Instructions for use

Title Keratin 1 Gene Mutation Detected in Epidermal Nevus with Epidermolytic Hyperkeratosis

Author(s) Tsubota, Akiko; Akiyama, Masashi; Sakai, Kaori; Goto, Maki; Nomura, Yukiko; Ando, Satomi; Abe, Masataka;Sawamura, Daisuke; Shimizu, Hiroshi

Citation Journal of Investigative Dermatology, 127(6), 1371-1374https://doi.org/10.1038/sj.jid.5700712

Issue Date 2007-06

Doc URL http://hdl.handle.net/2115/30282

Rights Nature Publishing Group, JOURNAL OF INVESTIGATIVE DERMATOLOGY, 127(6), 2007, pp.1371-1374.

Type article (author version)

File Information JID127-6.pdf

Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP

Journal of Investigative Dermatology MS# JID-2006-0726 Revised Version Mutation Report Keratin 1 Gene Mutation Detected in Epidermal Nevus with Epidermolytic Hyperkeratosis Akiko Tsubota, Masashi Akiyama*, Kaori Sakai, Maki Goto, Yukiko Nomura, Satomi Ando, Masataka Abe, Daisuke Sawamura, Hiroshi Shimizu*

Department of Dermatology, Hokkaido University Graduate School of Medicine, Sapporo, Japan. *Co-corresponding authors: Masashi Akiyama and Hiroshi Shimizu Department of Dermatology Hokkaido University Graduate School of Medicine North 15 West 7, Kita-ku, Sapporo 060-8638, Japan Telephone: +81-11-716-1161, ext. 5962 Fax: +81-11-706-7820 e-mail akiyama@med.hokudai.ac.jp shimizu@med.hokudai.ac.jp Short title: Keratin 1 mutation in epidermal nevus Key words: bullous congenital ichthyosiform erythroderma / epidermolytic hyperkeratosis / granular degeneration / mosaicism / palmoplantar keratoderma Abbreviations: BCIE, bullous congenital ichthyosiform erythroderma; EH, epidermolytic hyperkeratosis; K1, keratin 1; K10, keratin 10; LA-PCR, long and accurate PCR

1

Abstract

Since 1994, four cases of epidermal nevus with epidermolytic

hyperkeratosis (EH) caused by K10 gene mutations have been reported,

although no K1 gene mutation has yet been reported. We detected a K1

gene (KRT1) mutation in epidermal nevus with EH in a 10-year-old

Japanese male. The patient showed well-demarcated verrucous,

hyperkeratotic plaques mainly on the trunk, covering 15 % of the entire

body surface. No hyperkeratosis was seen on the palms or soles. He had no

family history of skin disorders. His lesional skin showed typical granular

degeneration and, ultrastructurally, clumped keratin filaments were

observed in the upper epidermis. Direct sequence analysis of genomic DNA

extracted from lesional skin revealed a heterozygous 5’ donor splice site

mutation c.591+2T>A in KRT1. This mutation was not detected in genomic

DNA samples from patient’s peripheral blood leukocytes or those of other

family members. The identical splice mutation was previously reported in a

family with palmoplantar keratoderma and mild ichthyosis, and was

demonstrated to result in a 22 amino acid deletion p.Val175_Lys196del in

the H1 and 1A domains of K1. The present patient is the first reported case

of epidermal nevus associated with EH caused by a K1 gene mutation in a

mosaic pattern.

2

INTRODUCTION

Epidermal nevi are skin hamartomatous lesions comprised of

keratinocytes. Their clinical features include circumscribed verrucous

lesions of any size, single or multiple in nature, and they can occur at any

site, frequently following Blaschko’s lines. Epidermal nevi are thought to

reflect a genetic mosaicism and, it has been often hypothesized that

epidermal nevi with epidermolytic hyperkeratosis (EH) reflect

differentiation specific, suprabasal keratin gene mutations. The term “EH”

in this case means pathological changes seen in bullous congenital

ichthyosiform erythroderma (BCIE), a keratin 1 (K1)/keratin 10 (K10)

disease, although EH is a histological feature of more than one disease.

Indeed, K10 gene mutations were reported in four cases of epidermal nevi

with EH (Paller et al., 1994; Moss et al., 1995), although no K1 gene

mutation has yet been reported. A mosaic mutation in the V1 domain of

keratin 16 was reported to underlie unilateral palmoplantar verrucous nevus

with vacuolar degeneration of keratinocytes in the upper epidermis

(Terrinoni et al., 2000).

A diverse range of subtly different phenotypes including classical BCIE

has been described with mutations in K1 (reviewed in Lane and McLean,

2004). Splice site mutations affecting the K1 peptide 1A or 2B domain

caused epidermolytic palmoplantar keratoderma (PPK) (reviewed in

Terron-Kwiatkowski et al., 2002). Now a total of 47 different mutations

have been reported in K1 (The Human Intermediate Filament Database).

Here we report that a splice site mutation in the K1 gene, previously

reported in a case of PPK and mild ichthyosis, was associated with the

epidermal nevus with EH disease phentoype. As far as we know, the

3

present case is the first reported patient of epidermal nevus with EH

associated with a K1 gene mutation.

RESULTS

Clinical features

A 10-year-old Japanese male showed well-demarcated verrucous,

hyperkeratotic plaques mainly on the trunk, covering 15 % of his entire

body surface. They distributed following the Blaschko’s lines (Figure 1).

No hyperkeratosis was seen on the palms and soles. The other family

members including his parents and elder brother had neither BCIE nor

epidermal nevus.

Typical granular degeneration and clumped keratin filaments were

seen in the epidermal nevus

Light microscopy of the skin samples from the nevus on the trunk revealed

typical granular degeneration with large keratohyalin granules in the upper

epidermis (data not shown). Electron microscopy showed clumped keratin

filaments in the upper epidermal keratinocytes (data not shown). Some of

those keratinocytes with abnormal keratin clumps were undergoing

degeneration.

A splice site mutation in K1 gene (KRT1) was identified in lesional skin

but not in peripheral blood

Mutation analysis of the entire 1-9 exons including the intron-exon

boundaries of the K1 gene (KRT1) revealed a heterozygous T>A

substitution at base position 591+2, in intron 1 (c.591+2T>A) (Figure 2).

4

This mutation disrupts the KRT1 exon 1 donor splice site. This mutation

was not detected in genomic DNA samples from patient’s peripheral blood

leukocytes (Figure 2a) or those of his family members. No other mutation

was found in the entire exon and intron/exon borders of the K1 and K10

genes. The mutation was not found in 100 normal, unrelated Japanese

alleles (50 healthy unrelated Japanese individuals) by sequence analysis,

and was unlikely to be a polymorphism (data not shown).

By mutant allele specific amplification analysis (Hasegawa et al., 1995; Xu

et al., 2003), a 102 bp fragment derived from the mutant allele was

amplified from the genomic DNA sample extracted from the lesional skin

(Figure 2b). The 102 bp fragment was sequenced and it was confirmed that

the fragment was derived from the targeted region of K1 gene, KRT1. The

mutant allele specific amplification showed no PCR product bands from

the peripheral blood cell DNA samples from the patient, any other family

members or controls.

K1 expression was weak and keratin 2e (K2e) expression was

upregulated in the epidermal nevus lesion

Immunofluorescence studies revealed that K1 and K10 were present in

the lesional epidermal suprabasal layers, although K1 expression was

weaker than that in the normal control skin (Figure S1a-d). In the

regions showing granular degeneration, abnormal, large granules in the

degenerated keratinocytes were positive for K1 and K10. K2e was

expressed only in the uppermost spinous and the granular layers of

epidermis in normal control skin (Figure S1f). In the patient’s lesional

skin, K2e expression was seen in the almost all suprabasal epidermal

5

layers, suggesting an upregulated expression of K2e in the lesional

epidermis (Figure S1e).

DISCUSSION

All the reported causative mutations underlying epidermal nevus with EH

affected the K10 gene (Paller et al., 1994; Moss et al., 1995). As far as we

know, the present case is the first reported case of epidermal nevus with EH

caused by a K1 gene mutation.

K2e expression increased in the lesional epidermis of the present case.

Although we do not have any direct evidence, K2e expression might be

upregulated compensatively in the epidermis with disrupted keratin

network. Indeed, increased K2e expression was also observed in the

lesional epidermis with disturbed keratin network of ichthyosis bullosa of

Siemens patients (Akiyama et al., 2005).

In our case, the causative K1 mutation was detected only in the lesional

skin, but not in the peripheral blood cells, as previously reported in K10

mutations in epidermal nevus with EH (Paller et al., 1994; Moss et al.,

1995). Our findings further support that the mutation detection of K1 as well

as K10 in epidermal nevus can be reliably performed only from direct

examination of lesional skin, not from analysis of other tissue or peripheral

blood cells.

As epidermal nevus is a disease caused by somatic mosaicism, widespread

6

skin lesions increase the risk of germ-line transmission (Paller et al., 1994).

In case causative K1 or K10 mutations are transmitted in germ-line, a half of

the children from patients with epidermal nevus with EH are expected to be

affected with ichthyosis on the whole body. Mutation analysis using a

patient's sperm gives us information on germ-line transmission (Zlotogora,

1998; Rantamaki et al., 1999). If the germ-line transmission is confirmed,

prenatal genetic screening may be applied for the offspring of the patient as

previously reported in the prenatal diagnosis of BCIE by molecular analysis

(Rothnagel et al., 1994; Tsuji-Abe et al., 2004).

The K1 gene mutation detected in the present case was a splice donor site

mutation c.591+2T>A. According to Splice Site Prediction by Neural

Network software (http://www.fruitfly.org/seq_tools/splice.html) (Tal et al.,

2005; Wessagowit et al., 2005; Wessagowit et al., 2006), a consequence of

this mutation is predicted with the highest probability, we can expect a

splice variant with an upstream cryptic splice donor site resulting in a 66 bp

deletion (22 amino acid deletion; p.Val175-Lys196del). The second highest

probability, an alternative splice pattern activating a cryptic donor site 22

bp downstream of the mutation with the subsequent insertion of 8 amino

acids into the 1A rod domain was predicted. Indeed, in a patient with PPK

with the same K1 gene mutation as in the present case, mRNA expression

analysis by in vitro splicing assay clearly indicated that the splice site

mutation c.591+2T>A results in a partial deletion of the H1 and 1A

domains of K1 (p.Val175_Lys196del) (Terron-Kwiatkowski et al., 2002),

as predicted by the highest probability using the software model.

Concerning reported mutations in the adjacent nucleotide as our mutation

7

in the K1 gene, i.e. splice donor site mutations c.591+1T>A and

c.591+3T>A were reported to lead to the same 22 amino acid deletions

(Vitanen et al., 2003; Tal et al., 2005). Thus, we may expect an identical 22

amino acid deletion p.Val175_Lys196del in K1 peptides as a consequence

of the KRT1 mutation c.591+2T>A in lesional keratinocytes from the

present patient.

Interestingly, the KRT1 mutation that had been reported to cause PPK

(Terron-Kwiatkowski et al., 2002) led to an epidermal nevus with EH

phenotype distributed on the trunk and the extremities in our case. In the

previous PPK patient with an identical mutation, only mild hyperkeratosis

was found over limited body areas and it was speculated that loss of the

protein motif in the helix boundary that is essential for the interaction of

keratin filaments (Steinert et al., 1993) have a less disruptive effect on

normal keratin filament assembly (Terron-Kwiatkowski et al., 2002). A

similar mechanism can be expected in deletions at either end of the K1 rod

domain. Indeed, a splice site mutation in K1 that leads to the insertion of 18

amino acids into the 2B domain led to a mild epidermolytic PPK phenotype

(reviewed in Terron-Kwiatkowski et al., 2002). However, in our case, the

mosaicism of the mutation showed an epidermal nevus phenotype even on

the trunk and the extremities. The precise mechanism of how identical

splice site mutations can result in a different severity of the lesions on the

trunk remains unclear.

Until the present report, all the reported mosaic mutations causing

8

epidermal nevus with EH had been due to K10 mutations that would have

resulted in BCIE if every cell in the body were affected (Paller et al., 1994;

Moss et al., 1995). In conclusion, the present case clearly indicated that K1

mutations with genetic mosaicism also cause epidermal nevus with EH. The

present K1 mosaicism might have led to PPK with mild hyperkeratotic

lesions if all the epidermal cells were affected over the entire body surface

(Terron-Kwitkowski et al., 2002).

MATERIALS AND METHODS

Mutation detection Mutation analysis was performed using genomic

DNA extracted from the lesional epidermal nevus skin and peripheral blood

leukocytes from the patient. In the other family members and normal

controls, genomic DNA isolated from peripheral blood leukocytes was used

for the analysis. Briefly, genomic DNA samples were subjected to PCR

amplification, followed by direct automated sequencing using an ABI

PRISM 3100 genetic analyzer (ABI Advanced Biotechnologies, Columbia,

MD, U.S.A.). The oligonucleotide primers were designed using the website

program (primer3_www.cgi v 0.2). The primers used for amplification of

exon 1 were as follows; forward, gtggacgtggtagtggcttt; reverse,

ctttaggtcgaccaccaacc. The entire coding region including the intron/exon

boundaries for both forward and reverse strands were sequenced. For

normal controls, 50 healthy unrelated Japanese individuals (100 normal

alleles) were studied.

Mutant allele specific amplification analysis Long and accurate

(LA)-PCR was done using primers, forward primer ex1F1;

9

aggaggtgggagatttt and a reverse primer ex2R; catgctgcttcatgatcttagc. For

the verification of the mutation, using LA-PCR products as a template,

mutant allele specific amplification analysis was performed with mutant

allele specific primers carrying the substitution of two bases at the 3’-end

(Linard et al., 2002; Sapio et al., 2006), as follows; forward,

gcctccttcattgacaagaa; reverse, ttcaaacctgcgtgtgttttgactgcaccgatccc. PCR

conditions were as follows; 94℃ for 5 min after (hot-start procedure) and

then 94℃ for 1 min, 56℃ for 1 min, 72℃ for 1 min during 35 cycles,

followed by 72℃ for 7 min. Only the 102 bp fragment derived from the

mutant allele was amplified with these primers and the PCR condition.

Ultrastructural observations Epidermal nevus on the trunk was

biopsied for morphological observation. Skin biopsy samples were

fixed in 2% glutaraldehyde solution, post-fixed in 1% OsO4,

dehydrated, and embedded in Epon 812. The samples were sectioned

at 1 µm thickness for light microscopy and thin sectioned for

electron microscopy (70 nm thick). The thin sections were stained

with uranyl acetate and lead citrate and examined in a transmission

electron microscope.

Antibodies Polyclonal anti-K1 antiserum (DAKO, Glostrup,

Denmark), anti-K2e antibody (Progen Biotechnick, Heidelberg,

Germany) and anti-K10 antiserum (Novocastra, New Castle upon

Tyne, England) were used in the present study.

Immunofluorescent labeling Immunofluorescent labeling was

performed as described previously (Akiyama et al., 2000). Briefly,

10

6-µm-thick sections of freshly frozen patient’s skin was cut using a

cryostat. The sections were incubated in primary antibody solution

for 30 min at 37˚C. Antibody dilutions were as follows; 1/10 for

anti-K1 antiserum, 1/50 for anti-K2e antibody and 1/100 for

anti-K10 antibody. The sections were then incubated in fluorescein

isothiocyanate-conjugated to rabbit anti-mouse immunoglobulins

and FITC-conjugated goat anti-mouse immunoglobulins diluted

1:100 (DAKO, Glostrup, Denmark) for 30 min at 37℃. The

sections were extensively washed with phosphate-buffered saline

between incubations. The stained sections were then mounted with

a cover slip and observed using a confocal laser scanning

microscope.

The medical ethical committee at Hokkaido University and

Hokkaido Cancer Institute approved all described studies. The study

was conducted according to the Declaration of Helsinki Principles.

Participants gave their written, informed consent.

Conflict of Interest

The authors state no conflict of interest.

ACKNOWLEDGEMENTS

We thank Ms. Megumi Sato and Ms. Akari Nagasaki for their technical

assistance on this project. We also thank Prof. James R. McMillan for

proofreading this manuscript. This work was supported in part by

Grants-in-Aid from the Ministry of Education, Science, Sports, and Culture

of Japan to M. Akiyama (Kiban B 18390310) and to H. Shimzu (Kiban A

11

17209038).

12

SUPPLEMENTARY MATERIALS

Figure S1. Immunofluorescent staining for K1 was weak, although K2e

expression was upregulated in the epidermal nevus.

13

REFERENCES

Akiyama M, Smith LT, Shimizu H (2000) Changing patterns of localization

of putative stem cells in developing human hair follicles. J Invest

Dermatol 114: 321-7

Akiyama M, Tsuji-Abe Y, Yanagihara M, Nakajima K, Kodama H, Yaosaka

M, Abe M, Sawamura D, Shimizu H (2005) Ichthyosis bullosa of Siemens:

its correct diagnosis facilitated by molecular genetic testing. Br J Dermatol

152: 1353-6

Hasegawa Y, Takeda S, Ichii S, Koizumi K, Maruyama M, Fujii A, et al.

(1995) Deletion of K-ras mutations in DNAs isolated from faces of

patients with colorectal tumors by mutant-allele-specific-amplification

(MASA). Oncogene 10: 1441-5

Lane EB, Mclean WHI (2004) Keratins and skin disorders. J Pathol 204:

355-66

Linard B, Bezieau S, Benlalam H, Labarrire N, Guilloux Y, Diez E, et al.

(2002) A ras-mutated peptide targeted by CTL infiltrating a human

melanoma lesion. J Immunol 168:4802-8

Moss C, Jones DO, Blight A, Bowden PE (1995) Birthmark due to

cutaneous mosaicism for keratin 10 mutation. Lancet 345: 596

Paller AS, Syder AJ, Chan YM, Yu QC, Hutton E, Tadini G, et al. (1994)

14

Genetic and clinical mosaicism in a type of epidermal nevus. N Engl J

Med 331:1408-15

Rantamaki T, Kaitila I, Syvanen A-C. Lukka M, Peltonen L (1999)

Recurrence of Marfan syndrome as a result of parental germ-line

mosaicism for an FBN1 mutation. Am J Hum Genet 64: 993-1001

Rothnagel JA, Longley MA, Holder RA, Kuster W, Roop DR (1994)

Prenatal diagnosis of epidermolytic hyperkeratosis by direct gene

sequencing. J Invest Dermatol 102:13-6

Sapio MR, Posca SD, Trocone G, Pettinato G, Palombini L, Rossi G, et al.

(2006) Detection of BRAF mutation in thyroid papillary carcinomas

by mutant allele-specific PCR amplification (MASA). Eur J

Endocrinol 154: 341-8

Steinert PM, Yang JM, Bale SJ, Compton JG (1993) Concrrence between

the molecular overlap regions in keratin intermediate filaments and the

locations of keratin mutations in genodermatoses. Biochem Biophys

Res Commun 197: 840-8

Tal O, Bergman R, Alcalay J, Indelman M, Sprecher E (2005)

Epidermolytic hyperkeratosis type PS-1 caused by aberrant splicing of

KRT1. Clin exp dermatol 30:64-7

Terrinoni A, Puddu P, Didona B, De Laurenzi V, Candi E, Smith FJ,

McLean WH, Melino G (2000) A mutation in the V1 domain of K16 is

15

responsible for unilateral palmoplantar verrucous nevus. J Invest Dermatol

114: 1136-40

Terron-Kwiatkowski A, Paller AS, Compton J, Atherton DJ, McLean WH,

Irvine AD (2002) Two cases of primarily palmoplantar keratoderma

associated with novel mutations in keratin 1. J Invest Dermatol 119:

966-71

Tsuji-Abe Y, Akiyama M, Nakamura H, Takizawa Y, Sawamura D,

Matsunaga K, et al. (2004) DNA-based prenatal exclusion of bullous

congenital ichthyosiform erythroderma at the early stage, 10-11 weeks'

of pregnancy in two consequent siblings. J Am Acad Dermatol 51:

1008-11

Vitanen M, Smith SK, Gedde-Dahl Jr T, Vahlquist A, Bowden PE (2003)

Splice site and deletion mutations in keratin (KRT1 and KRT10)

genes: Unusual phenotypic alterations in scandinavian patients with

epidermolytic hyperkeratosis. J Invest Dermatol 121: 1013-20

Wessagowit V, Kim SC, Woong OS, McGrath JA (2005)

Genotype-phenotype correlation in recessive dystrophic epidermolysis

bullosa: when missense doesn't make sense. J Invest Dermatol 124 :

863-6

Wessagowit V, Nalla VK, Rogan PK, McGrath JA (2006) Normal and

abnormal mechanisms of gene splicing and relevane to inherited skin

disease. J Dermatol Sci 40: 73-84

16

Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA (2003) High prevalence of

BRAF gene mutation in papillary thyroid carcinomas and thyroid

tumor cell lines. Cancer Res 63: 4561-7

Zlotogora J. Germ line mosaicism (1998) Hum Genet 102: 381-6

17

FIGURE LEGENDS

Figure 1. Clinical features of epidermal nevi at the age of 10

Well-demarcated verrucous, hyperkeratotic plaques, light to dark brown in

color, were seen on the back (a), axilla (b) and abdomen (c).

Figure 2. A splice site mutation c.591+2T>A was detected in the

lesional skin

(a) Direct sequencing of KRT1 exon 1 PCR products derived from patient’s

lesional skin revealed heterozygous donor splice site mutation c.591+2T>A.

This mutation was not detected in genomic DNA samples from the patient’s

peripheral blood leukocytes.

(b) Mutant allele specific amplification analysis showed the amplification

band from the mutant allele as a 102 bp fragment only from the DNA

sample from the patient’s lesional skin, confirming the presence of the

mutation c.591+2T>A in the patient’s epidermal nevus.

18