Interferon Regulatory Factor 7 Contributes to the Control ... · cedures and Ethics Committee and performed under United Kingdom Home Ofﬁce license. Confocal microscopy. Confocal

INFECTION AND IMMUNITY, Mar. 2011, p. 1057–1066 Vol. 79, No. 30019-9567/11/$12.00 doi:10.1128/IAI.00633-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Interferon Regulatory Factor 7 Contributes to the Control ofLeishmania donovani in the Mouse Liver�†

Lynette Beattie, Rebecca Phillips, Najmeeyah Brown, Benjamin M. J. Owens,Neal Chauhan, Jane E. Dalton, and Paul M. Kaye*

Centre for Immunology and Infection, Hull York Medical School and Department of Biology, University ofYork, Wentworth Way, York YO10 5YW, United Kingdom

Received 11 June 2010/Returned for modification 28 July 2010/Accepted 2 December 2010

Optimal hepatic resistance to Leishmania donovani in mice requires the coordinated effort of a variety ofleukocyte populations that together induce activation of local macrophages to a leishmanicidal state. Althoughnitric oxide and reactive oxygen intermediates are potent leishmanicidal effector molecules operating in theacquired phase of immunity, there have long been suggestions that other mechanisms of leishmanicidal activityexist. We recently discovered that Irf-7 regulates a novel innate leishmanicidal response in resident splenicmacrophages that line the marginal zone. Here, we tested whether this mechanism also operates in Kupffercells, the resident macrophage population of the liver and the major target for hepatic infection by L. donovani.Comparing the Kupffer cell responses in situ in B6 and B6.Irf-7�/� mice, we found no evidence that Irf-7affected amastigote uptake or early survival. However, we did find that Irf-7-deficient mice had impairedacquired resistance to hepatic L. donovani infection. This phenotype was attributable to a reduction in thecapacity of hepatic CD4� T cells, NK cells, and NKT cells to produce gamma interferon (IFN-�) and also todefective induction of NOS2 in infected Kupffer cells. Our data therefore add interferon regulatory factor 7(IRF-7) to the growing list of interferon regulatory factors that have effects on downstream events in theacquired cellular immune response to nonviral pathogens.

The leishmaniases remain a global health problem, and anunderstanding of the mechanisms that underpin host resis-tance and susceptibility to these parasites is likely to have animportant bearing on the development of new drugs and vac-cines for human use. Leishmania parasites reside within thephagosomal compartment of their host cell, and this cellularlocation dictates the options available for parasite elimination.A variety of mechanisms have been shown to operate to con-tain and/or kill intracellular amastigotes within phagosomes.Early genetic studies with mice identified a natural resistancegene (Scl11a1) operating in macrophages to limit the growthrate of L. donovani and L. chagasi (6, 7, 19, 40). In contrast tothe leishmanistatic effects of Slc11a1, the activation of therespiratory burst can be leishmanicidal (25), and mice defec-tive in gp91(phox) have increased early susceptibility to hepaticinfection with L. donovani (26), in spite of the fact that Kupffercells (KCs) have a limited capacity for secretion of reactiveoxygen intermediates (ROIs) (20). Further studies demon-strated the more dominant effect of NOS2-regulated nitricoxide production for the resolution of L. donovani infection inmice (26). Although there is an overwhelming body of datasupporting the role of NO and ROIs as mediators of leish-manicidal activity, other pathways may remain to be uncov-ered. For example, in doubly phox/NOS2-deficient mice, an

alternative mechanism of control serves to limit relapse fol-lowing chemotherapy (27). For some intracellular pathogens,including L. major, a significant role for small GTPases hasbeen identified (38).

We recently demonstrated that Irf-7 had a profound effecton the leishmanicidal activities of splenic marginal zone mac-rophages (MZM) and marginal metallophilic macrophages(MMM) in situ and of a stromal macrophage cell line (14M1.4)in vitro (12, 30). Unlike many other populations of macro-phages studied in vitro and in vivo, these macrophages ex-pressed an innate gamma interferon (IFN-�)-independentlevel of leishmanicidal activity that was capable of reducing theintracellular parasite burden by �60% within 24 h of infection(30). An examination of genes differentially expressed between14M1.4 macrophages and a Leishmania-permissive macro-phage population (RAW264.7) identified a strong type I inter-feron-associated transcriptional signature that accompaniedinfection of 14M1.4 macrophages, including upregulation ofIrf-7. Gene knockdown experiments using RNA interference(RNAi) and infection of Irf-7 �/� mice confirmed a functionalrole for this transcription factor in the early host response to L.donovani, that could not be bypassed by exogenous IFN-� andthat was independent of NOS2 (30). The long-term conse-quences of Irf-7 deficiency were not established at that time,however.

Although interferon regulatory factor 7 (IRF-7) has notbeen studied in the context of acquired immunity to any Leish-mania species to date, a number of other IRFs have beenstudied from this perspective. Irf-1 is involved in the downregu-lation of interleukin-12 (IL-12) in dendritic cells (DC) ob-served following infection with L. amazonensis (41). L. majorinduces IRF1 and IRF8 in human DC, and their protein prod-

* Corresponding author. Mailing address: Centre for Immunologyand Infection, Hull York Medical School and Department of Biology,University of York, Wentworth Way, York YO10 5YW, United King-dom. Phone: 44 1904 32 8840. Fax: 44 1904 328844. E-mail: [email protected].

† Supplemental material for this article may be found at http://iai.asm.org/.

� Published ahead of print on 13 December 2010.

1057

on Novem

ber 19, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

ucts bound to the IL-12p35 promoter (15). L. donovani pro-mastigotes stimulate IRF-1 expression in an lipophosphogly-can (LPG)-dependent manner in murine J774.1 cells (2).However, in a family study in a region of Brazil where visceralleishmaniasis (VL) is endemic, no genetic association wasfound between delayed-type hypersensitivity (DTH) positivity,a marker of resistance to L. chagasi, and single-nucleotidepolymorphisms (SNPs) in Irf-1 (16). Irf-4 has been shown toplay a T cell-intrinsic role in Th2 development in L. major (39).Intriguingly, Irf-8 has been shown to be a regulator of Slc11a1,acting to coordinate gene expression through a mechanisminvolving c-myc and Miz-1 (1). Irf-8 also plays a role in Th1determination by acting as a regulator of IL-12 production, andIrf-8�/� mice were highly susceptible to L. major infection (11).

In this report, we show that B6.Irf-7�/� mice have a reducedcapacity to mount an effective hepatic response to L. donovaniinfection. In contrast to splenic macrophages, Kupffer cells(KCs) did not express innate Irf-7-dependent leishmanicidalactivity toward amastigotes. Nevertheless, the peak parasiteburden in B6.Irf-7�/� mice was increased by �4-fold comparedto that in wild-type B6 mice. The reduced hepatic resistance ofB6.Irf-7�/� mice was shown to be associated with reducedIFN-� production within the hepatic CD4� T cell, NK cell, andNKT cell compartments and with a commensurate rise in thefrequency of CD4� T cells making IL-10. This altered cytokineenvironment in the liver was reflected by severely compro-mised NO production by infected KCs at the core of the he-patic granuloma. Our data add IRF-7 to the list of interferonregulatory factors that influence host resistance to Leishmaniaspecies.

MATERIALS AND METHODS

Animals and parasites. C57BL/6 mice (Charles River Laboratories, Margate,United Kingdom) were used at 6 to 10 weeks of age and housed under specific-pathogen-free conditions. B6.Irf-7�/� mice (backcrossed to B6 for �8 genera-tions [14]) were obtained from the RIKEN Bioresource Center (Ibaraki, Japan)with kind permission of T. Taniguchi, University of Tokyo, Japan. L. donovani(LV9) and tdTomato-expressing L. donovani (4) were maintained by passage inRAG-2�/� mice. Mice were infected by injecting 3 � 107 amastigotes intrave-nously (i.v.) via the lateral tail vein. Mice were killed by cervical dislocation.Parasite burdens were determined from Giemsa-stained impression smears andexpressed as Leishman-Donovan units (LDU) (number of parasites per 1,000host cell nuclei � organ weight). Granuloma maturation was assessed fromhematoxylin-eosin (H&E)-stained tissue sections as described elsewhere (34).All animal experiments were approved by the University of York Animal Pro-cedures and Ethics Committee and performed under United Kingdom HomeOffice license.

Confocal microscopy. Confocal microscopy was performed on 8- to 20-�mfrozen sections. For tissue containing tdTomato-expressing parasites, tissue wasfixed in 4% paraformaldehyde (PFA) for 2 h before incubation in 30% sucroseovernight and embedding in optimal-cutting-temperature (OCT) medium(Sakura). Sections were stained with Alexa 488-conjugated F4/80 (eBioscience,United Kingdom). Parasite burdens were evaluated with three-dimensional (3D)reconstructed images generated from z-stacked 0.8- to 1-�m optical slices. 3Drendering of serial sections was generated using Volocity software (Improvision)(4). For all other sections, tissue was snap-frozen in OCT and sections fixed inice-cold acetone. F4/80, CD11c, and CD11b antibodies were conjugated to Alexa488 or Alexa 647 (eBioscience) and purified rabbit anti-mouse inducible nitricoxide synthase (iNOS) (Abcam, United Kingdom) detected with donkey anti-rabbit Alexa 647. Sections were counterstained with 4,6-diamidino-2-phenylin-dole (DAPI), mounted in Pro-Long Gold antifade (Invitrogen), and visualizedusing a Carl Zeiss inverted LSM META 510 confocal microscope. Quantificationof NOS2 staining was performed on randomly selected fields for each mouse(�10 mice for each time point). The degree of staining was detected using AdobePhotoshop CS3, and the fractions of positively stained pixels relative to the

number of pixels for field of view and within granulomas (depicted by F4/80)were counted and expressed as percentage of area positive per field of view orper granuloma.

Flow cytometry and cell sorting. Hepatic nonparenchymal cells (includingmyeloid and lymphoid cells) were prepared from the livers of naïve or infectedwild-type and Irf-7�/� mice without collagenase digestion as previously described(4). Isolated cells were labeled with fluorochrome-conjugated antibodies toNK1.1 (eBioscience, United Kingdom), CD3 (BioLegend), and CD19, B220,CD4, CD8, DX5, CD11c, GR-1, F4/80, and CD11b (eBioscience, United King-dom). Intracellular cytokine staining was performed on phorbol myristate ace-tate (PMA)-ionomycin-restimulated liver cell suspensions incubated with brefel-din A at 37°C for 4 h. Cells were surface stained with phycoerythrin (PE)-Cy7-conjugated anti-CD3, peridinin chlorophyll protein (PerCP)-conjugated anti-CD4, allophycocyanin (APC)-Cy7-conjugated anti-CD8, Alexa Fluor 647-conjugated F4/80, PE-conjugated anti-CD11b (BD Pharmingen), CD11c-PE-Cy7, and NK1.1-PE (e-Bioscience). LIVE/DEAD fixable aqua dead-cell stain(Invitrogen) was added in some experiments, and cells were then fixed with 2%paraformaldehyde, permeabilized with 0.5% saponin, and stained with Pacificblue-conjugated anti-IFN-�, PE-conjugated anti-tumor necrosis factor alpha(anti-TNF-�), and APC-conjugated anti-IL-10 (eBioscience). B cell frequencywas assessed by staining spleen cell suspensions with PerCP-conjugated anti-CD45R (BD Pharmingen). Cells were analyzed using a CyAn flow cytometer andSummit software (Beckman Coulter).

Real-time RT-PCR. RNA was isolated from livers by using an RNeasy kitaccording to the manufacturer’s instructions (Qiagen). RNA was then reversetranscribed into cDNA using the first-strand cDNA synthesis kit according to themanufacturer’s instructions (Invitrogen). Oligonucleotides (5 to 3) used for thespecific amplification were for IL-10 and hypoxanthine phosphoribosyltrans-ferase (HPRT) (1a), IFN-� (forward, CCTCCTGCGGCCTAGCTC; reverse,GTAACAGCCAGAAACAGCCATG), and NOS2 (forward, CCCTTCCGAAGTTTCTGGCAGCAGCAGC; reverse, GGCTGTCAGAGCCTCGTGGCTTTGG). Real-time quantitative reverse transcription-PCR (RT-PCR) was per-formed with the SYBR green PCR kit in an ABI Prism 7000 sequence detectionsystem (Applied Biosystems) according to the manufacturer’s instructions. Ex-pression of target genes was normalized to HPRT and expressed as relativeexpression using the change in cycle threshold (CT) analysis method (relativeexpression of the gene in the naïve compared to the infected counterpart).

Statistical analysis. Data were analyzed using one-way Kruskal-Wallis analysisof variance (ANOVA) or Student’s t test as appropriate. All experiments wereperformed independently at least twice.

RESULTS

Characterization of the immune status of B6.Irf-7�/� mice.Mice defective in other interferon regulatory factor genes,including Irf-8 and Irf-4, have been shown to have a range ofimmune dysfunctions in the steady state, but a formal study ofIrf-7-defective mice has not previously been published. Wetherefore first evaluated a number of cellular parameters in B6and B6.Irf-7�/� mice, focusing particularly on cells and tissuesassociated with the host response during experimental VL(EVL). Comparing the livers of uninfected B6 and B6.Irf-7�/�

mice, we found no differences in the number, frequency, ordistribution of KCs (Fig. 1A to E), intrahepatic B cells (Fig.2A), CD4� or CD8� T cells (Fig. 2B and C), or NKT cells (Fig.2D). In contrast, we noted an increase in the number of NKcells (Fig. 2E) and small but significant increases in the num-bers of CD11c� F4/80� resident DC (Fig. 2F) and B220�

CD19� cells (presumptive �� T cells) (Fig. 2G), which wassomewhat offset by a reduction in Gr-1� CD11b� cells (pre-sumptive granulocytes) (Fig. 2H). Similarly, in spleen no sig-nificant changes were observed in lymphoid tissue architecture(assessed by SIGNR1, CD169, ERTR-7, MAdCAM-1, CD19,and CD3) (reference 30 and data not shown). The numbersand distributions of the three CD11chi MHCIIhi splenic con-ventional DC (cDC) subsets were equivalent in steady-state B6and B6.Irf-7�/� mice (B. M. J. Owens et al., unpublished data).

1058 BEATTIE ET AL. INFECT. IMMUN.

on Novem


.org/D

ownloaded from

http://iai.asm.org/

Hence, Irf-7-deficient mice have a substantially intact immunesystem at steady state, compared to mice with other interferonregulatory factor deficiencies (37).

Kupffer cells do not express IRF-7-dependent innate leish-manicidal activity. In macrophages of the splenic marginalzone, IRF-7 regulates the extent to which intracellular amas-tigotes survive over the first 24 h postinfection (p.i.) (30). Todetermine whether the survival of L. donovani amastigoteswithin Kupffer cells (KCs), the principal host cell for this par-asite in the liver (4), was also affected by IRF-7 deficiency, weinfected wild-type B6 and B6.Irf-7�/� mice with transgenictdTomato-expressing L. donovani. At 5 h, 24 h, and 48 h p.i.,the parasite burden in individual KCs in F4/80-stained tissuesections was evaluated, using 3D reconstructed z-stacked im-ages to obtain a full-thickness view of each individual KC. Asshown in Fig. 3A to C and Movie S1 in the supplemental

material, KCs infected with L. donovani were readily detectedby this approach. Unlike in spleens of B6 mice, where macro-phages of the marginal zone reduce their parasite load by �50to 60% over the first 24 h p.i. (30), the parasite burden in KCsof B6 mice did not decrease significantly over this time period,as determined either by the percentage of infected KCs (Fig.3D) or by the number of parasites present within each KC (Fig.3E). These data indicate that KCs lack the innate leishmani-cidal activity of resident splenic macrophages, a finding con-sistent with earlier data from tritium-labeling studies that dem-onstrated the permissiveness of KCs for amastigote growthover the first 48 h of infection (8). Furthermore, we found noevidence to suggest that Irf-7-deficiency affected either amas-tigote uptake or subsequent survival within KCs during the first24 h p.i. By 48 h p.i. there was, however, a small but significantincrease in parasite burden in KCs of B6.Irf-7�/� mice (Fig. 3Cand E). Hence, at the level of innate macrophage function,Irf-7 acts in a tissue-specific manner.

Irf-7-deficient mice have diminished early control over he-patic L. donovani infection. Having established that amastigoteuptake and survival over the first 24 h of hepatic infection weresimilar in B6 and B6.Irf-7�/� mice, it was then possible tocompare the long-term outcome of hepatic infection withoutthe confounding issue of altered initial parasite burden. There-fore, we followed the course of hepatic infection over a 56-dayperiod. As anticipated from previous studies, the hepatic par-asite burden in B6 mice increased to day 14 p.i. and wassubsequently brought under control by day 56 p.i., and in thisseries of experiments, B6 mice had already begun to showexpression of immunity by day 28 p.i. (Fig. 4). In B6.Irf-7�/�

mice the parasite burden was significantly higher at both day 14(3-fold) (614 � 433 LDU in B6 mice and 1,839 � 384 LDU inB6.Irf-7�/� mice) and day 28 (4.1-fold) (545 � 194 LDU in B6mice and 2,240 � 1,787 LDU in B6.Irf-7�/� mice). Neverthe-less, B6.Irf-7�/� mice ultimately also cleared their hepatic par-asite burden (Fig. 4). Of interest, the parasite burden was notsignificantly different in the spleens of these infected mice atany time point measured, in spite of the initial differences inparasite burden in the marginal zone (data not shown), againarguing for differences in the regulation of host resistance atthis site (9). Thus, B6.Irf-7�/� mice have a selective defect intheir expression of hepatic resistance that operates after initialamastigote-KC interactions.

The hepatic granulomatous response is intact in Irf-7-defi-cient mice. Hepatic infection with L. donovani leads to a char-acteristic granulomatous response, and this can be quantifiedeither as the number of granulomas per unit area of liver tissueor by determining the maturation level of individual granulo-mas (34). A comparison of these parameters showed no sig-nificant differences between the granulomatous responses inB6 and B6.Irf-7�/� mice (Fig. 4B to E) in spite of the signifi-cant difference in parasite burden (Fig. 4A). Hence, the in-creased parasite burden in B6.Irf-7�/� mice was not a conse-quence of a failure to mount or a lack of maturation of thegranulomatous tissue response.

IRF-7 deficiency alters the balance of IFN-� and IL-10 pro-duction in the livers of L. donovani-infected mice. To under-stand the mechanism behind the increased parasite loadobserved within hepatic granulomas, we assessed their func-tionality using quantitative RT-PCR to analyze a broad range

FIG. 1. Frequency and distribution of KCs in B6.Irf-7�/� mice. (Aand B) Eight-micrometer-thick liver sections from B6 (A) and B6.Irf-7�/� (B) mice were stained with anti-F4/80 (green), and nuclei werecounterstained with DAPI (blue) Scale bar, 42 �m. (C and D) Rep-resentative fluorescence-activated cell sorter (FACS) plots of F4/80�

CD11b� cells in livers of B6 (C) and B6.Irf-7�/� (D) mice. (E) Fre-quency of F4/80� CD11b� cells in livers of B6 (wild type [WT]) andB6.Irf-7�/� mice (n 3 mice per group from one of two independentexperiments; error bars indicate standard deviations [SD]).

VOL. 79, 2011 IRF-7 REGULATES IMMUNITY TO LEISHMANIA DONOVANI 1059

on Novem


.org/D

ownloaded from

http://iai.asm.org/

of pro- and anti-inflammatory cytokines. At the level of mRNAaccumulation, we did not observe a significant difference in theIFN-� responses of B6 mice and B6.Irf-7�/� mice, whereasIL-10 mRNA accumulation was significantly elevated at earlytimes in B6.Irf-7�/� mice compared to B6 mice (Fig. 5A andB). To more precisely evaluate cytokine production and iden-tify the cellular source of IL-10 and IFN-�, we used intracel-lular flow cytometry to analyze IFN-� and IL-10 production atthe protein level. At day 28 p.i., B6 mice had an increasedfrequency of IFN-�-producing CD4� T cells compared toB6.Irf-7�/� mice (Fig. 5C), whereas the reciprocal was ob-served for IL-10-producing CD4� T cells (Fig. 5D). The fre-quency of IFN-�� IL-10� CD4� T cells was minimal in thisseries of experiments, though there was a trend toward anincrease in the frequency of these cells in infected compared tonaïve B6 mice but not in B6.Irf-7�/� mice (Fig. 5E). IFN-�responses were also raised in infected B6 mice compared toB6.Irf-7�/� mice within both the hepatic NK cell (Fig. 5F)

and NKT cell (Fig. 5G) populations. IFN-� production byCD8� T cells was increased in B6 mice (4.13% � 2.3%versus 11.15% � 2.8% in naïve versus infected mice),whereas the percentage of IFN-�� CD8� T cells was re-duced after infection of B6.Irf-7�/� mice, albeit from ahigher resting state (9.98% � 2.7% versus 5.58% � 1.5% innaïve and infected mice, respectively). In contrast to thesedivergent results in the liver, the splenic T cell responses inthe two strains were similar. Thus, the percentage of CD4�

T cells producing IFN-� increased from 4.38% � 0.4% to13.7% � 0.2% in naïve versus day 35 infected B6 mice andfrom 4.17% � 0.05% to 13.98% � 0.85% in naïve versus day35 infected B6.Irf-7�/� mice. Similarly, the percentages ofCD8� T cells producing IFN-� in naïve and infected B6 andB6.Irf-7�/� mice were 16.13% � 2.26% and 17.56% � 0.2%versus 17.83% � 0.5% and 18.92% � 0.3%, respectively.Therefore, B6.Irf-7�/� mice had a restricted capacity tomake IFN-� in the liver microenvironment, which was re-

FIG. 2. Hepatic nonparenchymal cell populations in B6 versus B6.Irf-7�/� mice. Flow cytometric analysis of B cells (CD19� B220�) (A), CD4T cells (B), CD8 T cells (C), NKT cells (D), NK cells (E), dendritic cells (F), B220� CD19� cells (G), and granulocytes (H) in livers from B6 (WT)and B6.Irf-7�/� mice is shown. Data are from two independent experiments with three to five mice per group per experiment. Data are expressedas mean absolute cell numbers � SD. *, P � 0.05; **, P � 0.01.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

flected by a reciprocal increase in hepatic T cell-derivedIL-10.

Granulomas in B6.Irf-7�/� mice are deficient in NOS2.NOS2 is known to be a major mediator of leishmanicidalactivity in hepatic granulomas (26). As NOS2 is regulateddifferentially regulated by IFN-� and IL-10, we examined thelivers of B6 and B6.Irf-7�/� mice for NOS2 expression. In B6mice, the accumulation of NOS2 mRNA in total liver in-creased �10-fold over that observed at day 14 p.i. (Fig. 6A),commensurate with the reduction in parasite burden seen atthis time (Fig. 4A). By day 56 p.i. NOS2 mRNA accumulationin B6 mice had begun to decrease. In contrast, in B6.Irf-7�/�

mice, though NOS2 mRNA accumulation was also increased atday 28 compared to day 14 p.i., this response was muted com-pared to that in B6 mice (�3-fold). Furthermore, the levels ofNOS2 mRNA accumulation remained high at day 56 p.i. (Fig.6A). To more specifically address the question of NOS2 levelsspecifically within granulomas, we used immunohistochemis-try. NOS2 was readily detected in the granulomas of day 28infected B6 mice but was far less abundant in granulomas ofB6.Irf-7�/� mice (Fig. 6B and C). To quantify these results, weused computer-assisted morphometric analysis to determinethe extent of NOS2 staining both in random areas of hepatictissue (Fig. 6D) and also circumscribed within the cross-sec-tional area of individual granulomas (Fig. 6E). By both of these

measures, the level of NOS2 staining was significantly reducedin B6.Irf-7�/� mice compared to B6 mice. Therefore, theskewed hepatic cytokine response and reduced host resistanceof B6.Irf-7�/� mice compared to B6 mice correlates with de-fective local NOS2 production.

DISCUSSION

In the splenic marginal zone, MZM and MMM rapidlyphagocytose blood-borne L. donovani amastigotes after intra-venous inoculation and over the following 24 h exert innateleishmanicidal activity that reduces the parasite burden at thissite by �60% (12, 30). We recently showed, using a combina-tion of gene expression profiling, RNAi, and gene-targetedmice, that Irf-7 played a key role in regulating this early leish-manicidal activity, operating in a manner that could not bebypassed by exogenous type I IFNs and was independent ofNO (30). However, in the current study, we have not found anyevidence that a similar mechanism operated in KCs, whichsimilarly acquire amastigotes rapidly from the circulation. Nei-ther the level of entry nor the subsequent survival of amasti-gotes over 48 h was affected in a major way by Irf-7 deficiency.By using full-thickness z-stack reconstructions of individualKCs, we were able to determine the level of infection withineach KC to a degree of accuracy not previously possible in situ.

FIG. 3. Kupffer cells from B6 and B6.Irf-7�/� mice lack innate leishmanicidal activity. (A and B) Liver sections (10 to 20 �m) fromtdTomato-expressing L. donovani-infected B6 and B6.Irf-7�/� mice were stained with F4/80 to identify infected KCs. Representative sectionswithout (A) and with (B) F4/80 staining (green) show localization of tdTomato-expressing amastigotes (red). Scale bars, 42 �m. (C) KCs (green)infected with tdTomato-expressing amastigotes (red). Scale bar, 6 �m. Nuclei were counterstained with DAPI (blue). A z-stack projection is shownin Movie S1 in the supplemental material. (D) Numbers of infected KCs in livers of B6 mice (white bars) and B6.Irf-7�/� mice (gray bars) at 24 hand 48 h following infection. Data are shown as percent infected KCs relative to percent infected at 5 h p.i. (E) Numbers of amastigotes per KCin B6 mice (white bars) and B6.Irf-7�/� mice (gray bars) at the indicated times p.i. Data are expressed as means � SD from two independentexperiments where n 3 to 5 mice at each time point per experiment *, P � 0.05; **, P � 0.01, ns, not significant.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

This analysis showed that whereas the percentage of infectedKCs decreased significantly from 24 h to 48 h p.i., there was noaccompanying change in the number of amastigotes per in-fected KC between these two time points. There are two non-exclusive explanations for this finding. First, KCs may repre-sent a heterogeneous population, with differing capacities for

leishmanicidal activity. In support of this possibility, recentstudies have identified two populations of KCs that differ intheir dependence on bone marrow for their renewal and intheir capacity for migration following an inflammatory insult(18). To date, potential differences in antimicrobicidal activitybetween these two populations have not been explored. Sec-

FIG. 4. Early acquired resistance to hepatic L. donovani infection is impaired in B6.Irf-7�/� mice. (A) Liver parasite burdens measured duringthe course of infection with L. donovani in B6 and B6.Irf-7�/� mice. Data represent the means � SD from three independent experiments wheren 8 to 12 mice per time point. The parasite load was significantly different at days 14 and 28. (B) Number of hepatic granulomas per 50 fieldsof view (F.O.V.) in B6 mice (white bars) and B6.Irf-7�/� (gray bars) mice at indicated times p.i. (C) Granuloma maturation in B6 mice andB6.Irf-7�/� mice, scored as no reaction, minimal/immature reaction, mature reaction, or resolving reaction. Data are expressed as meanfrequency � SD of each maturation stage and are derived from 10 mice per time point from three independent experiments. (D and E)Representative hematoxylin- and eosin-stained liver sections showing the histopathology observed in the livers of B6 (D) and B6.Irf-7�/� (E) mice.The original magnification was �40 (day 14) or �100 (days 28 and d56). Arrows indicate amastigote-infected cells. **, P � 0.01; ***, P � 0.0001.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

ond, KC activation for antileishmanial activity may be depen-dent upon extrinsic signals provided in trans by a cell(s) whoseactivity or number is rate limiting. In this regard, we havepreviously shown that NK cells, invariant NKT (iNKT) cells,and noninvariant NKT cells are all stimulated during L. dono-vani infection to produce IFN-� but that only iNKT cell-pro-duced IFN-� is sufficient to induce KC expression of CXCL10(35). These two options may not be mutually exclusive. Forexample, in order to stimulate maximal IFN-� from NKT cells,KCs express SIRP�, yet only �80% of infected KCs had de-monstrably upregulated SIRP� by 24 h p.i. (5). Further studieson KC heterogeneity are clearly warranted, but in any event, itis clear from our data that this late stage of KC activation (24h to 48 h) as well as the early innate response of KCs (5 h to24 h) are independent of functional IRF-7.

IRF-7 is most closely associated with the amplification of thetype I IFN response (37). In plasmacytoid DC, IRF-7 is con-stitutively expressed at high levels and underlies the capacity ofthese cells to make a robust type I IFN (13, 14). In most othercells, including most macrophage populations studied to date,basal IRF-7 expression is low and the levels of Irf-7 mRNAaccumulation and IRF-7 protein expression are tightly regu-lated by the immediate IFN-� response to viral infection orToll-like receptor (TLR) ligation (37). However, low-level ex-pression of IRF-7 is not a feature of all macrophages. WhileRAW264.7 macrophages had minimal IRF-7 and failed toinduce an IRF-7 response following L. donovani infection,expression of IRF-7 was significantly greater at rest in thestromal macrophage cell line 14M1.4, and the response to L.donovani infection in this cell line, measured by the global gene

FIG. 5. Irf-7 deficiency alters hepatic cytokine responses. (A and B) Hepatic IFN-� (A) and IL-10 (B) mRNA levels in B6 mice (WT) andB6.Irf-7�/� mice at the indicated times p.i. with L. donovani. Data are presented relative to mRNA accumulation in naïve controls. (C to E) At28 days p.i., hepatic CD3� CD4� cells from B6 mice (WT) and B6.Irf-7�/� mice were restimulated with PMA-ionomycin and then analyzed forexpression of intracellular IFN-� (C), IL-10 (D), and both IFN-� and IL-10 (E). (F to H) Other cellular sources of IFN-� were identified, includingCD11c� F4/80� cells (F), NK cells (G), and NKT cells (H). Data are presented as means � SD. *, P � 0.05; **, P � 0.01; ***, P � 0.0001.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

expression profile, shows the characteristic hallmarks of a typeI IFN-IRF-7-mediated response (30). Similarly, MZM andMMM in situ rapidly upregulated their expression of IRF-7 toa level detected by immunohistochemistry within 5 h of infec-tion. In contrast, we have not to date been able to identifyIRF-7 in KCs (L. Beattie, unpublished data). Though this mayreflect a sensitivity issue, it is nevertheless in keeping with thelack of early IRF-7-dependent leishmanicidal activity reportedhere and suggests that KCs may have lower basal levels ofIRF-7 than some resident splenic macrophages. Together,these findings serve to further highlight the distinct properties

and functional potential of different tissue macrophage popu-lations.

The link between Irf-7 and other IRF genes that are inti-mately involved in myeloid cell differentiation (37) made itimportant to more fully characterize the phenotype of B6.Irf-7�/� mice. We found no obvious differences in KCs (this pa-per) or in the subsets of conventional DC (Owens, unpublisheddata) in these mice, indicating that while some of the down-stream effects of Irf-7 deficiency may be indirectly attributableto Irf-7-dependent regulation of other IRF genes (see below),these mice did not display the gross defects in myeloid celldifferentiation observed in mice deficient in Irf-1, Irf-2, Irf-4,and Irf-8 (reviewed in reference 37). Establishing that B6 andB6.Irf-7�/� KCs did not differ in their early control of L.donovani also provided a firm platform for further character-ization of the long-term response to infection without the bi-ases potentially introduced by a differing initial parasite load.Our data indicate that the major lesion found in the hepaticimmune response was at the level of NOS2 expression withinthe granuloma. Similarly, IRF-7-deficient mice exhibited nor-mal granuloma assembly and maturation despite having higherparasite burdens, a profile that was also observed in iNOS-deficient mice (26). NOS2 is regulated positively by IFN-� andnegatively by IL-10, and these two cytokines were reciprocallyexpressed in infected B6 and B6.Irf-7�/� mice. Of note, mostof the major hepatic sources of IFN-� were affected by IRF-7deficiency, including CD4� T cells, NK cells, and NKT cells.Given the role of IRF-7 in the regulation of type I IFNs, a linkinvolving this amplification loop and the regulation of IFN-�responses might seem plausible. However, most literature, al-beit from viral systems, argues against a role for type I IFNs inthe regulation of murine NK cell and T cell IFN-� production(28). This contrasts with the clear role of these cytokines inregulating IFN-� production in human cells (31), a reflectionof the species-specific difference in STAT2-dependent activa-tion of STAT4 by type I IFNs (10, 29). Indeed, some reportshave indicated that in the mouse, type I IFN acts as a negativeregulator of IFN-� in CD4� T cells and the balance betweenpositive and negative regulation of IFN-� lies at the level ofSTAT1 (28). Hence, it is unlikely in our model that IRF-7deficiency directly leads to a muted IFN-� response due to alack of available type I IFNs.

Analysis of other potential transcriptional targets for IRF-7,both experimentally in IRF-7-overexpressing cell lines (3) andby bioinformatic approaches (P. M. Kaye, unpublished data),suggests a range of potential targets through which IRF-7deficiency may affect the IFN-� responses independently oftype I IFNs. CD80 and CD86 have been identified as potentialIRF-7 target genes (3) and could regulate Th1 developmentthrough affecting levels of costimulation (21). However, inpreliminary studies, we have not found any differences in ac-tivated cDC derived from L. donovani-infected B6 and B6.Irf-7�/� mice (Owens, unpublished data).

IRF-7 also binds to the Irf-1 promoter (33), a transcriptionfactor playing a major role in cellular resistance to intracellularpathogens that arises from two independent functions. Irf-1 isan intrinsic regulator of myeloid cell IL-12 and IL-18 produc-tion (37), and consequently Irf-1 deficiency leads to loss of bothCD4� Th1 and NK cell IFN-� responses (23, 36). In addition,Irf-1 directly binds to the macrophage NOS2 promoter, inhib-

FIG. 6. IRF-7 deficiency leads to diminished NOS2 in hepatic gran-ulomas. (A) Hepatic NOS2 mRNA levels in B6 mice (WT) and B6.Irf-7�/� mice at the indicated times p.i. with L. donovani. Data are pre-sented relative to mRNA accumulation in naïve mice. (B to E) Ten- to20-�m-thick liver sections from B6 (B) and B6.Irf-7�/� (C) mice at 28days p.i. were stained for F4/80 (green) and NOS2 (red). Scale bar, 42�m. Quantification of NOS2 expression in liver tissue from B6.Irf-7�/�

mice and B6 mice was compared on the bases of field of view (D) andper granuloma (E) using computer-assisted morphometric analysis *,P � 0.05; ***, P � 0.0001. Data are expressed as means � SD.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

iting the macrophage microbicidal response to cytokine-medi-ated activation (17, 24). The striking susceptibility of Irf1�/�

mice to L. major infection has been suggested to result fromthe compound effect of both these aspects of Irf-1 function(22), and this conclusion could similarly be applied to our datawith L. donovani in Irf-7�/� mice. Irf-2 has also been linked tosusceptibility to L. major infection (22) and is induced by L.donovani in stromal macrophages (30), but while Irf-2 affectedTh1 development through impairment of IL-12, its effect wasmodest compared to that of Irf-1 and Irf-2 deficiency did notdirectly affect macrophage NOS2 production (22). Further-more, no direct link between IRF-7 and Irf-2 regulation hasbeen reported.

Further studies of the response to L. donovani in mice willclearly be required to ascertain how Irf-7 and Irf-1 might co-operate to maximize hepatic resistance in this model, thoughwe have already noted that in stromal macrophages infectedwith L. donovani, induction of Irf-7 occurs coordinately withIrf-1 expression (30). A dependence upon IRF-1 and not typeI IFNs would also reconcile our current data with those ofRosas et al., who noted that loss of type I IFN signaling inIFN-��R�/� mice had no impact on hepatic L. donovani in-fection (32). The late onset of hepatic resistance that we ob-serve in Irf-7-deficient mice may also reflect the availability ofother pathways able to activate Irf-1 in these mice, coupled tothe fact that unlike Irf-1 and Irf-2 mice (37), Irf-7 mice do notshow defects in other key cellular players in antileishmanialimmunity.

In summary, therefore, we have shown that B6.Irf-7�/� micehave heightened susceptibility during the initial stages of he-patic infection with L. donovani and that this is linked to adefective IFN-� response and limited induction of NOS2 ininfected KCs. These data add IRF-7 to the list of interferonregulatory factors playing a role in acquired host resistance tointracellular pathogens.

ACKNOWLEDGMENTS

This work was supported by grants from the Wellcome Trust and theMedical Research Council (to P.M.K.).

We thank the staff of the Biological Services Facility for animalhusbandry and the Technology Facility for microscopy support.

We declare no conflicts of interest.

REFERENCES

1. Alter-Koltunoff, M., et al. 2008. Innate immunity to intraphagosomal patho-gens is mediated by interferon regulatory factor 8 (IRF-8) that stimulates theexpression of macrophage-specific Nramp1 through antagonizing repressionby c-Myc. J. Biol. Chem. 283:2724–2733.

1a.Ato, M., et al. 2002. Defective CCR7 expression on dendritic cells contrib-utes to the development of visceral leishmaniasis. Nat. Immunol. 3:1185–1191.

2. Balaraman, S., P. Tewary, V. K. Singh, and R. Madhubala. 2004. Leishmaniadonovani induces interferon regulatory factor in murine macrophages: a hostdefense response. Biochem. Biophys. Res. Commun. 317:639–647.

3. Barnes, B. J., J. Richards, M. Mancl, S. Hanash, L. Beretta, and P. M. Pitha.2004. Global and distinct targets of IRF-5 and IRF-7 during innate responseto viral infection. J. Biol. Chem. 279:45194–45207.

4. Beattie, L., et al. 2010. Dynamic imaging of experimental Leishmania dono-vani-induced hepatic granulomas detects Kupffer cell-restricted antigen pre-sentation to antigen-specific CD8 T cells. PLoS Pathog. 6:e1000805.

5. Beattie, L., et al. 2010. Leishmania donovani-induced expression of signalregulatory protein alpha on Kupffer cells enhances hepatic invariant NKT-cell activation. Eur. J. Immunol. 40:117–123.

6. Blackwell, J. M., et al. 2001. SLC11A1 (formerly NRAMP1) and diseaseresistance. Cell. Microbiol. 3:773–784.

7. Bradley, D. J. 1977. Regulation of Leishmania populations within the host.

II. Genetic control of acute susceptibility of mice to Leishmania donovaniinfection. Clin. Exp. Immunol. 30:130–140.

8. Crocker, P. R., E. V. Davies, and J. M. Blackwell. 1987. Variable expressionof the murine natural resistance gene Lsh in different macrophage popula-tions infected in vitro with Leishmania donovani. Parasite Immunol. 9:705–719.

9. Engwerda, C. R., and P. M. Kaye. 2000. Organ-specific immune responsesassociated with infectious disease. Immunol. Today 21:73–78.

10. Farrar, J. D., et al. 2000. Selective loss of type I interferon-induced STAT4activation caused by a minisatellite insertion in mouse Stat2. Nat. Immunol.1:65–69.

11. Giese, N. A., et al. 1997. Interferon (IFN) consensus sequence-binding pro-tein, a transcription factor of the IFN regulatory factor family, regulatesimmune responses in vivo through control of interleukin 12 expression. J.Exp. Med. 186:1535–1546.

12. Gorak, P. M., C. R. Engwerda, and P. M. Kaye. 1998. Dendritic cells, but notmacrophages, produce IL-12 immediately following Leishmania donovaniinfection. Eur. J. Immunol. 28:687–695.

13. Honda, K., et al. 2005. Spatiotemporal regulation of MyD88-IRF-7 signallingfor robust type-I interferon induction. Nature 434:1035–1040.

14. Honda, K., et al. 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434:772–777.

15. Jayakumar, A., M. J. Donovan, V. Tripathi, M. Ramalho-Ortigao, and M. A.McDowell. 2008. Leishmania major infection activates NF-kappaB and in-terferon regulatory factors 1 and 8 in human dendritic cells. Infect. Immun.76:2138–2148.

16. Jeronimo, S. M., et al. 2007. Genes at human chromosome 5q31.1 regulatedelayed-type hypersensitivity responses associated with Leishmania chagasiinfection. Genes Immun. 8:539–551.

17. Kamijo, R., et al. 1994. Requirement for transcription factor IRF-1 in NOsynthase induction in macrophages. Science 263:1612–1615.

18. Klein, I., et al. 2007. Kupffer cell heterogeneity: functional properties ofbone marrow derived and sessile hepatic macrophages. Blood 110:4077–4085.

19. Leclercq, V., M. Lebastard, Y. Belkaid, J. Louis, and G. Milon. 1996. Theoutcome of the parasitic process initiated by Leishmania infantum in labo-ratory mice: a tissue-dependent pattern controlled by the Lsh and MHC loci.J. Immunol. 157:4537–4545.

20. Lepay, D. A., C. F. Nathan, R. M. Steinman, H. W. Murray, and Z. A. Cohn.1985. Murine Kupffer cells. Mononuclear phagocytes deficient in the gener-ation of reactive oxygen intermediates. J. Exp. Med. 161:1079–1096.

21. Liang, L., and W. C. Sha. 2002. The right place at the right time: novel B7family members regulate effector T cell responses. Curr. Opin. Immunol.14:384–390.

22. Lohoff, M., et al. 2000. Deficiency in the transcription factor interferonregulatory factor (IRF)-2 leads to severely compromised development ofnatural killer and T helper type 1 cells. J. Exp. Med. 192:325–336.

23. Lohoff, M., et al. 1997. Interferon regulatory factor-1 is required for a Thelper 1 immune response in vivo. Immunity 6:681–689.

24. Martin, E., C. Nathan, and Q. W. Xie. 1994. Role of interferon regulatoryfactor 1 in induction of nitric oxide synthase. J. Exp. Med. 180:977–984.

25. Murray, H. W. 1981. Susceptibility of Leishmania to oxygen intermediatesand killing by normal macrophages. J. Exp. Med. 153:1302–1315.

26. Murray, H. W., and C. F. Nathan. 1999. Macrophage microbicidal mecha-nisms in vivo: reactive nitrogen versus oxygen intermediates in the killing ofintracellular visceral Leishmania donovani. J. Exp. Med. 189:741–746.

27. Murray, H. W., Z. Xiang, and X. Ma. 2006. Responses to Leishmania do-novani in mice deficient in both phagocyte oxidase and inducible nitric oxidesynthase. Am. J. Trop. Med. Hyg. 74:1013–1015.

28. Nguyen, K. B., et al. 2000. Interferon alpha/beta-mediated inhibition andpromotion of interferon gamma: STAT1 resolves a paradox. Nat. Immunol.1:70–76.

29. O’Shea, J. J., and R. Visconti. 2000. Type 1 IFNs and regulation of TH1responses: enigmas both resolved and emerge. Nat. Immunol. 1:17–19.

30. Phillips, R., et al. 2010. Innate killing of Leishmania donovani by macro-phages of the splenic marginal zone requires IRF-7. PLoS Pathog.6:e1000813.

31. Rogge, L., et al. 1998. The role of Stat4 in species-specific regulation of Thcell development by type I IFNs. J. Immunol. 161:6567–6574.

32. Rosas, L. E., et al. 2006. STAT1 and T-bet play distinct roles in determiningoutcome of visceral leishmaniasis caused by Leishmania donovani. J. Immu-nol. 177:22–25.

33. Sgarbanti, M., G. Marsili, A. L. Remoli, R. Orsatti, and A. Battistini. 2007.IRF-7: new role in the regulation of genes involved in adaptive immunity.Ann. N. Y. Acad. Sci. 1095:325–333.

34. Stager, S., J. Alexander, K. C. Carter, F. Brombacher, and P. M. Kaye. 2003.Both interleukin-4 (IL-4) and IL-4 receptor alpha signaling contribute to thedevelopment of hepatic granulomas with optimal antileishmanial activity.Infect. Immun. 71:4804–4807.

35. Svensson, M., et al. 2005. Invariant NKT cells are essential for the regulationof hepatic CXCL10 gene expression during Leishmania donovani infection.Infect. Immun. 73:7541–7547.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

36. Taki, S., et al. 1997. Multistage regulation of Th1-type immune responses bythe transcription factor IRF-1. Immunity 6:673–679.

37. Tamura, T., H. Yanai, D. Savitsky, and T. Taniguchi. 2008. The IRF familytranscription factors in immunity and oncogenesis. Annu. Rev. Immunol.26:535–584.

38. Taylor, G. A., C. G. Feng, and A. Sher. 2004. p47 GTPases: regulators ofimmunity to intracellular pathogens. Nat. Rev. Immunol. 4:100–109.

39. Tominaga, N., et al. 2003. Development of Th1 and not Th2 immune

responses in mice lacking IFN-regulatory factor-4. Int. Immunol. 15:1–10.

40. Vidal, S., et al. 1995. The Ity/Lsh/Bcg locus: natural resistance to infectionwith intracellular parasites is abrogated by disruption of the Nramp1 gene. J.Exp. Med. 182:655–666.

41. Xin, L., K. Li, and L. Soong. 2008. Down-regulation of dendritic cell signal-ing pathways by Leishmania amazonensis amastigotes. Mol. Immunol. 45:3371–3382.

Editor: J. F. Urban, Jr.


on Novem


.org/D

ownloaded from

http://iai.asm.org/

Documents

Interferon Regulatory Factor 7 Contributes to the Control ... · cedures and Ethics Committee and performed under United Kingdom Home Ofﬁce license. Confocal microscopy. Confocal