Tt

JSC

a

ARRAA

KBTT

1

ttuatrftrpo

enaCit

s

1h

Process Biochemistry 47 (2012) 1889–1893

Contents lists available at SciVerse ScienceDirect

Process Biochemistry

jo u rn al hom epage: www.elsev ier .com/ locate /procbio

risporic acid stimulates gene transcription of terpenoid biosynthesis in Blakeslearispora

ie Sun, Hao Li, Xinxiao Sun, Qipeng Yuan ∗

tate Key Laboratory of Chemical Resource Engineering, College of Life Science & Technology, Beijing University of Chemical Technology, Post Box No. 75, Bei San Huan East Road 15,hao Yang District, Beijing 100029, China

r t i c l e i n f o

rticle history:eceived 15 August 2011eceived in revised form 6 February 2012ccepted 15 June 2012vailable online 23 June 2012

a b s t r a c t

The zygomycete Blakeslea trispora is used commercially to produce �-carotene. Trisporic acid (TA), thepreviously discovered pheromone of B. trispora, is considered to be the main inducer of carotene biosyn-thesis. To gain insight into the regulatory mechanisms of TA that controls terpenoid biosynthesis, changesin the contents of �-carotene, ubiquinone, and ergosterol in the (−) strain of B. trispora after TA additionwere measured. Transcription products of eight genes encoding enzymes in terpenoid biosynthesis were

eywords:lakeslea trisporaerpenoid biosynthesisrisporic acid

also analyzed. The addition of TA to the B. trispora culture increased the production of �-carotene andubiquinone, while the ergosterol content remained unchanged during the first 48 h after TA addition anddecreased slightly thereafter. Four genes in the �-carotene biosynthetic pathway (ipi, carG, carRA, andcarB) had increased expression following TA addition. These data suggest that TA increases terpenoidproduction in B. trispora by stimulation of transcription. This study contributes to a better understandingof the regulatory mechanisms of TA on terpenoid biosynthesis.

. Introduction

Blakeslea trispora, which belongs to the order Mucorales withinhe class Zygomycetes, has gained much attention for its abilityo produce high amounts of �-carotene and potential to producebiquinone (coenzyme Q) and ergosterol. �-Carotene functionss an antioxidant that can protect against cancer and stimulateshe immune system [1]. Ubiquinone is a lipid-soluble antioxidantesponsible for the exchange of reducing equivalents between dif-erent electron-transfer complexes and has been successfully usedo treat cardiovascular disease [2]. Ergosterol is involved in theegulation of membrane fluidity and the distribution of integralroteins [3], and can be used as a raw material for the productionf vitamin D2, cortisone, and progesterone.

In Mucorales, the biosynthesis of carotenes, ubiquinone, andrgosterol occurs via the mevalonate pathway [4,5]. Briefly, far-esyl pyrophosphate (FPP) can be enzymatically synthesized from

cetyl-CoA by 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-oA) synthase, HMG-CoA reductase (encoded by gene hmgR),

sopentenyl pyrophosphate (IPP) isomerase (ipi), and FPP syn-hase (isoA). FPP is converted into geranylgeranyl pyrophosphate

∗ Corresponding author. Tel.: +86 10 64414668; fax: +86 10 64437610.E-mail addresses: sunjiehh@126.com (J. Sun), lihao@mail.buct.edu.cn (H. Li),

unxinxiao@126.com (X. Sun), yuanqp@mail.buct.edu.cn (Q. Yuan).

359-5113/$ – see front matter © 2012 Elsevier Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.procbio.2012.06.017

© 2012 Elsevier Ltd. All rights reserved.

(GGPP) and the ergosterol precursor squalene by GGPP synthase(carG) and squalene synthase (erg9), respectively. GGPP is con-verted to phytoene, lycopene, and �-carotene by the bifunctionalenzyme lycopene cyclase/phytoene synthase (carRA) and phytoenedehydrogenase (carB). The precursor of ubiquinone is synthe-sized from GGPP and 4-hydroxybenzoate by para-hydroxybenzoatepolyprenyltransferase (coq2).

One of the primary factors that regulate carotene biosynthe-sis in Mucorales is sexual stimulation. Mating of (+) and (−)strains increases �-carotene production 13–15-fold [6]. The stim-ulation of carotene biosynthesis is based on the diffusion ofmating-type specific pheromones that are degradation productsof �-carotene [7]. One of these products is trisporic acid (TA),which triggers the accumulation of �-carotene and the develop-ment of zygospores. TA is classified by five different series: A, B,C, D, and E [7,8], of which TA-B and TA-C are the most abun-dant [9]. Moreover, TA-B activates carotene production in the (−)strain to a greater extent than TA-C [10,11]. However, the regula-tory mechanisms of TA on terpenoid biosynthesis remain largelyunknown.

In this study, changes in �-carotene, ubiquinone, and ergosterolproduction in B. trispora (−) strain were measured in response to theaddition of TA. The expression of terpenoid biosynthetic pathway

genes, hmgR, ipi, isoA, carG, coq2, erg9, carRA, and carB, in responseto TA stimulation was also analyzed. Our data provide insight intothe regulatory mechanisms of TA on �-carotene production at themolecular level.

1 hemistry 47 (2012) 1889–1893

2

2

aKm

(s1

2

Tfiw(

1vai

2

aeciep

2

TMt

(aRpMatbtT

TD

Table 2Real-time PCR primers used in this study.

Genes Forward and reverse primers (5′ → 3′) Amplicon length (bp)

ipi TCTCACCCCTTAAATACAGCAGATG 161CTCGGTGCCAAATAATGAATACG

erg9 GCTTAAAGCCTGAATTTCAACAAG 128GAGATCAAAGTCGGCAATGGTAG

carG AATTGTTTTGGCGTGACACCTT 129CAGTTCCCGATTGACTAGCTTCTT

coq2 TGCCATTTCACCTAAGCAAGC 158GCCAATAAGTGACACGTTTCATCA

isoA CCAAGGCTAACCCTGAACAACG 74CTTGGCTTCAGATTCAGCATTCTTC

hmgR AAACGATGGATTGAACAAGAGGG 113TAGACTAGACGACCGGCAAGAGC

carRA CTAAAGCCGTTTCACTCACAGCA 129ACAAGTAGGACAGTACCACCAAGCG

carB AGACCTAGTACCAAGGATTCCACAA 92AGAACGATAGGAACACCAGTACCTG

tef1 CTTCTCAAGCCGATTGTGCTATTC 120

890 J. Sun et al. / Process Bioc

. Materials and methods

.1. Strains and culture conditions

B. trispora ATCC 14272 (−) was maintained on potato dextrosegar plates (30% [w/v] potato extract, 2% [w/v] glucose, 0.1% [w/v]H2PO4, 0.01% [w/v] MgSO4). Spores were harvested by rinsing theature cultures with distilled water.B. trispora was cultivated in liquid synthetic mucor medium

SMM) [12] containing 1% malt extract at a concentration of 8 × 103

pores per milliliter of medium. The flasks were incubated at 28 ◦C,80 rpm, and in the dark.

.2. Separation of TA

TA was extracted as described by Schimek et al. [13]. Briefly,A recovered from acidified (pH 2) culture medium was puri-ed by silica gel thin-layer chromatography. TA concentrationsere calculated using specific extinction coefficients for TA

E325 nm 1% cm = 572) [14].Cultures (36-h-old, 50 mL) were treated with 35, 50, 70, or

05 �g TA-B or ethanol without TA-B as a control, in the same totalolume. The mycelia were subsequently harvested, squeeze-dried,nd frozen in liquid nitrogen. These experiments were performedn triplicate.

.3. Terpenoid extraction and chemical analysis

The mycelia were washed with water, lyophilized, weighed,nd broken with a mortar and pestle in the presence of petroleumther (boiling point 40–60 ◦C). Debris was removed by low-speedentrifugation, and the samples were vacuum-dried and dissolvedn petroleum ether. The contents of �-carotene, ubiquinone, andrgosterol in the petroleum ether extracts were measured by higherformance liquid chromatography [15].

.4. Cloning EST sequences of ipi, carG, coq2, and erg9

Total RNA was extracted with TRIzol (Invitrogen, Carlsbad, USA).he cDNA synthesis reaction was carried out with oligo(dT)18 andMLV reverse transcriptase (Promega, Madison, USA), according

o the manufacturer’s instructions.Degenerate PCR primers for the genes ipi, carG, coq2, and erg9

Table 1) were designed based on the conserved sequencesmong Phycomyces blakesleeanus, Mucor circinelloides, andhizopus oryzae (sequences obtained from http://genome.jgi-sf.org/Phybl2/Phybl2.home.html, http://genome.jgi-psf.org/ucci2/Mucci2.home.html, and http://www.broadinstitute.org/

nnotation/genome/rhizopus oryzae/MultiHome.html, respec-

ively), using the CODEHOP method (http://blocks.fhcrc.org/locks/make blocks.html) [16], and taking codon usage of B.rispora into consideration (http://www.kazusa.or.jp/codon/).ouchdown PCR was performed as follows: 95 ◦C for 5 min,

able 1egenerate PCR primers used in this study.

Genes Forward and reverse primers (5′ → 3′) Amplicon length (bp)

ipi CGTGCCTTTAGTGTNTTYTTRTTYG 440CAGATAAGCTTGAACCADGGDGTCAT

carG CCTGTCGCTCAYMAYATHTAYGG 398GTAAGATCTTCACARAANCCYTTRTT

erg9 TGGCCCAAAYGARAARGAYMG 218CAAGACCAGCNACRTARTGRCA

coq2 GGCTGTACAATTAAYGAYYTNTGGGA 304ATCCCGTCATNGCNSWCCA

GGACACCCAAGGTGAAGGCAA

10 cycles at 95 ◦C for 30 s, 65–55 ◦C for 30 s (the annealingtemperature decreased 1 ◦C in every cycle), and 72 ◦C for 30 sthen followed by 25 cycles at 95 ◦C for 30 s, 55 ◦C for 30 s,and 72 ◦C for 30 s. To confirm the validity of the primers, thefour PCR fragments were gel purified and sequences wereconfirmed at the amino acid level with the Blastx program(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&BLASTPROGRAMS=blastx&PAGE TYPE=BlastSearch&SHOW DEFAULTS=on&LINK LOC=blasthome).

2.5. Real-time PCR

The real-time PCR primers are presented in Table 2. The primerswere designed within the EST sequences obtained above to detectthe transcripts of ipi, carG, coq2, and erg9. Additional real-time PCRprimers were designed based on the partial cDNA sequences ofthe genes hmgR [17], isoA [18], carRA and carB (GenBank acces-sion number AY884174), and tef1 (encoding translation elongationfactor 1-alpha; GenBank accession number AF157235).

First-strand cDNA synthesis was performed using 1 �g totalRNA and 0.4 �g random hexamers. Relative quantification was per-formed using RealSuper Mixture (CWBiotech, Beijing, China) ona Mastercycler Realplex2 cycler (Eppendorf, Hamburg, Germany).The real-time PCR cycling conditions were as follows: 95 ◦C for10 min followed by 40 cycles at 95 ◦C for 15 s, 59 ◦C for 25 s, and72 ◦C for 30 s. Measurements were performed in triplicate. Allresults were normalized to the tef1 gene and presented as rela-tive to expression of the corresponding group without TA addition(value = 1), using the comparative method of Livak and Schmittgen[19].

2.6. Statistical analysis

The means of three independent experiments are presented inFigs. 1 and 2. Each data point represents the mean and the error barsrepresent the standard error of the mean. Data were analyzed using

Student’s t-test. A P-value less than 0.05 was considered statisticallysignificant.

J. Sun et al. / Process Biochemist

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

5

0 6 12 18 24 30 36 42 48 54 60 66 72 78 84 90 96

Time after TA add ition, hou rs

β-C

aro

ten

e, u

biq

uin

on

e, a

nd

erg

ost

ero

l m

g/g

dry

bio

mas

s

0.5

1

1.5

2

2.5

3

3.5

4

0 12 24 36 48 60 72 84 96

Dry

bio

mas

s, g

/lWithout TA

With TA

Fig. 1. �-Carotene, ubiquinone, and ergosterol levels of B. trispora cultures after TAtreatment. The square, rhombus, and triangle represent �-carotene, ubiquinone, andergosterol contents, respectively. Filled symbols represent B. trispora cells treatedwith TA and open symbols represent the control. Values are the mean± standarderror of three independent experiments.

0

1

2

3

4

5

6

7

Fo

ld c

han

ge

1 h

3 h

6 h

12 h

**

*

*

**

**

**

* *

hmgr ipi isoA carG coq2 erg9 carRA carB

A

0369

1215182124273033363942

Fo

ld c

han

ge

35 μg

70 μg

105 μg

***

**

**

** ****

*

**

**

**

**

hmgr ipi isoA carG coq2 erg9 carRA carB

B

Fig. 2. Transcription of genes involved in terpenoid biosynthesis. All results werenormalized to the tef1 gene and are expressed relative to expression of the corre-sponding control group (without TA addition; value = 1). A: Time courses of genetranscription after the addition of 50 �g TA; B: Gene transcription 3 h after treat-ment with different amounts of TA. Values are the mean ± standard error of threeindependent experiments. Values > 1 represent greater expression compared withthe control group. *means significantly different from the corresponding controlgroup (P < 0.05) and **(P < 0.01).

Table 3Homology to GenBank sequences using the Blastx algorithm.

GenBank access number Protein identification number Organism

JK017326 CAP17174.1 Mucor circinelloides

JK017328 CAB89115.1 Mucor circinelloides

JK017329 XP 003335618.1 Puccinia graminis

JK017327 CBX94862.1 Leptosphaeria macula

ry 47 (2012) 1889–1893 1891

3. Results and discussion

TA is secreted from mycelia of B. trispora when (+) and (−) strainsmate, which induces the accumulation of �-carotene. The effectsof TA at both metabolic and transcriptional levels were assessedin this study. B. trispora ATCC 14272 (−) was chosen for this studybecause (−) strains do not produce TA [20] and the production of�-carotene in (−) strains increases when exogenous TA is added tothe culture medium [11].

3.1. Effects of TA on ˇ-carotene, ubiquinone, and ergosterolbiosynthesis

The effects of TA on the biosynthesis of �-carotene, ubiquinone,and ergosterol were measured by the addition of 50 �g TA-B to36-h-old B. trispora cultures (Fig. 1). TA significantly increased thebiosynthesis of both �-carotene and ubiquinone 6 h after treatment(P < 0.05). The production of �-carotene and ubiquinone increasedby 80% and 66%, respectively, 24 h after TA addition. The changesin the content of ergosterol occurred much later than that of�-carotene and ubiquinone. No effect on the biosynthesis of ergos-terol was observed during the first 48 h after treatment with TA.After 48 h, the ergosterol content in the control group (withoutTA addition) was greater than that in the TA-treated group. At theend of the culture period, the content of ergosterol in the controlgroup was 11.9% higher than that in the TA-treated group (P < 0.05).The dry biomass of mycelia increased slightly after TA addition,indicative of growth.

Our data indicate that the production of �-carotene andubiquinone, but not ergosterol, increases following addition ofexogenous TA. However, Kuzina et al. reported that ubiquinoneand ergosterol levels were not affected by increased productionof �-carotene induced by sexual interaction [21]. The intracellu-lar reactions induced by the addition of exogenous TA may notbe the same as those induced by sexual interaction. Other mecha-nisms that affect ubiquinone production likely exist during sexualinteraction.

Radiolabeling experiments have demonstrated that inZygomycetes, ergosterol and ubiquinone are synthesized inthe same compartments or in compartments that exchangeprecursors [4,21]. This may explain why the ergosterol contentdecreases and the ubiquinone content increases when ketocona-zole, an inhibitor of ergosterol biosynthesis, is added to B. trisporacultures [15]. Therefore, the moderately reduced final contentof ergosterol may be related to the significantly increased finalcontent of ubiquinone due to competition for common precursors.TA may affect the content of ergosterol by altering the metabolicflow.

3.2. Cloning EST sequences of ipi, carG, coq2, and erg9

The EST sequences of ipi, carG, coq2, and erg9 were cloned usingdegenerate primers. These sequences have been submitted to theGenBank EST database as accession numbers JK017326, JK017328,JK017329, and JK017327, respectively. A summary of the homology

Protein/domain Expectation value Score (bits)

Isopentenyl-diphosphatedelta-isomerase

2 × 10−64 248

Geranylgeranyl pyrophosphatesynthase

10−42 176

Para-hydroxybenzoatepolyprenyltransferase

3 × 10−31 138

ns Squalene synthase 4 × 10−11 71.6

1892 J. Sun et al. / Process Biochemistry 47 (2012) 1889–1893

Fig. 3. Effects of TA on the terpenoid biosynthesis in B. trispora. Transcription of genes and production of metabolites in red circles were increased after treatmentw lyl pyrg

siiJepf

3

ttoswtT(Hmii(rtieAt

3t

uptAe

ith TA. HMG-CoA, 3-hydroxy-3-methylglutaryl-coenzyme A; DMAPP, dimethylaleranylgeranyl pyrophosphate.

earch results in GenBank using the BLAST algorithm [22] is shownn Table 3. Blastx analysis identified strong matches to previouslydentified proteins (P < 10−11); JK017326, JK017328, JK017329, andK017327 belong to the genes ipi, carG, coq2, and erg9, whichncode isopentenyl-diphosphate delta-isomerase, geranylgeranylyrophosphate synthase, para-hydroxybenzoate polyprenyltrans-erase, and squalene synthase, respectively.

.3. Gene transcription analysis

To explore the molecular mechanisms underlying the highererpenoid production observed after TA addition, 36-h-old B.rispora cultures were treated with TA-B and the gene expressionf eight enzymes involved in terpenoid biosynthesis was mea-ured by real-time PCR. As shown in Fig. 2, the gene expressionas affected by TA addition. The results show that TA responses at

he transcriptional level occur earlier than at the metabolic level.ranscription of the four �-carotene biosynthetic pathway genesipi, carG, carRA, and carB) increased 3 h or 6 h after TA treatment.owever, gene expression was similar between control and treat-ent groups 12 h after TA addition. Transcription predominantly

ncreased in a TA dose-dependent manner. Significant differencesn transcription were not observed 3 h after a lower amount of TA35 �g) was added, but increased amount of TA (70 �g or 105 �g)esulted in a significant increase in transcription. An overview oferpenoid biosynthesis in B. trispora is presented in Fig. 3. Accord-ng to Kuzina et al., the biosynthetic pathways for ubiquinone andrgosterol are not in the same compartment with �-carotene [21].s shown in Fig. 3, the addition of TA causes significantly increased

ranscription of genes involved in �-carotene biosynthesis.

.3.1. Quantitative analysis of ipi, carG, carRA, and carBranscripts

IPP isomerase catalyzes the conversion of the relativelynreactive IPP to the more reactive electrophile dimethylallyl

yrophosphate (DMAPP) [23]. Real-time PCR data demonstratedhat the expression of ipi was elevated following TA addition.s compared with the control group that did not receive TA, ipixpression increased 4.3-fold 6 h after treatment with 50 �g TA and

ophosphate; IPP, isopentenyl pyrophosphate; FPP, farnesyl pyrophosphate; GGPP,

7.07-fold 3 h after treatment with 70 �g TA, suggesting that TA mayincrease production of the terpenoid precursor DMAPP.

The formation of GGPP is catalyzed by GGPP synthase (Fig. 3).As compared with the control group without TA addition, expres-sion of carG 3 h after TA treatment increased in a dose-dependentmanner (2.5-fold for 50 �g TA, 6.7-fold for 70 �g TA and 8.6-foldfor 105 �g TA). As a consequence of increased expression of carG,the abundance of GGPP, the common precursor of �-carotene andubiquinone, is also likely increased following treatment with TA.

The genes involved in �-carotene biosynthesis in B. trispora werepreviously identified by Rodriguez-Saiz et al. [24]. CarB encodesphytoene dehydrogenase, and carRA encodes a bi-functionalenzyme with lycopene cyclase activity and phytoene synthaseactivity [24]. TA treatment increased expression of carRA andcarB (P < 0.01). The addition of 70 �g TA led to 32.8- and 29.7-fold increase in the transcripts of carRA and carB, respectively.These results are consistent with the previous report of increasedcarRA and carB transcription observed during sexual interactionin B. trispora [25]. Transcription factors must bind to promotersequences to induce gene transcription. Ste11 and Mot3 bindingsites are located in a bi-directional promoter sequence shared bycarRA and carB of B. trispora [24,25]. Ste11 and Mot3 are both tran-scriptional regulators involved in sexual interaction that occur inyeast [26,27], and may be related to the increase of carB and carRAtranscription regulated by TA. The promoter structures of genesregulated by TA or sexual interaction require further identificationand characterization.

3.3.2. Quantitative analysis of hmgR, isoA, coq2, and erg9expression

HMG-CoA reductase, the rate-limiting enzyme of the meval-onate pathway, reduces HMG-CoA to mevalonate [28]. Expressionof hmgR in cultures remained stable 3 h after treatment with dif-ferent amounts of TA. Transcription of hmgR increased slightly 12 hafter treatment with 50 �g TA (P < 0.05). These data suggest thathmgR transcription is not sensitive to the sexual pheromone TA.

These data further support the findings of Almeida and Cerdá-Olmedo that hmgR expression is not affected by sexual interactionin Phycomyces [29]. HMG-CoA reductase is regulated by feedbackinhibition and post-translational phosphorylation modification in

emist

aHr

apapgretTitswotdtiadto

4

paptbeswacb

A

ta

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

J. Sun et al. / Process Bioch

nimals and yeast [30]. Whether post-translational regulation ofMG-CoA reductase is involved in the effects of TA treatment

emains unclear.FPP synthase, encoded by isoA, catalyzes the conversion of IPP

nd DMADP to various terpenoids [31]. The gene coq2 encodesara-hydroxybenzoate polyprenyltransferase, the enzyme that cat-lyzes the prenylation of para-hydroxybenzoate with an all-transolyprenyl group [32], to produce ubiquinone downstream. Theene erg9 encodes squalene synthase, which balances the incorpo-ation of FPP into sterol and nonsterol isoprene synthesis [33] toventually produce ergosterol. Para-hydroxybenzoate polyprenyl-ransferase and squalene synthase are both branch-point enzymes.ranscription of isoA, coq2, and erg9 significantly increased onlyn the group that was treated with 70 �g TA (P < 0.01); the addi-ion of more or less TA did not alter transcription. A previoustudy reported that protein and mRNA expression levels in yeastere not correlated [34]. Therefore, that whether protein levels

f para-hydroxybenzoate polyprenyltransferase and squalene syn-hase increase after addition of 70 �g TA remains unknown. Inownstream pathways following the reactions catalyzed by thesewo enzymes, there are a series of additional enzymes involvedn ubiquinone and ergosterol synthesis [35,36], and whether TActs on those biosynthetic genes requires further investigation. Ourata, however, suggest that the promotion of ubiquinone produc-ion after treatment with 50 �g TA is not related to the regulationf coq2 at the transcriptional level.

. Conclusions

The aim of this study was to examine the effects of TA on ter-enoids in the fungus B. trispora. The production of �-carotenend ubiquinone significantly increases after TA addition, while theroduction of ergosterol is steady in the early stages following TAreatment, but subsequently decreases. Four genes in the terpenoidiosynthetic pathway (ipi, carG, carRA, and carB) have increasedxpression (between 9- and 33-fold) after TA treatment. The tran-cription of hmgR is not sensitive to the sexual pheromone TA,hereas the transcription of isoA, coq2, and erg9 depends on the

mount of TA added. TA appears to increase the production of �-arotene and ubiquinone through transcriptional induction of theiriosynthetic genes.

cknowledgment

The authors would like to acknowledge the financial support ofhe National Natural Science Foundation of China (Nos. 20976009nd 21176018).

eferences

[1] Palozza P, Krinsky NI. Antioxidant effects of carotenoids in vivo and in vitro: anoverview. Methods Enzymol 1992;213:403–20.

[2] Coenzyme Sarter B. Q10 and cardiovascular disease: a review. J Cardiovasc Nurs2002;16:9–20.

[3] Bard M, Lees ND, Turi T, Craft D, Cofrin L, Barbuch R, et al. Sterol synthesisand viability of erg11 (cytochrome P450 lanosterol demethylase) mutations inSaccharomyces cerevisiae and Candida albicans. Lipids 1993;28:963–7.

[4] Bejarano ER, Cerdá-Olmedo E. Independence of the carotene and sterol path-ways of Phycomyces. FEBS Lett 1992;306:209–12.

[5] Disch A, Rohmer M. On the absence of the glyceraldehyde 3-phosphate/pyruvate pathway for isoprenoid biosynthesis in fungi andyeasts. FEMS Microbiol Lett 1998;168:201–8.

[6] Mehta BJ, Obraztsova IN, Cerdá-Olmedo E. Mutants and intersexual het-erokaryons of Blakeslea trispora for production of beta-carotene and lycopene.Appl Environ Microbiol 2003;69:4043–8.

[7] Sutter RP, Harrison TL, Galasko G. Trisporic acid biosynthesis in Blakesleatrispora via mating type-specific precursors. J Biol Chem 1974;249:2282–4.

[

[

ry 47 (2012) 1889–1893 1893

[8] Sutter RP, Whitaker JP. Zygophore-stimulating precursors (pheromones) oftrisporic acids active in (−)-Phycomyces blakesleeanus. Acid-catalyzed anhydroderivatives of methyl 4-dihydrotrisporate-C and 4-dihydrotrisporate-C. J BiolChem 1981;256:2334–41.

[9] Schachtschabel D, Menzel KD, Krauter G, David A, Roth M, Horn U, et al. Pro-duction and derivate composition of trisporoids in extended fermentation ofBlakeslea trispora. Appl Microbiol Biotechnol 2010;88:241–9.

10] Rao SMV. Carotenogenesis: Possible mechanism of action of trisporic acid inBlakeslea trispora. Cell Mol Life Sci 1977;33:31–3.

11] van den Ende H. Relationship between sexuality and carotene synthesis inBlakeslea trispora. J Bacteriol 1968;96:1298–303.

12] Hesseltine CWAR. Microbiological production of carotenoids. I. Zygosporesand carotene produced by intraspecific and interspecific crosses ofChoanephoraceae in liquid media. Myeologia 1957;49:449.

13] Schimek C, Kleppe K, Saleem AR, Voigt K, Burmester A, Wostemeyer J. Sexualreactions in Mortierellales are mediated by the trisporic acid system. Mycol Res2003;107:736–47.

14] Nieuwenhuis M. Sex specificity of hormone synthesis in Mucor mucedo. ArchMicrobiol 1975;102:167–9.

15] Tang Q, Li Y, Yuan QP. Effects of an ergosterol synthesis inhibitor on genetranscription of terpenoid biosynthesis in Blakeslea trispora. Curr Microbiol2008;57:527–31.

16] Rose TM, Henikoff JG, Henikoff S. CODEHOP (COnsensus-DEgenerate HybridOligonucleotide Primer) PCR primer design. Nucleic Acids Res 2003;31:3763–6.

17] Burmester A, Czempinski K. Sequence comparison of a segment of the genefor 3-hydroxy-3-methylglutaryl-coenzyme A reductase in zygomycetes. Eur JBiochem 1994;220:403–8.

18] Kuzina V, Ramirez-Medina H, Visser H, van Ooyen AJ, Cerdá-Olmedo E, van denBerg JA. Genes involved in carotene synthesis and mating in Blakeslea trispora.Curr Genet 2008;54:143–52.

19] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego,Calif) 2001;25:402–8.

20] Sutter RP, Capage DA, Harrison TL, Keen WA. Trisporic acid biosynthesis inseparate plus and minus cultures of Blakeslea trispora: identification by Mucorassay of two mating-type-specific components. J Bacteriol 1973;114:1074–82.

21] Kuzina V, Domenech C, Cerdá-Olmedo E. Relationships among the biosynthe-ses of ubiquinone, carotene, sterols, and triacylglycerols in Zygomycetes. ArchMicrobiol 2006;186:485–93.

22] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. GappedBLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res 1997;25:3389–402.

23] Anderson MS, Muehlbacher M, Street IP, Proffitt J, Poulter CD. Isopentenyldiphosphate: dimethylallyl diphosphate isomerase. An improved purificationof the enzyme and isolation of the gene from Saccharomyces cerevisiae. J BiolChem 1989;264:19169–75.

24] Rodriguez-Saiz M, Paz B, De La Fuente JL, Lopez-Nieto MJ, Cabri W, BarredoJL. Blakeslea trispora genes for carotene biosynthesis. Appl Environ Microbiol2004;70:5589–94.

25] Schmidt AD, Heinekamp T, Matuschek M, Liebmann B, Bollschweiler C,Brakhage AA. Analysis of mating-dependent transcription of Blakeslea trisporacarotenoid biosynthesis genes carB and carRA by quantitative real-time PCR.Appl Microbiol Biotechnol 2005;67:549–55.

26] Kjaerulff S, Dooijes D, Clevers H, Nielsen O. Cell differentiation by interactionof two HMG-box proteins: Mat1-Mc activates M cell-specific genes in S. pombeby recruiting the ubiquitous transcription factor Ste11 to weak binding sites.EMBO J 1997;16:4021–33.

27] Grishin AV, Rothenberg M, Downs MA, Blumer KJ. Mot3, a Zn finger transcrip-tion factor that modulates gene expression and attenuates mating pheromonesignaling in Saccharomyces cerevisiae. Genetics 1998;149:879–92.

28] Ruiz-Albert J, Cerdá-Olmedo E, Corrochano LM. Genes for mevalonate biosyn-thesis in Phycomyces. Mol Genet Genomics 2002;266:768–77.

29] Almeida ER, Cerdá-Olmedo E. Gene expression in the regulation of carotenebiosynthesis in Phycomyces. Curr Genet 2008;53:129–37.

30] Hampton R, Dimster-Denk D, Rine J. The biology of HMG-CoA reductase: thepros of contra-regulation. Trends Biochem Sci 1996;21:140–5.

31] Homann V, Mende K, Arntz C, Ilardi V, Macino G, Morelli G, et al. The iso-prenoid pathway: cloning and characterization of fungal FPPS genes. Curr Genet1996;30:232–9.

32] Ashby MN, Kutsunai SY, Ackerman S, Tzagoloff A, Edwards PA.COQ2 is a candidate for the structural gene encoding para-hydroxybenzoate:polyprenyltransferase. J Biol Chem 1992;267:4128–36.

33] Fegueur M, Richard L, Charles AD, Karst F. Isolation and primary structure ofthe ERG9 gene of Saccharomyces cerevisiae encoding squalene synthetase. CurrGenet 1991;20:365–72.

34] Gygi SP, Rochon Y, Franza BR, Aebersold R. Correlation between protein andmRNA abundance in yeast. Mol Cell Biol 1999;19:1720–30.

35] Meganathan R. Ubiquinone biosynthesis in microorganisms. FEMS MicrobiolLett 2001;203:131–9.

36] Alcazar-Fuoli L, Mellado E, Garcia-Effron G, Lopez JF, Grimalt JO, Cuenca-EstrellaJM, et al. Ergosterol biosynthesis pathway in Aspergillus fumigatus. Steroids2008;73:339–47.