.2), zeigen

    Klasse 2-Vertreter ein sehr vielfltigeres Einsatzfeld, ggf. agieren sie erst in spteren

    Stadien der Entwicklung (CHAN et al., 1998). Sowohl Klasse 1 und Klasse 2-Gene, als

    auch die Knox-Familie selbst sind Monophyla (BRGLIN, 1997; BARATHAN et al., 1999;

    REISER et al., 2000). Untersuchungen an Pflanzenlinien vor Beginn der Landpflanzen

    (z. B. der Grnalgen Acetabularia acetabulum, SERIKAWA & MANDOLI, 1999) kamen zu

    dem Ergebnis, dass die Duplikation der beiden Klassen erst vor 500 Millionen Jahren,

    nach Formierung der Landpflanzen-Linie, auftrat (HAKE et al., 2004). Laut SINGER &

    ASHTON (2007) kann man fr Klasse 1 festhalten, dass eine heterologe Expression ihrer

    Gene bzw. die resultierenden Phnotypen die Vermutung nahe legen, dass man den

    Klasse 1-Genen nur entfernt verwandter Pflanzenvertreter wie Arabidopsis, Picea und

    Ceratopteris durchaus eine homologe Funktion zusprechen kann (z. B.

    HARRISON et al., 2005).

    1.2.2 Knox-Expression & der pflanzliche Bauplan

    Die pflanzliche Entwicklung zeigt gravierende Unterschiede zur Entwicklung von Tieren.

    Pflanzliche Organe knnen zeitlebens neu gebildet werden. Der Grund liegt im

    Vorhandensein spezieller, unbegrenzt teilungsfhiger Zellen, deren Zellverbnde als so

    genannte Meristeme erhalten bleiben. In Tieren kann man dies allenfalls auf totipotente

    Stammzellen mit selbst erhaltenden Eigenschaften bertragen.

    Fr die Bildung aller oberirdischen Pflanzenteile hat das eingangs erwhnte

    Scheitelmeristem eine besondere Bedeutung. Es ist ber die Fhigkeit zur

    Selbsterhaltung eine essentielle Quelle fr meristematische Zellen bzw. Wachstum. Zwei

    weitere sehr wichtige Aufgaben kommen dem Scheitelmeristem als Ursprungszentrum

    von lateralen Organen wie Blttern, sowie weiteren axillren Meristemen und als

    Schaltzentrale im Zuge der Primordien(an)ordnung bzw. Phyllotaxis zu (MC STEEN &

    HAKE, 1998; Abb. 9 A). Die im Bereich des Scheitelmeristems bei Anlage neuer

  • EINLEITUNG 14

    Organprimordien ablaufenden Prozesse sind sehr komplex. Die Ablufe/Muster werden

    zustzlich zur Gen-abhngigen Expression noch ber An- und Abwesenheit von

    Hormonen beeinflusst. HAY et al. (2004) beschreibt, dass sich die verschiedenen Gene

    nicht nur wechselseitig beeinflussen, sondern auch die Hormonaktivitt regulierend auf

    die Aktivitt der KNOX-Proteine im Apex Einfluss nimmt. Verallgemeinert lsst sich

    sagen, dass die Knox-Expression (eines Klasse 1 Gens wie z. B. Kn1 oder Stm) auf das

    Sprossmeristem beschrnkt ist und whrend der Blattentwicklung fehlt (seltener nur stark

    herunterreguliert ist). Die Meristemzellen, die den Ursprung einer neuen Blattanlage

    bilden (Plastochron 0/P0 Stadium, vgl. Abb. 9 B), verlieren die Expressionsttigkeit schon

    vor ersten (sichtbaren) Anzeichen einer Blattanlage (HAKE et al., 2004).

    Die Genprodukte beeinflussen zwar die Anlage von Blttern, sind im Blatt selber aber

    nicht zu finden (SMITH et al., 1992; JACKSON et al., 1994). Die Expressionsmuster fr

    einfache und zusammengesetzte Bltter knnen variieren. Das Expressionsmuster ist

    also allgemein eher mit dem Entwicklungsstadium des Blattprimordiums und nicht

    zwangslufig mit der endgltigen Blattmorphologie korreliert (BARATHAN et al., 2002 &

    HAKE et al., 2004). So wichtig es fr die Blattidentitt ist die Expression bestimmter Gene

    in Blttern abzuschalten, so wichtig ist aber auch, dann bestimmte Gene anzuschalten

    Abb. 9: Schematische Darstellung zum Scheitelmeristem (SAM). Expressionsmuster eines Klasse 1Knox-Gens wie Kn1 oder Stm im vegetativen Meristem (nach MC STEEN & HAKE 1998, JACKSON et al., 1994 & HAY et al., 2004, jeweils verndert). Das SAM bernimmt die Aufgabe der Selbsterhaltung, Bildung von Blttern und axillren Meristemen sowie Phyllotaxis. Zellen der zentralen Zone dienen der Selbsterhaltung des SAM und teilen sich weniger hufig. Zellen des peripheren Bereichs teilen sich hufig und sind Ausgangspunkt fr die Organogenese (nur Zellen im Bereich des (Blatt-)Primordiums differenzieren aus). P0-P2 stehen fr die (ontogenetischen) Zeitintervalle, Plastochrone, zwischen der Anlage der Blattprimordien mit P1 als jngstem Primordium bzw. jngstem Blatt. P0 steht fr den Bereich wo das nchste Primordium zu erwarten ist und die Expression des eigentlich im gesamten Meristem exprimierten Klasse 1-Gens unterdrckt ist/fehlt. Axillre Meristeme entstehen in Blattachseln. A: Schematischer Querschnitt durch SAM. B: SAM, in lateraler Ansicht, keilfrmig angeschnitten.

  • EINLEITUNG 15

    (MC STEEN & HAKE, 1998). Pflanzliche Zellen geben ber ihr Wuchsverhalten Antwort auf

    Umweltbedingungen, erkennbar anhand ihrer Anpassungsfhigkeit und Koordination

    ihrer Aktivitt. Die wichtigste funktionelle Gemeinsamkeit aller Knox-Gene in der

    Morphogenese der Pflanzen liegt in der Kontrolle der Zelldifferenzierungsprozesse und

    der Formierung bestimmter Muster im pflanzlichen Bauplan. Die undifferenzierten

    Meristemzellen differenzieren nach speziellen Mustern aus und bringen so laterale

    Organe hervor. Mustervariationen sind Form gebend, indem sie im Zuge der vegetativen

    Entwicklung Einfluss auf die Anlage von Blattformen, Leitbndelanschlsse und

    Phyllotaxis nehmen. Die unterschiedliche Genexpression ist im Hinblick auf verschiedene

    Wuchsformen ein entscheidender evolutiver Mechanismus (HAKE & JACKSON, 1995).

    Ein Verstndnis der entstehenden Expressionsmuster bzw. von ektopischer Expression

    wird erleichtert, wenn man auf mutationsbedingte Phnotypen (mit verndertem

    Zellschicksal und anderem Teilungsverhalten) zur Illustration der Entwicklungsschritte

    zurckgreift. Ein hoher Expressionslevel in transgenen Pflanzen bedingt einen Wechsel

    hin zum Meristem und niedrigere Level verndern die entstehenden Zelltypen. Durch

    (nicht letale) rezessive Wildtyp-Mutanten und spezielle induzierte Transformanten (Mono-

    und Dikotyle sind kompatibel, SINHA et al., 1993) werden Aussagen und Analysen des

    Gens und seiner Genprodukte mglich. Rezessive Mutationen informieren ber die Rolle

    des Genproduktes in der frhen Entwicklung (bezogen auf das Meristem). Eine

    dominante berexpression bzw. die so genannten gain-of-function-Phnotypen,

    machen ber ihr dosisabhngiges Erscheinungsbild Vernderungen im Bauplan

    vorhersehbar (HAKE & JACKSON, 1995). Klasse 1 wird im Scheitelmeristem exprimiert. Die

    Expression von Klasse 2 ist nicht so klar definiert (KERSTETTER et al., 1994,

    SERIKAWA et al., 1996 & SERIKAWA et al., 1997). Ihre Expression ist nicht auf bestimmte

    Gewebe beschrnkt, sondern abhngig von Ort (Zelltyp) und Zeit der Expression in der

    Pflanze sehr variabel, sie kommt in den meisten Geweben, jedoch nie im Meristem vor.

    Aufgrund fehlender mutationsbedingter Phnotypen ist die Klasse 2-Funktion nicht so

    klar beschreibbar wie die der Klasse 1-Gene (SERIKAWA et al., 1997).

    Neben verschiedenen Modellen zur Blattentwicklung existieren fr Monokotyle und

    Dikotyle eigene Modelle zur Knox-Gen-Expression in der Embryo-, Smlings- und

    Infloreszenzentwicklung. Die Expression der Knox-Gene selbst ist auf vielfltigste Weise

    und auf verschiedensten Leveln reguliert (HAKE et al., 2004). Bezogen auf den eingangs

    erwhnten universellen Bau der Kormophyten (Abb. 1) bergen also die Expressions-

    muster von Knox-Genen Hinweise auf die Organidentitt und die Mglichkeit untersuchte

  • EINLEITUNG 16

    Strukturen einem der drei vegetativen Grundorgane im pflanzlichen Bauplan zuzuordnen

    und Aussagen ber die Homologieverhltnisse zu machen.

    Gegenwrtig nimmt erstens die Zahl der diesbezglich untersuchten Gymnospermen

    (gemessen an der Vielzahl von Untersuchungen an Angiospermen) immer weiter zu.

    Zweitens ist mit der Arbeit von HIRAYAMA et al. (2007) auch der erste Schritt

    unternommen umgestaltete Organe mit Sonderfunktion wie Phyllokladien (blattartige

    Flachsprosse) nher zu untersuchen, bei denen die Zusammensetzung aus den

    Grundorganen nicht immer hinreichend klar ist. Untersuchungen zu derartigen

    innovativen Organen (z. B. aus der Angiospermengattung Ruscus und der

    Gymnospermengattung Phyllocladus) die zur morphologischen Differenzierung

    beitragen sind wichtig. Whrend die Zusammensetzung fr Phyllocladus in diesem

    Zusammenhang einfach ist (RIEGER, 2002; BELL, 1991 & TOMLINSON et al. 1987), bleibt

    Ruscus laut HIRAYAMA et al. (2007) morphologisch ein Problem. Mit Hilfe dieser

    Versuchsanstze, knnte es einerseits mglich sein eine intermedire Organidentitt von

    z. B. Phyllokladien zu belegen (vergleiche HIRAYAMA) und andererseits auch die

    Wahrscheinlichkeit vermuteter Transformationsreihen fr die blattartigen Kurztriebe bei

    Sciadopitys zu berprfen.

    1.3 in-situ-Hybridisierung

    Die in-situ-Hybridisierung ist ein Verfahren mit dem die mRNA eines bestimmten Gens

    (im Gewebeschnitt) sichtbar gemacht wird und anhand dessen die fr das Gewebe oder

    die Zelle typische Proteinexpression ggf. inklusive des zeitlichen Verlaufes

    nachvollziehbar wird (MHLHARDT, 2003).

    Die ursprnglich im Zuge zytologischer Prparationen etablierte Methodik der

    in-situ-Hybridisierung beruht auf der spezifischen Bindung einer markierten Sonde

    (Nukleinsure-Probe) im Gewebeschnitt unter selektiven Bedingungen. Fr die Botanik

    wurde diese Methodik erst spter angepasst, um als diagnostisches Werkzeug zur

    Detektierung von Pflanzenpathogenen, Genomanalysen von Pflanzengenen oder fr

    Expressionsstudien der mRNA und ihrer Proteinen im Gewebe eingesetzt zu werden.

    Allen bestehenden Hybridisierungsvarianten liegt zu Grunde, dass die gewhlte Sonde

    an eine komplementre Sequenz im Gewebe unter Bildung einer stabilen Hybride bindet

    und anschlieend histologisch detektierbar ist. Im Rahmen dieser Arbeit kommen so

    genannte Antisense-mRNA-Transkripte zum Einsatz, die im pflanzlichen Gewebeverband

    die genaue, temporre Expression der Sense-mRNA-Zielsequenz lokalisieren. Die

  • EINLEITUNG 17

    verwendeten Sonden (Riboproben) lassen sich sowohl radioaktiv als auch nicht

    radioaktiv (Fluoreszenzfarbstoff oder Antikrper, Bindungsproteine) markieren. Die

    Sensitivitt beider Detektionsvarianten ist mittlerweile vergleichbar hoch. Auch geringe

    Kopienzahlen von mRNA (auch in einzelnen Zellen) sind detektierbar. Ein sehr gngiger

    Marker ist hierbei Digoxigenin, kurz DIG, ein Steroid aus Blten und Blttern der

    Digitalis-Pflanze. Es ist im Vergleich zum Biotin-Marker sensitiver. In der Regel werden

    Marker an UTPs gekoppelt und sind ber einen enzymgebundenen Antikrper (z. B.

    Alkalische Phosphatase) gegen das verwendetet Marker-Molekl (z.B. Anti-DIG) unter

    Entstehung eines chromogenen Substrates (z. B. BCIP/NBT) sichtbar und nachweisbar.

    Das Verfahren bietet den Vorteil, dass sowohl eine gleichzeitige Ko-Lokalisation

    verschiedener RNAs in ein und derselben Probe unter Einsatz verschiedener Marker, als

    auch die gleichzeitige Detektion von RNA und dazugehrigem Protein mglich ist

    (ZACHGO, 2002). Durch Einsatz der Doppelmarkierung (double labeling) zeigte

    JACKSON (2002), dass Kn1-mRNA und das zugehrige Protein an unterschiedlichen

    Orten lokalisierbar waren und Proteine ber Plasmodesmata wandern knnen.

    1.4 Ziel der Arbeit

    ber die reine Anwendung der klassischen morphologisch-anatomischen Methodik

    hinaus erscheint es viel versprechend, diese mit genetischen Versuchsanstzen zu

    kombinieren, um neue und/oder zustzliche Hinweise und untersttzende Aussagen zur

    Funktion und Evolution der Gymnospermenbltter zu ermglichen. Stellenweise liefern

    die erfassten Rohdaten zur Morphogenese allein keine eindeutigen Aussagen zum

    Organcharakter. Fragen zu Makroevolution knnten daher erst durch Kombination

    molekularer Daten besser beantwortet werden. Die Palobotanik bzw. Vergleiche mit

    fossilen Funden aus der Anfangszeit der Gymnospermen sind insofern problematisch,

    als man nicht sicher sein kann wie komplett die Angaben zu Relikt- und Ur-Habitaten

    sind. Auerdem lassen fossile Funde viel Spielraum fr Spekulationen. Aussagen ber

    die Homologie oder Analogie rezenter Strukturen (z. B. ber vergangene

    standortbedingte Anpassungen) sind nur schwer mglich.

    Vor diesem Hintergrund erscheint eine Methodenetablierung zum Expressionsnachweis

    von Genen direkt im entscheidenden Gewebeverband eines so ursprnglichen

    Gymnospermen-Taxons wie der Japanischen Schirmtanne, S. verticillata, angebracht.

    Selbst in kladistischen Analysen unter Verwendung verschiedenster

    (morphologischer/genetischer) Parameter und der ber die Jahre stndig wechselnden

    Zuordnung zu den verschiedensten Gymnospermen-Familien (FARJON, 2005) entsteht

  • EINLEITUNG 18

    hufig der Eindruck eines Mischorganismus, dessen Zuordnung sich als verwirrend

    erweist. Ziel der vorliegenden Arbeit ist daher erstens die allgemeine Etablierung der

    angesprochenen genetischen Methoden wie z.B. die in-situ-Hybridisierung, inklusive der

    Adaption an Sciadopitys, am Lehrstuhl zu realisieren. Zweitens soll ber eine

    Methodenetablierung fr ein ursprngliches Gymnospermen-Taxon, mit S. verticillata als

    Modellgymnosperme, im Speziellen eine Knox-Gen-Sequenz aus S. verticillata

    vergleichbar mit dem HBK-Gen aus P. abies (SUNDS-LARSSON et al., 1998) identifiziert

    werden und entsprechende Primer fr ein Klasse 1 Knox-Gen erstellt werden.

    Bei den Doppelnadeln bzw. Kladodien von Sciadopitys ist morphologisch eindeutig,

    dass es sich um einen Spross handelt. Unklar ist, welchen Anteil Sprossachse und

    mglicherweise vorhandene Bltter an Kladodien haben. Die Frage ist, ob sich die

    Sprossnatur genetisch belegen lsst. Gelingt es, so schliet sich als nchstes die Frage

    an, ob andere Gymnospermennadeln, die morphologisch sehr hnlich, aber durch die

    Stellung eindeutig als Bltter anzusehen sind, nicht ebenfalls umgewandelte Sprosse

    sind. Fhrt die Studie zum Erfolg, bedeutet das, dass mglicherweise eine

    polyphyletische Entstehung des Gymnospermenblattes belegt werden kann. Fhrt sie

    nicht zum Erfolg, bedeutet es, dass in manchen Fllen die Auflsung morphologischer

    Verfahren hher sein kann, als die genetischer Techniken.

  • MATERIAL & METHODEN

    19

    2 MATERIAL & METHODEN

    2.1 Pflanzenmaterial

    2.1.1 Materialsammlung

    Die Sammlung und Probenentnahme erfolgten jeweils angepasst an die Erfordernisse

    der verschiedenen Versuchsanstze. Das Material fr Entwicklungsreihen wurde in

    regelmigen, etwa 1-wchigen Intervallen gesammelt. Die Proben fr die genetischen

    Anstze wurden punktuell, d. h. im mglichst optimalen Entwicklungsstadium frisch und

    zeitnah zum Versuchsbeginn entnommen. Zustzlich wurde das fr die Hybridisierung

    gesammelte Material unmittelbar nach Entnahme und eventuell ntiger

    Prparation/Fixierung gekhlt aufbewahrt. Material fr die Isolierung von RNA oder DNA

    wurde direkt nach Entnahme in flssigem Stickstoff oder Trockeneis Schock gefroren

    und anschlieend bei -80 C gelagert. Knospen (vegetative und generative) und Bltter

    stammen hauptschlich aus dem Freiland des Botanischen Gartens Bochum (BGBO).

    Samen und junge weibliche () Zapfen von S. verticillata wurden grtenteils im Freiland

    des Botanischen Gartens in Marburg (BGM) gesammelt (Tab. 1).

    Tab. 1: bersicht des verwendeten Pflanzenmaterials.

    Art Pflanzenteil Herkunft

    Abies homolepis SIEBOLD &

    ZUCC.

    Nadeln & Triebe

    vegetative Knospen

    BGBO, Freiland

    BGBO, Freiland

    Arabidopsis thaliana L. Bltter/Grundblattrosette BGBO, Freiland

    Phyllocladus trichomanoides D.

    DON. var. trichomanoides

    Phyllokladien

    vegetative Knospen

    BGBO, Freiland

    BGBO, Freiland

    Picea abies (L.) H. KARST. var.

    abies

    Nadeln

    vegetative Knospen

    BGBO, Freiland

    BGBO, Freiland

    Pinus sylvestris L. Langtriebe & Kurztriebe/Nadeln BGBO, Freiland

    Sciadopitys verticillata

    (THUNB.) SIEBOLD & ZUCC.

    Kladodien & Langtriebe

    vegetative & generative Knospen

    junge Zapfen & Samen (versch. Stadien)

    reife Zapfen & Samen

    angekeimte Samen & Keimlinge

    BGBO, Freiland

    BGBO, Freiland

    BGM, Freiland

    BGBO/BGM, Freiland

    BGBO, Warmhaus

  • MATERIAL & METHODEN

    20

    2.1.2 Anzucht der Keimlinge

    Die Anzucht der keimfhigen Samen aus Marburg erfolgte im Botanischen Garten

    Bochum unter Warmhaus-Bedingungen bei 22 C, mit Lftung ab 26 C. Ausgest wurde

    in ein Torf-Sand-Gemisch (inklusive Drainageschicht) mit einer dnnen Abschlussschicht

    aus reinem Sand. Um die Substratoberflche abzudunkeln und vor Austrocknung zu

    schtzen wurde das Pflanzgef bis zum Auflaufen der Samen abgedeckt. Gewssert

    wurde einmal tglich, direkt auf das Substrat ohne die Keimlinge selbst zu benetzen. Im

    Zeitraum von Ende Oktober bis Mrz wurde von 6.00 bis 22.00 h zustzlich beleuchtet

    (OSRAM L 58/77, Fluora). Die entnommenen Samen bzw. Keimlinge wurden mit Hilfe von

    RNAse-freiem Wasser von Substratresten gereinigt. Bei Schdlingsbefall wurde mit

    Confidor WG70 (BAYER) als 0,03 %ige Lsung und/oder Mesurol Schneckenkorn

    (BAYER) behandelt.

    2.2 Morphologisch-anatomische Methoden

    2.2.1 Fixierung

    Das gesammelte Pflanzenmaterial (siehe 2.1) wurde in FAA, einem Gemisch aus

    Formalin, Ethanol und Eisessig, unmittelbar nach dem Sammeln fr mindestens 72 h

    fixiert und anschlieend in Ethanol (70 %) berfhrt (kurz waschen) und gelagert.

    Prpariert wurde unter einer Stereolupe Stemi SV11 von ZEISS bei bis zu 40 facher

    Vergrerung in Ethanol (70 %).

    FAA (100 ml)

    Ethanol (70 %, vergllt)

    Formalin (37 %)

    Eisessig (99-100 % ige Essigsure)

    90 ml

    5 ml

    5 ml

    2.2.2 Mikrotomtechnik

    Fr die Herstellung von Serienschnitten in Paraffintechnik wurden die anatomisch zu

    untersuchenden Prparate entwssert und fr mindestens 24 h in Ethanol (70 %)

    inkubiert (2.2.1). Die berfhrung in HISTOWAX (HISTOLAB PRODUCTS AB) erfolgte

    mittels tertirem (tert.) Butanol (Schmelzpunkt 25 C) als Intermedium (GERLACH, 1984)

    bei 37 C im Wrmeschrank. Die Prparate wurden dabei fr mindestens 24 h in

    folgenden Lsungen (I-VI) belassen:

  • MATERIAL & METHODEN

    21

    Lsung I: 20 ml tert. Butanol, abs. + 50 ml Ethanol (96 %), vergllt + 30 ml Aqua dest.

    Lsung II: 35 ml tert. Butanol, abs. + 50 ml Ethanol (96 %), vergllt + 15 ml Aqua dest.

    Lsung III: 55 ml tert. Butanol, abs. + 45 ml Ethanol (96 %), vergllt

    Lsung IV: 100 ml tert. Butanol, abs. + Eosin

    Lsung V: 100 ml tert. Butanol, abs.

    Lsung VI: 100 ml tert. Butanol, abs.

    Um die Objekte auch im Wachsblock sichtbar zu machen und im weiteren Arbeitsverlauf

    besser ausrichten zu knnen, wurde dem tertiren Butanol der Farbstoff Eosin

    beigemischt. Das Eosin lst sich im Verlauf des Frbevorganges durch Alkohol wieder

    heraus. Die entwsserten Proben wurden mit reinem tertirem Butanol in Glasdosen mit

    Rillendeckel bertragen und der Glasbehlter mit Wachskugeln aufgefllt. Die Proben

    wurden bei 63 C fr zwei bis drei Tage im verschlossenen Gef gelagert. Zum

    Verdampfen wurden die Deckel entfernt und die Gefe fr zwei bis drei weitere Tage im

    Wrmeschrank belassen.

    Einbetten:

    Das Einbetten der Proben in Wachs (Schmelzpunkt HISTOWAX bei ca. 58 C) erfolgte

    nach GERLACH (1984). Nach dem Einbetten wurden die Wachsblcke zugeschnitten und

    mittels eines Rotationsmikrotoms MOD 1130/Biocut (REICHERT JUNG) mit automatischem

    Objektrckzug 10 m dicke Serienschnitte der Objekte angefertigt. Im Anschluss wurden

    die fertigen Schnittbnder mit Eiweiglycerin (Glycerin/Hhnereiwei 1:1, nach

    MAYER; GERLACH 1984, S. 99 f) auf Objekttrger geklebt und bei ca. 40 C fr 1 bis 2 h

    getrocknet. Um ein Zerreien der Schnitte whrend des Schneidens zu verhindern bzw.

    zu verringern, wurden die entsprechenden (Paraffin-) Blcke mit Glycerin behandelt. Es

    ist hilfreich, die entsprechend angeschnittenen Blcke entweder fr ca. 24 h in Glycerin

    einzulegen oder die Schnittflche whrend des Schneidens wiederholt mit Glycerin zu

    bestreichen. Ein Zerreien ist gehuft bei kompakten Knospen und stark cutinisierten

    Strukturen (z. B. Nadeln) zu erwarten, da hier das Eindringen des Wachses in das Objekt

    erschwert wird. Auch verholzte Objekte erwiesen sich nach einer Behandlung mit

    Glycerin als besser schneidbar.

    Frben:

    Das Frben der Schnitte erfolgte mittels einer Safranin-Astrablau-Frbung nach

    GERLACH (1984, S. 128 f) und wurde wie folgt modifiziert. Dem Frben der Schnitte ging

    das Entfernen des Wachses mittels Roticlear (ROTH), anstelle von Histol, voraus.

    Anschlieend wurden die Schnitte als Vorbereitung auf das Anfrben ber eine

    absteigende Alkoholreihe auf die wssrige Safranin-Astrablau-Frbung vorbereitet:

  • MATERIAL & METHODEN

    22

    Roticlear I 10 min.

    Roticlear II 10 min.

    Roticlear/Isopropanol (abs.), 1:1 5 min.

    Isopropanol (abs.) 5 min.

    Etahnol (96 %) 5 min.

    Ethanol (70 %) 2 min.

    Ethanol (50 %) 2 min.

    Aqua dest. 2 min.

    Anfrben der Schnitte:

    Astrablau (0,5 g in 2 % iger Weinsurelsg.) 5 min.

    Aqua dest. kurz waschen

    Aqua dest. kurz waschen

    Aqua dest. kurz waschen

    Safranin (1 % w/v) 5 min.

    Aqua dest. kurz waschen

    Aqua dest. kurz waschen

    Aqua dest. kurz waschen

    Verholzte Zellwnde (Lignin) werden mit Safranin rot, reine Cellulose(wnde) mit

    Astrablau blau angefrbt. Um einer Pilzinfektion vorzubeugen, ist dem Astrablau eine

    Messerspitze Phenol zugesetzt. Eine bleibende berfrbung der Schnitte ist durch

    Differenzieren nach Augenma zu vermeiden:

    Aqua dest. + 3 Tropfen HCl (5 %)

    Im Anschluss an das Differenzieren erfolgte die Entwsserung und berfhrung in

    Roticlear, um die Serienschnitte fr das Eindecken vorzubereiten:

    Ethanol (70 %) kurz waschen

    Ethanol (96 %) kurz waschen

    Isopropanol (abs.) 2 min.

    Roticlear I 5 min.

    Roticlear II 5 min.

    Roticlear III 5 min.

    Fr die Herstellung von Dauerprparaten wurden die Schnitte mit ENTELLAN NEU

    (MERCK) eingedeckt. Zustzlich wurden mit einem Handmikrotom (ALLMIKRO) einzelne

  • MATERIAL & METHODEN

    23

    Gewebeschnitte von frischem Pflanzenmaterial (bzw. 24 h FAA-fixierten Proben) fr die

    Fluoreszenzmikroskopie hergestellt.

    2.2.3 Rasterelektronenmikroskopie (REM)

    Die in 70 %igem Ethanol aufbewahrten und prparierten Proben wurden vor der

    rasterelektronenmikroskopischen Untersuchung fr 12 h zur chemischen Entwsserung

    in FDA (Formaldehyd-Dimethyl-Acetal; FLUKA) berfhrt. Darber hinaus fungiert FDA als

    Intermedium bei der Critical-Poit-Trocknung (GERSTERBERGER & LEINS, 1978) und wurde

    im Verlauf des Trocknungsvorganges durch das eigentliche Trocknungsmedium CO2

    ersetzt, welches im flssigen Aggregatzustand (50 bar/10 C) vorliegt und dessen

    Kritischer Punkt bei 42 C/73 bar erreicht wird. Verwendet wurde ein Critical Porint Dryer

    CPD 030 der Firma BALZERS/BAL TEC AG.

    Fr die Prparation der Vegetationskegel von S. verticillata erwies es sich als vorteilhaft

    die Objekte nach der Trocknung (unmittelbar vor dem Aufkleben) nachzuprparieren. Je

    nach Prparatgre erfolgte das Aufbringen der Objekte auf die massiven

    Aluminiumzylinder entweder mit Leit-C (NEUBAUER CHEMIKALIEN) oder Leit-Tabs der Firma

    PLANO. Zur Vorbereitung auf das Rasterelektronenmikroskop werden Objekte mit Hilfe

    eines Sputtergertes SCD von BALZERS mit einer dnnen Schicht Gold belegt. Fr

    Gymnospermenknospen erwies sich eine Besputterungszeit von ca. 5 min. als optimal.

    Abhngig von der jeweiligen Oberflchenstruktur der Objekte musste teilweise

    nachtrglich erneut besputtert werden.

  • MATERIAL & METHODEN

    24

    2.3 Molekulargenetische Methoden

    2.3.1 Allgemeines

    Spezielle Abwandlungen bzw. Varianten der angegebenen Protokolle und

    Arbeitsschritte, sowie genauere Angaben zu jeweils speziell verwendeten Primern etc.

    werden im Folgenden eher allgemein behandelt. Die betreffenden Arbeitsschritte

    werden, im Zuge der Methodenetablierung fr Gymnospermen, im entsprechenden

    Ergebnisteil aufgegriffen und Objekt bezogen(er) besprochen.

    2.3.1.1 Primerdesign

    ber die Suche in der Datenbank des National Center for Biotechnology Information

    (http://www.ncbi.nlm.nih.gov/), kurz NCBI, wurden bekannte Gensequenzen aus-

    gewhlter Pflanzen ermittelt. Zum Erstellen degenerierter Primer wurden entsprechende

    Gensequenzen aus Angio- und Gymnospermen ausgewhlt und in einem Alignment

    unter Anwendung des Programms VectorNTI (INVITROGEN) verglichen. Hergestellt wurden

    abhngig vom jeweiligen Versuchsansatz auch spezifische Primer. Die Synthese der

    Primer aus der angegebenen Basensequenzen erfolgte durch die Firma MWG BIOTECH

    (http://www.mwg-biotech.com).

    2.3.1.2 Sequenzanalyse

    Die zur Verifizierung von Klonierungsprodukten ntige Sequenzierung der DNA wurde

    von der Firma MWG BIOTECH (http://www.mwg-biotech.com) durchgefhrt. Ein

    anschlieender Abgleich der erhaltenen mit bereits vorhandenen Sequenzen erfolgte

    ber die Datenbank-eigene BLAST-Funktion von NCBI (Blast Search:

    http://www.ncbi.nlm.nih.gov/blast/Blast).

    2.3.2 Material fr molekulargenetische Methoden

    Die in diesem Kapitel verwendeten Lsungen und Medien werden, sofern nicht allgemein

    im Abschnitt Lsungen erlutert, im jeweils zugehrigen thematischen Versuchsabschnitt

    bzw. Methodenteil direkt aufgefhrt. Smtliche Lsungen fr die in-situ-Hybridisierung

    oder andere RNase-sensitive Schritte wurden mit Diethyl-Pyrocarbonat (0,1 %)-

    behandeltem Aqua dest. (DEPC-H2O) und Chemikalien in p.a.-Qualitt (frisch) angesetzt.

    Die entsprechenden Lsungen und entsprechendes Material (Glasware etc.) wurden

    autoklaviert bzw. sterilisiert. Die verwendeten Chemikalien, Verbrauchsmaterialien,

    Enzyme etc. sind in Tabelle 2 aufgefhrt.

  • MATERIAL & METHODEN

    25

    Tab. 2: Verwendete Materialien.

    I. Chemikalien:

    Acrylamid

    BCIP/NBT (SIGMAFAST)

    Borsure

    Bromphenolblau

    BSA, Fraktion V

    CaCl2

    Chloroform

    Coomassie Brilliant Blue R250

    Denhardts Lsung

    DEPC

    Dextransulfat (Natriumsalz)

    EDTA (Titriplex)

    Eosin

    Essigsure (100 %)

    Essigsureanhydride

    Ethanol p.a

    Ethidiumbromid

    Formaldehyd (37 %)

    Formamid

    Glucose

    Glutathion

    Glycin

    Glycerin

    HCl (36-38 %)

    HCl (2M, Lsg.)

    IPTG

    Isopropanol

    KCl

    Lithiumchlorid

    MgCl2.6 H20

    -Mercaptoethanol

    Methanol

    NaCl

    Na2HPO4.2 H2O

    NaH2PO4.H2O

    NaOH (Pellets)

    NaOH (4M, Lsg.)

    Natriumacetat

    OrangeG

    Paraformaldehyd (16 %)

    Polyvinylalkohol

    Roti-Histol

    SDS

    APPLICHEM

    SIGMA ALDRICH

    APPLICHEM

    SIGMA-ALDRICH

    APPLICHEM

    J. T. BAKER, BAKER ANALYZED

    J.T. BAKER, BAKER ANALYZED

    SIGMA-ALDRICH

    APPLICHEM

    APPLICHEM

    APPLICHEM

    MERCK

    WALDECK DIVISION CHROMA

    VWR LABORHANDEL

    SIGMA-ALDRICH

    MERCK

    APPLICHEM

    J. T. BAKER, BAKER ANALYZED

    VWR-NORMAPUR

    J.T. BAKER

    MERCK

    APPLICHEM

    J.T. BAKER

    J.T. BAKER, BAKER ANALYZED

    APPLICHEM

    APPLICHEM

    J.T. BAKER, BAKER ANALYZED

    J.T. BAKER, BAKER ANALYZED

    J.T. BAKER, BAKER ANALYZED

    APPLICHEM

    MERCK

    J. T. BAKER

    J.T. BAKER, BAKER ANALYZED

    J.T. BAKER, BAKER ANALYZED

    J.T. BAKER, BAKER ANALYZED

    J.T. BAKER, BAKER ANALYZED

    RIEDEL-DE HAEN

    J.T. BAKER, BAKER ANALYZED

    APPLICHEM

    ELECTRON MICROSCOPY SCIENCE

    MERCK

    ROTH

    APPLICHEM

  • MATERIAL & METHODEN

    26

    Select Pepton

    Triethanolamin

    Tris

    TrisHCl

    Trypton

    Tween 20

    x-Gal

    BD BIOSCIENCE

    FLUKA/BIOCHEMIKA

    APPLICHEM

    APPLICHEM

    APPLICHEM

    APPLICHEM

    APPLICHEM

    II. Verbrauchsmaterial:

    Agar

    Agarose

    Ampicillin

    Entellan

    Histowax

    Paraplast Plus

    PROTRAN BA85 , 0,45 m / 82 mm

    POLYSINE Microscope Slides, precleaned;

    BD BIOSCIENCE

    BIOZYM

    APPLICHEM

    MERCK

    HISTOLAB PRODUCTS AB

    TYCO HEALTHCARE/KENDALL

    WHATMAN

    ESCO/ERIE SCIENTIFIC COMPANY

    III. Enzyme & Sonstiges

    PWO-Polymerase (1 u/l)

    Taq-Polymerase (5 u/l)

    T4-DNA-Ligase (1u/l)

    T7-Polymerase (1u/l)

    ProteinaseK-Lsg. (20mg/ml)

    RevertAid H Minus M-MuLV Reverse Transkriptase (200u/l)

    RNaseA (10 mg/ml)

    Restriktionsendonukleasen

    *

    Yeast tRNA

    GeneRuler TM 100bp DNA LadderPlus (0,5 g/Spur)

    Hefe-Extrakt

    DIG RNA Labeling Mix (DIG UTPs)

    Nukleasefreies H2O, Molecular Biology Grade

    SDS-Marker (MW-SDS-70L, 66 kDa)

    PEQLAB

    PEQLAB

    FERMENTAS

    FERMENTAS

    APPLICHEM

    FERMENTAS

    APPLICHEM

    NEW ENGLAND BIOLABS (NEB)

    *

    INVITROGEN (LIFE TECHNOLOGIES)

    FERMENTAS

    BD BIOSCIENCE

    ROCHE

    EPPENDORF

    SIGMA-ALDRICH

    2.3.2.1 Oligonukleotide

    Die in dieser Arbeit verwendeten spezifischen und degenerierten Primer (dP) sind in

    Tabelle 3 aufgelistet.

    Tab. 3: Verwendete Primer.

    Primer Sequenz

    dP-SvKnox for1

    dP-SvKnox for2

    dP-SvKnox rev1

    5-CCRGARYTMGAYCARTTYATGGARGCWTAC 3

    5-AAGAARAARAAGAAAGGDAARCTYCC 3

    5-GGRAGYTTHCCTTTCTTYTTYTTCTT 3

  • MATERIAL & METHODEN

    27

    dP-SvKnox rev2

    Knat1 for

    Knat1 rev

    PaHbk1 for

    PaHbK1rev

    PhyN1 for

    PhyN1 rev

    SvSondeKnox for1

    SvSondeKnox for2

    SvSondeKnox rev1

    SvSondeKnox rev2

    SvGST for

    SvGST rev

    5-ATRAACCAATTRTTKATTTGYTTYTGATCYARCCC3

    5GGAATTCCATGGAAGAATACCAGC 3

    5GGGGTACCCCTTATGGACCGAGACG -3

    5-CCTCGAGGGTACCCATGGAGCACCTGAATGCAG -3

    5-GCGGCCGCGAGCTCGTTAGCAATCCAAATGATAGCC 3

    5CGAATTGGGTACCGATGATCATGGGGAGGTGAT 3

    5GCTGGAGCTCGATGTTGGGCTTCTGAGTGA 3

    5CCGAGCTCGAAGATTGCAGCACTGGTGAA 3

    5CTCAAGCTTAAGTTTACCTTTCTTTTTCTTCTTC 3

    5CCGAGCTCAAGTTTACCTTTCTTTTTCTTCTTC 3

    5CTAAGCTTGAAGATTGCAGCACTGGTGAA 3

    5CAGTGAATTCCCGGAGTTAGATCAATTTATGGA 3

    5GCCCTCGAGAAGTTTACCTTTCTTTTTCTTCTT 3

    2.3.2.2 Plasmide

    Fr die Klonierung von erstellten PCR-Fragmenten kamen folgende Plasmide zum

    Einsatz:

    Tab. 4: Verwendete Plasmide.

    Plasmid Quelle

    pBlueskript SK +

    pCR II TOPO

    pJET 1.2

    pGEM-11Zf

    pGEX-4T1

    STRATAGENE

    INVITROGEN

    FERMENTAS

    PROMEGA

    GE HEALTHCARE

    2.3.2.3 Bakterienstmme

    Zur Amplifikation von DNA und zur heterologen Expression wurden verschiedene

    Stmme von E. coli verwendet: Tab. 5: Verwendete Bakterienstmme.

    Stamm Genotyp Quelle

    DH5*

    TOP10

    BL21(DE3)

    F-80dladacZM15, rec A1, end A1, gyrA96, thi-1, hsd R17, (rK-mK-), sup E44, rel A1, deo R, (lac ZYA-arg F) U169 F- mcr A (mrr-hsd RMS-mcr BC) 80lac ZM15 lacX74 rec A1 deo R ara D139 (ara-leu)7697 galU galK rpsL (StrR) end A1 nup G F- ompT hsdSB(rB-mB-) gal dcm (DE3)

    HANAHAN, 1983

    INVITROGEN

    INVITROGEN

    *nur fr Amplifkation der Vektoren verwendet

  • MATERIAL & METHODEN

    28

    2.3.2.4 Kits

    Im Rahmen dieser Arbeit wurden fr verschiedene molekularbiologische Arbeiten

    unterschiedliche Kits verwendet. Die verwendeten Kits sind in Tabelle 6 aufgelistet.

    Tab. 6: Verwendete Kits.

    Methode Produkt (Hersteller)

    Isolierung von Nukleinsuren

    Aufreinigung von Nukleinsuren

    cDNA-Synthese

    Gelelution/Extraktion

    Ligation

    Sondenherstellung/Markierung

    Detektion

    - Rneasy Plant Mini Kit for Isolation of Total RNA from Plant

    Cells and Tissue and Filamentous Fungi (QIAGEN)

    - DNeasy Plant Mini Kit for Isolation of Total DNA from

    Plant Cells and Tissue (QIAGEN)

    - FastPlasmid Mini Kit (EPPENDORF)

    - RNA-Clean up Kit (MACHERYNAGEL)

    - Revert Aid H Minus First Strand cDNA Synthesis Kit

    (FERMENTAS)

    - Perfectprep Gel Cleanup Kit (EPPENDORF)

    - GeneJet PCR Cloning Kit (FERMENTAS)

    - TA Cloning Kit (INVITROGEN)

    -Transcript AidTM T7 High Yield Transcription Kit

    (FERMENTAS)

    - DIG Nucleic Detection Kit (ROCHE)

    2.3.2.5 Lsungen

    Verwendung fanden folgende Puffer und Stammlsungen. Weitere, aus den

    Stammlsungen angesetzte Lsungen, sind direkt in den jeweiligen Versuchsablufen

    aufgefhrt.

    DEPC-H2O, 1000 ml:

    1 ml DEPC auf 1000 ml Aqua dest.,

    ber Nacht rhren (Abzug!),

    im Anschluss autoklavieren!

    Dextransulfat:

    10 g Dextransulfat in 15 ml

    DEPC-H2O

    DNA-Probenpuffer (4x):

    40 % (w/v) Saccharose

    0,1 % (w/v) OrangeG

    DNA-Probenpuffer (5x):

    50 % (w/v) Glycerin

    0,1 % (w/v) Bromphenolblau

    NTE, pH 8,0:

    0,5 M NaCl

    10 mM Tris-HCl

    1 mM EDTA

    Puffer 1, pH 7,5:

    100 m Tris-HCl

    150 mM NaCl

  • MATERIAL & METHODEN

    29

    Puffer 2, pH 9,5:

    100 mM Tris-Base

    100 mM NaCl

    50 mM MgCl2

    PBS (10x):

    1,3 M NaCl

    0,07 M Na2HPO4

    0,03 M NaH2PO4

    DEPC-H2O ad 1000 ml

    Proteinase K-Puffer:

    20 mM Tris-HCl, pH 7,0

    2 mM CaCl2

    Salze (10x):

    3 M NaCl

    0,1 M Tris

    0,05 M EDTA

    0,5 M NaH2PO42 H2O

    0,5 M Na2HPO4

    SSPE (20x), pH 7,4:

    3M NaCl

    20 mM EDTA

    200 mM NaH2PO42 H2O

    TBE (1x), pH 8:

    90 mM Trisbase

    90 mM Borsure

    2, 5 mM EDTA

    2.3.3 Isolierung von RNA & DNA aus Pflanzen

    Die Isolierung der Gesamt-RNA aus Pflanzenmaterial (vergleiche 2.1, Tab. 1) erfolgte

    mittels RNeasy Plant Mini Kit von QIAGEN (Tab. 6). Hierzu wurde das Pflanzenmaterial in

    flssigem Stickstoff pulverfein gemrsert. Die Isolierung erfolgte nach Angaben des

    Herstellers inklusive aller Optionalschritte und unter Verwendung des RLT-Puffers.

    Eingesetzt wurden max. 100 mg des Gewebepulvers. Nach Zugabe von 450 l RLT-

    Puffer wurden die Zellen unter vortexen und zustzlicher 1 bis 3 min. Inkubation bei

    56 C unter Zuhilfenahme eines Mini-Pistills lysiert. Zum Scheren der DNA und zur

    weiteren Homogenisierung bzw. Reduktion der Viskositt wurde die Probe durch einen

    Filter (QIASHREDDER) zentrifugiert (2 min./13.000 rpm). Der wssrige berstand wurde

    mit 0,5 Volumen Ethanol (100 %) versetzt. Die Probe wurde komplett auf einen Filter

    gegeben und durch Zentrifugation (15 sec./10.000 rpm) an eine Silica-Gelmembran

    gebunden. Die Membran wurde im Anschluss dreimal gewaschen: mit 700 l RW1-Puffer

    und Zentrifugation fr 15 sec. bei 10.000 rpm, mit 500 l RPE-Puffer inklusive einer

    Zentrifugation fr 15 sec. bei 10.000 rpm und 500 l RPE fr 2 min. Durch 1 min.

    Zentrifugation bei maximaler Geschwindigkeit wurde die Membran getrocknet. Die RNA

    wurde mit 30 l RNase freiem H2O eluiert.

    Fr die DNA-Isolierung aus Pflanzenmaterial wurde das DNeasy Plant Mini Kit der Firma

    QIAGEN (Tab. 6) verwendet. Nach Herstellerangaben wurde das Stickstoff-gemrserte

    Gewebepulver (max. 100 mg frisch oder 20 mg trocken) mit 400 l des mitgelieferten

    A1-Puffers und 4 l RNAse (100 mg/m