of 10 /10
The Eumelanin Intermediate 5,6-Dihydroxyindole- 2-Carboxylic Acid Is a Messenger in the Cross-Talk among Epidermal Cells Daniela Kovacs 1,3 , Enrica Flori 1,3 , Vittoria Maresca 1 , Monica Ottaviani 1 , Nicaela Aspite 1 , Maria Lucia Dell’Anna 1 , Lucia Panzella 2 , Alessandra Napolitano 2 , Mauro Picardo 1 and Marco d’Ischia 2 Interest in colorless intermediates of melanocyte metabolism has traditionally been related to their role as melanin precursors, though several lines of evidence scattered in the literature suggested that these compounds may exert an antioxidant and protective function per se unrelated to pigment synthesis. Herein, we disclose the remarkable protective and differentiating effects of 5,6-dihydroxyindole-2-carboxylic acid (DHICA), a diffusible dopachrome tautomerase (DCT)-dependent eumelanin intermediate, on primary cultures of human keratinocytes. At micromolar concentrations, DHICA induced: (a) time- and dose-dependent reduction of cell proliferation without concomitant toxicity; (b) enhanced expression of early (spinous keratins K1 and K10 and envelope protein involucrin) and late (loricrin and filaggrin) differentiation markers; (c) increased activities and expression of antioxidant enzymes; and (d) decreased cell damage and apoptosis following UVA exposure. The hitherto unrecognized role of DHICA as an antiproliferative, protective, and antiapoptotic endogenous cell messenger points to a reappraisal of the biological functions of melanocytes and DCT in skin homeostasis and photoprotection beyond the mere provision of melanin pigments, and provides, to our knowledge, a previously unreported possible explanation to the higher resistance of the dark-skinned eumelanic phenotypes to sunburn and skin cancer. Journal of Investigative Dermatology (2012) 132, 1196–1205; doi:10.1038/jid.2011.457; published online 2 February 2012 INTRODUCTION The structural and functional integration between melano- cytes and keratinocytes (the epidermal melanin unit) is believed to have a central role in skin photoprotection against the harmful effects of ultraviolet radiation (UV). The inter- actions among melanocytes and keratinocytes are regulated by a paracrine network of growth factors and cytokines, released from all skin cell population in response to UV and involved in promoting several responses, including differen- tiation and survival (Imokawa, 2004). UV-induced melano- genesis is the most evident aspect of melanocyte differentia- tion, and generates melanins as putatively photoprotective end products. Two main types of melanin pigments have been identified in the skin, the black eumelanins, typical of darkly pigmented phenotypes, and the sulphur-containing pheomelanins, mainly present in the epidermis of fair- skinned subjects with a high susceptibility to actinic damage and skin cancer. Current views suggest that eumelanins serve as a filter against UV radiation and possess efficient scavenging properties toward photogenerated free-radical species, whereas pheomelanins are not only less-effective UV screens but also act apparently as photosensitizers. Although the protective function of epidermal melanocytes is generally associated with a competence for eumelanin synthesis, several evidence indicate that the entire biochemical pathway is relevant to melanocyte function (Prota, 2000). Slominski et al. (2004), for example, highlighted the possible role of tyrosine and other eumelanin intermediates as second messengers affecting intracellular and intercellular commu- nication, and emphasized the powerful immunosuppressive action of L-Dopa and its oxidation products. The precise mech- anisms by which the eumelanin-forming pathway would contribute to melanocyte roles in skin homeostasis and (photo)protection remained, however, to be elucidated. Eumelanin synthesis is initiated by the tyrosinase- promoted conversion of L-tyrosine to L-dopaquinone, which undergoes cyclization and oxidation yielding L-dopacrome. In mammals, tyrosinase-related protein 1 and dopachrome tautomerase (DCT) are involved in the subsequent steps of the pathway. DCT catalyzes tautomerization of dopacrome into ORIGINAL ARTICLE 1196 Journal of Investigative Dermatology (2012), Volume 132 & 2012 The Society for Investigative Dermatology Received 1 June 2011; revised 27 October 2011; accepted 3 November 2011; published online 2 February 2012 1 Laboratory of Cutaneous Physiopathology and Integrated Center of Metabolomics Research, San Gallicano Dermatologic Institute (IRCCS), Rome, Italy and 2 Department of Organic Chemistry and Biochemistry, University of Naples Federico II, Naples, Italy Correspondence: Mauro Picardo, Laboratory of Cutaneous Physiopathology and Integrated Center of Metabolomics Research, San Gallicano Dermatologic Institute (IRCCS), Via Elio Chianesi 53, Rome 00144, Italy. E-mail: [email protected] 3 These authors contributed equally to this work. Abbreviations: DCT, dopachrome tautomerase; DHICA, 5,6-dihydroxyindole- 2-carboxylic acid; 6H5MICA, 6-hydroxy-5-methoxyindole-2-carboxylic acid; NHKs, normal human keratinocytes; PPAR, peroxisome proliferator-activated receptor; PUFA, polyunsaturated fatty acids; SOD, superoxide dismutase

Melanin the Cabooxylic Acid

Embed Size (px)

DESCRIPTION

Aspects of Melanin

Text of Melanin the Cabooxylic Acid

  • The Eumelanin Intermediate 5,6-Dihydroxyindole-2-Carboxylic Acid Is a Messenger in the Cross-Talkamong Epidermal CellsDaniela Kovacs1,3, Enrica Flori1,3, Vittoria Maresca1, Monica Ottaviani1, Nicaela Aspite1, Maria LuciaDellAnna1, Lucia Panzella2, Alessandra Napolitano2, Mauro Picardo1 and Marco dIschia2

    Interest in colorless intermediates of melanocyte metabolism has traditionally been related to their role asmelanin precursors, though several lines of evidence scattered in the literature suggested that thesecompounds may exert an antioxidant and protective function per se unrelated to pigment synthesis. Herein, wedisclose the remarkable protective and differentiating effects of 5,6-dihydroxyindole-2-carboxylic acid (DHICA),a diffusible dopachrome tautomerase (DCT)-dependent eumelanin intermediate, on primary cultures of humankeratinocytes. At micromolar concentrations, DHICA induced: (a) time- and dose-dependent reduction of cellproliferation without concomitant toxicity; (b) enhanced expression of early (spinous keratins K1 and K10 andenvelope protein involucrin) and late (loricrin and filaggrin) differentiation markers; (c) increased activities andexpression of antioxidant enzymes; and (d) decreased cell damage and apoptosis following UVA exposure. Thehitherto unrecognized role of DHICA as an antiproliferative, protective, and antiapoptotic endogenous cellmessenger points to a reappraisal of the biological functions of melanocytes and DCT in skin homeostasis andphotoprotection beyond the mere provision of melanin pigments, and provides, to our knowledge, a previouslyunreported possible explanation to the higher resistance of the dark-skinned eumelanic phenotypes tosunburn and skin cancer.

    Journal of Investigative Dermatology (2012) 132, 11961205; doi:10.1038/jid.2011.457; published online 2 February 2012

    INTRODUCTIONThe structural and functional integration between melano-cytes and keratinocytes (the epidermal melanin unit) isbelieved to have a central role in skin photoprotection againstthe harmful effects of ultraviolet radiation (UV). The inter-actions among melanocytes and keratinocytes are regulatedby a paracrine network of growth factors and cytokines,released from all skin cell population in response to UV andinvolved in promoting several responses, including differen-tiation and survival (Imokawa, 2004). UV-induced melano-genesis is the most evident aspect of melanocyte differentia-tion, and generates melanins as putatively photoprotectiveend products. Two main types of melanin pigments have

    been identified in the skin, the black eumelanins, typical ofdarkly pigmented phenotypes, and the sulphur-containingpheomelanins, mainly present in the epidermis of fair-skinned subjects with a high susceptibility to actinic damageand skin cancer. Current views suggest that eumelaninsserve as a filter against UV radiation and possess efficientscavenging properties toward photogenerated free-radicalspecies, whereas pheomelanins are not only less-effective UVscreens but also act apparently as photosensitizers. Althoughthe protective function of epidermal melanocytes is generallyassociated with a competence for eumelanin synthesis, severalevidence indicate that the entire biochemical pathway isrelevant to melanocyte function (Prota, 2000). Slominskiet al. (2004), for example, highlighted the possible role oftyrosine and other eumelanin intermediates as secondmessengers affecting intracellular and intercellular commu-nication, and emphasized the powerful immunosuppressiveaction of L-Dopa and its oxidation products. The precise mech-anisms by which the eumelanin-forming pathway wouldcontribute to melanocyte roles in skin homeostasis and(photo)protection remained, however, to be elucidated.

    Eumelanin synthesis is initiated by the tyrosinase-promoted conversion of L-tyrosine to L-dopaquinone, whichundergoes cyclization and oxidation yielding L-dopacrome.In mammals, tyrosinase-related protein 1 and dopachrometautomerase (DCT) are involved in the subsequent steps of thepathway. DCT catalyzes tautomerization of dopacrome into

    ORIGINAL ARTICLE

    1196 Journal of Investigative Dermatology (2012), Volume 132 & 2012 The Society for Investigative Dermatology

    Received 1 June 2011; revised 27 October 2011; accepted 3 November 2011;published online 2 February 2012

    1Laboratory of Cutaneous Physiopathology and Integrated Center ofMetabolomics Research, San Gallicano Dermatologic Institute (IRCCS),Rome, Italy and 2Department of Organic Chemistry and Biochemistry,University of Naples Federico II, Naples, Italy

    Correspondence: Mauro Picardo, Laboratory of Cutaneous Physiopathologyand Integrated Center of Metabolomics Research, San GallicanoDermatologic Institute (IRCCS), Via Elio Chianesi 53, Rome 00144, Italy.E-mail: [email protected]

    3These authors contributed equally to this work.

    Abbreviations: DCT, dopachrome tautomerase; DHICA, 5,6-dihydroxyindole-2-carboxylic acid; 6H5MICA, 6-hydroxy-5-methoxyindole-2-carboxylic acid;NHKs, normal human keratinocytes; PPAR, peroxisome proliferator-activatedreceptor; PUFA, polyunsaturated fatty acids; SOD, superoxide dismutase

  • the more stable intermediate 5,6-dihydroxyindole-2-carboxylicacid (DHICA) while tyrosinase-related protein 1 catalyzes inmice the oxidation of DHICA, thus promoting its incorpora-tion into the eumelanin polymer. Suggested biological rolesof DCT include: (a) regulation of neural progenitor cell pro-liferation (Jiao et al., 2006); (b) induction of eumelanin versuspheomelanin synthesis (Costin et al., 2005); (c) regulation of

    hair melanin content in mice (Guyonneau et al., 2004); (d)resistance to UV radiation and chemotherapeutic agents inmelanoma cells (Pak et al., 2004); and (e) decreased bindingof indolic melanogens to proteins (Salinas et al., 1994).Moreover, DCT inactivation elevates reactive oxygen specieslevel, increases the number of sunburn and apoptotic cells,and decreases the amount of eumelanin in the epidermis

    3.5

    * * *

    **

    *

    5 25 50 5 25 50 5 25 50

    48 Hours

    Ki67 DAPI

    72 Hours

    5 25 50

    5 25 50 5 25 50 5 25 50

    Untreated DHICA 50 M

    72 Hours

    5 25 50

    12024 Hours 48 Hours 72 Hours

    100

    80

    60

    40

    Num

    ber o

    f via

    ble

    cells

    /tota

    l cel

    ls (%

    )

    20

    0

    5 25 50 5 25 50

    72 Hours

    *P

  • 4.5

    ^

    ^

    ^

    Involucrin Loricrin Filaggrin

    4.0

    *

    *

    *3.53.02.52.01.51.00.5

    Nor

    maliz

    ed

    mRN

    A fo

    ld e

    xpre

    ssio

    n

    0

    Untreated DHICA 25 M Untreated DHICA 25 M

    K1DAPI

    K10DAPI

    DHICA 50 M

    ++

    ++

    ++

    *P

  • upon exposure to chronic UVA radiation. Most interestingly,DHICAmelanin exhibits a more potent hydroxyl radical-scavenging activity suggesting the important role of DCTin the regulation of eumelanin antioxidant properties(Jiang et al. 2010). Michard et al. (2008) have demonstratedthe association between DCT expression in WM35 melano-ma cells and increased intracellular glutathione levels,reduction in free-radicalsinduced DNA damage, anddecreased cell sensitivity to oxidative stress. Transcriptionalupregulation of DCT mediates also the antiapoptotic propertyof the transcription factor hypoxia-inducible factor-1(Sendoel et al., 2010).

    Whether and by what mechanism(s) DHICA accounts forthe biological roles of DCT have not yet been clarified. Earlystudies showed that DHICA inhibits lipid peroxidation in vitro(Memoli et al., 1997). Subsequent work indicated that DHICAis oxidized by nitric oxide and efficiently inhibits H2O2-Fe(II)/EDTA (Fenton)-induced oxidation processes (Novellino et al.,1998, 1999). Moreover, DHICA exhibits excellent tripletquenching properties (Zhang et al., 2000). DHICA has also anintense absorption maximum at 313 nm, in the erithemogenicUVB region, and exhibits efficient excited state relaxationmechanisms of potential relevance to UV dissipation (Gaudenet al., 2008).

    Very recently, we reported that DHICA possesses anti-oxidant properties in three different in vitro assays and maythus act as a diffusible protective mediator under oxidativestress conditions (Panzella et al., 2011). The aim of thepresent study was to analyze the possible contribution ofDHICA in mediating cell protection mechanisms not onlyin melanocytes but also in the surrounding keratinocytesfunctioning as a diffusible chemical messenger in the contextof the paracrine interactions between epidermal cells, whichregulate skin homeostasis and defense.

    RESULTSDHICA inhibits cell growthTo analyze the effects of DHICA on the growth of normalhuman keratinocytes (NHKs), we first treated the cells with

    increasing concentrations of the compound (5, 25, and 50 mM)for different time points (24, 48, and 72 hours) and performedan 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazoliumbromide (MTT) assay. DHICA caused a time-dependentdecrease of cell proliferation in comparison with controlkeratinocytes (Figure 1a). To further analyze the effectof DHICA on keratinocyte proliferation, we performedan immunofluorescence analysis using an anti-Ki67 poly-clonal antibody to identify cycling cells. At 24 hours, nomodification in the percentage of keratinocytes displayingKi67 positivity was observed between treated and untreatedcells (Figure 1b). At 48 and 72 hours, DHICA caused asignificant decrease in the number of cycling cells at all dosesexamined (Figure 1b and c). A parallel trypan blue cellviability assay confirmed the reduction in the cell numberafter 72 hours of DHICA treatment (Figure 1d) and demon-strated no increase in keratinocyte mortality at any dose andtime point tested (Figure 1e), suggesting an inhibitory effecton proliferation without affecting cell survival. Parallel phasecontrast microscopic analysis after 72 hours of treatmentclearly showed the reduction of cell density (Figure 1f).Keratinocytes exposed to 50 mM DHICA for 72 hours andallowed to recover for 48 hours showed an increase inthe growth with respect to that detected at the end of thetreatment, probably ascribable to the portion of cells thatwere not inhibited by DHICA (Supplementary Figure S1online).

    DHICA induces the expression of differentiation markers

    In the epidermis, keratinocytes committed to the differentia-tion process are characterized by the sequential expression ofearly differentiation markers, such as the spinous keratins K1and K10, and the envelope protein involucrin and then latedifferentiation markers including the granular loricrin andfilaggrin proteins (Fuchs, 1990).

    As some DHICA-treated keratinocytes appeared larger andmore elongated, features typical of a differentiated phenotype(Alani et al., 1999) (Figure 1f), we next evaluated whetherthe DHICA-induced growth inhibition could be associated to

    5024 Hours 48 Hours

    *P

  • enhanced keratinocyte differentiation. Hence, we examinedInvolucrin, Loricrin, and Filaggrin transcripts by quantitativereal-time reverse transcriptasePCR (qRTPCR), and all three

    genes were significantly induced by DHICA (Figure 2a).Keratinocytes grown in the presence of high calcium (1.2 mM)were used as positive control (Bikle et al., 1996). The differ-entiative activity was also evaluated at the protein levelby immunofluorescence analysis for K1 and K10 proteins.Immunolabeling showed a cytoplasmic reactivity in a minorityof untreated keratinocytes (Figure 2b and c, arrows), whereasa strong staining was observed in cells kept in high calciummedium (Figure 2b and c, arrows). A significant increase inthe number of keratinocytes labeled for K1 and K10 wasobserved upon treatment with DHICA (Figure 2b and c, arrows).Immunocytochemical staining for filaggrin showed the presenceof few keratinocytes expressing this late differentiation markerin untreated cells (Figure 2d, arrow). In the presence of highcalcium in the culture medium an increase in the immuno-reactivity was observed (Figure 2d, arrows). DHICA signifi-cantly enhanced the number of filaggrin-positive keratinocytesin a dose-dependent manner with respect to those observedin control cells (Figure 2d, arrows).

    DHICA induces activity and expression of antioxidant enzymes

    As cell differentiation has been reported to be associatedto the increase of antioxidant enzymatic activities (Reinerset al., 1988; Baker and Baker, 1992), we investigated theeffects of DHICA on the antioxidant defense system,evaluating the activities of superoxide dismutase (SOD) andcatalase, which represent the main enzymes involved in themaintenance of the intracellular redox equilibrium during anoxidative stress (Yohn et al., 1991). DHICA stimulated SODactivity in a dose-dependent manner after 24 hours, whereasat 48 hours an increase of its activity was observed only at thehighest concentration (Figure 3a). DHICA was stronglyeffective in inducing catalase activity at 50 mM after 24 hoursand at 25 and 50 mM after 48 hours, while the lowest dosesdid not affect the activity of the enzyme (Figure 3b).Cu Zn SOD, the main inducible cytoplasmic compo-nent of the enzyme, and catalase were also evaluated at theprotein level by western blot analysis. DHICA-exposed keratino-cytes expressed significantly higher levels of both enzymeswith respect to untreated cells (Figure 3c).

    DHICA protects against UVA-induced cell damages and death

    Based on the above results, we investigated whether DHICAmy have a protective role against the free-radicalsmediateddamages resulting from UVA exposure. Keratinocytes were

    120*P

  • exposed to UVA 10 J cm2 and then allowed to recover for24 hours. UVA alone induced a significant decrease in thenumber of viable cells compared with control, as measuredby trypan blue exclusion assay, and pretreatment with DHICA50 mM enhanced the overall cell viability (Figure 4a). Parallelphase contrast microscopic analysis revealed the presence ofmany shrunken and rounded keratinocytes after UVA. Bycontrast, keratinocytes pretreated with DHICA displayedless damage, polygonal-featured and more regular contours(Figure 4b). As peroxidation of the cell membrane poly-unsaturated fatty acids (PUFA) is one of the detrimentaleffects due to free radicals generated after UVA, we evaluatedthe effect of DHICA on PUFA content. DHICA did not affectthe base concentration of PUFA. UVA caused a marked pero-xidative damage with a B30% reduction in PUFA contentwith respect to that measured in nonirradiated cells. DHICAbefore UV irradiation significantly reduced such effects(Figure 4c). UVA-mediated oxidative injury can ultimatelyresult in apoptosis, we therefore examined the modificationof the apoptosis marker annexin V by FACS analysis. Nodifferences in annexin V staining pattern were observedbetween control and DHICA-treated cells. Following UVA,the amount of annexin V-positive keratinocytes increased9-fold with respect to control, and DHICA significantly reducedsuch effect (Figure 4d).

    DHICA induces PPARa mRNA expression and partially actsthrough its activation

    As it has been demonstrated that activators of the nuclearhormone receptors peroxisome proliferators-activated recep-tors (PPARs) can promote keratinocyte differentiation andincrease antioxidant enzymes expression and activity (Hanleyet al., 1998; Komuves et al., 2000; Inoue et al. 2001; Mao-Qiang et al. 2004; Okuno et al., 2010), we investigatedwhether the enhanced expression of the differentiationmarkers accompanied to the induction of the antioxidantdefenses observed in DHICA-treated cells could be related toan increase in PPARs expression. qRT-PCR demonstratedthat DHICA significantly heightened the messenger RNA(mRNA) expression of PPARa isotype, whereas no inductionwas observed for PPARb/d and PPARg (Figure 5a). To validatethe hypothesis that DHICA is functioning through PPARaactivation, NHKs were transiently transfected with siRNAfor PPARa (siPPARa) or control (siCtr), and qRT-PCR analysisconfirmed that 6 hours after nucleofection, PPARa mRNAwas significantly reduced in NHKs transfected with siPPARa(Figure 5b). The analysis of Involucrin and Filaggrin mRNAexpression demonstrated that DHICA for 24 hours inducedboth genes in siCtr-cells, as expected, whereas a signi-ficant decrease of such induction was observed in NHKsinterfered for PPARa (Figure 5c). Parallel immuno-fluorescence analysis of K1 and K10 showed an increasein the expression of both keratins in siCtr keratinocytestreated with DHICA for 48 hours and a reduction in this effectwas observed in PPARa-silenced NHKs (Figure 5d and e).Taken together, this conclusively documents that PPARa isinvolved in the DHICA-mediated regulation of NHKsdifferentiation.

    6-Hydroxy-5-methoxyindole-2-carboxylic acid (6H5MICA)does not affect proliferation and differentiation of NHKs

    To assess whether the main circulating DHICA metabolite6H5MICA may exert similar biological function, we first evalu-ated keratinocyte proliferation by MTT assay upon treatmentwith increasing concentrations of 6H5MICA. No modificationin cell growth was observed at any time and doses analyzed incomparison with untreated cells (Supplementary Figure S2aonline), as supported by parallel phase contrast microscopicanalysis of the cell density (Supplementary Figure S2b online).To determine if treatment with 6H5MICA would inducekeratinocyte differentiation, we analyzed the presence ofInvolucrin, Loricrin, and Filaggrin transcripts by qRT-PCR andno differences were detected between untreated and treatedcells (Supplementary Figure S2c online). Parallel immunofluor-escence analysis of the expression of K1 showed a comparablenumber of positive NHKs in the presence or absence ofthe metabolite, further demonstrating the lack of biologicalactivity of 6H5MICA on primary keratinocytes (SupplementaryFigure S2d and e online).

    DISCUSSIONThe detailed molecular mechanisms underlying the relation-ship between melanocyte (photo)protective role and compe-tence for eumelanin synthesis have remained so far notentirely understood. Although it is clear that a dysfunction inthis pathway, secondary, e.g., to polymorphisms at the Mc1rgene, accounts for alterations in the protective capacity of thepigmentary system, the failing mechanisms have not beenelucidated at the biochemical level. A crucial gap concernsthe actual biological significance of DCT, the enzyme deputedto the formation of DHICA by dopachrome. At the chemicallevel, the deviation of the pathway of melanogenesis towardthe generation of DHICA is difficult to reconcile with thelower oxidizability and worse pigment-producing propertiesof this metabolite (Pezzella et al., 2009) compared with itsdecarboxylated counterpart, 5,6-dihydroxyindole, which isthe product of the spontaneous rearrangement of dopachromein the absence of DCT. The enzymatic activity of DCT thusraises several questions, including:

    (1) What is the purpose of deviating the spontaneous courseof the tyrosinase-catalyzed oxidation of tyrosine towardDHICA (Ito, 2009) if the ultimate function of thepathway is to produce an insoluble black pigment?

    (2) Is DHICA generated to solely regulate pigment genesisand properties, or does it serve other functions before,during, or after leakage from melanocytes?

    Here, we demonstrate the involvement of DHICA in thecross talk between melanocytes and keratinocytes throughthe induction in the latter of the antioxidant defense systemsand differentiation, suggesting that it may be the missingmediator in the protective role of eumelanin-forming mela-nocytes. DHICA may participate in the complex network ofgrowth factors and mediators, which regulate skin homeo-stasis and protection. In fact, environmental oxidative stress-ors including UV and chemicals continuously challenge the

    www.jidonline.org 1201

    D Kovacs et al.DHICA as a Paracrine-Protecting Messenger

  • 2.5*P
  • skin, and cutaneous cells are equipped with antioxidantsystems to maintain the intracellular redox balance. It hasbeen reported that differentiation of keratinocytes in cultureparallels to an increase in the antioxidants and in thetolerance to higher levels of peroxide, hypothesizing thatthis augmented capacity is a differentiated function ofkeratinocytes helping to protect against oxidative insults(Vessey et al., 1995). Our results demonstrate a contributionof DHICA to skin defenses besides the formation ofeumelanin, by its ability to activate protective mechanismsin the cells surrounding melanocytes via paracrine interac-tions, aimed to increase the resistance of all the epidermisagainst the external stimuli to which it is exposed. Themechanisms underlying these biological effects are notcompletely clear. One possible explanation could be theinduction of the nuclear hormone receptor PPARa observedin response to DHICA. In fact, its activation stimulatesepidermal differentiation in vitro and in vivo (Hanley et al.,1998; Komuves et al., 2000) by up-modulating the expressionof differentiation markers, which were induced also in ourcell model. Furthermore, activators of PPARa increase theexpression of Cu Zn SOD and catalase antioxidantenzymes in the liver and in endothelial cells (Inoue et al.,2001; Toyama et al., 2004), and receptor overexpressionelevates the activity of the two enzymes and reducesdoxorubicin-mediated reactive oxygen species formation inrenal tubular cells (Lin et al., 2007).

    In addition, the antiapoptotic effects of DHICA disclosedin this study provide a convincing explanation to the findingsby Jiang et al. (2010) that DCT inactivation in knockout miceincreases the number of apoptotic cells upon exposure tochronic UVA radiation, and by Sendoel et al. (2010), whoshowed that transcriptional upregulation of DCT mediates theantiapoptotic property of the transcription factor hypoxia-inducible factor-1.

    We therefore propose that DHICA has a more complexbiological role than so far believed, acting both as a eumelaninbuilding block imparting to the pigment an effective protectivefunction and as a diffusible chemical messenger contributingto cell protection in the overall epidermis. These effects maygain biological relevance: in fact, DHICA and other melaninintermediates such as 5,6-dihydroxyindole are contained insubcellular melanogenic compartments (Hatta et al., 1988).Under conditions characterized by increased melanogenesissuch as UV exposure or inflammatory reactions, their concen-tration markedly enhance and the local skin levels have beenestimated as high as 200mM (Koch and Chedekel, 1987). Theincreased amount of DHICA may diffuse from the producing

    melanocytes toward keratinocytes activating biological func-tions, which contribute to protect the overall skin. The possibleinvolvement of DHICA as a chemical mediator released bymelanocytes and acting on the neighboring cells have beenpreviously suggested by demonstrating that this diffusibleeumelanin intermediate increases the production of nitric oxideby LPS-activated macrophages, possibly implying its contribu-tion in epidermal inflammatory and immune responses(DAcquisto et al., 1995). Our results further support animportant role of this melanin intermediate in the cellcellinteractions, which regulate skin homeostasis under bothphysiological and pathological conditions. The lack of6H5MICA effect on keratinocyte differentiation is in linewith the reported inability of other melanin precursors tostimulate the LPS-induced production of nitric oxide bymacrophages (DAcquisto et al., 1995).

    In this perspective, DCT-dependent DHICA productionwould emerge as one of the central features of functionallyactive eumelanin-forming melanocytes. It is tempting tospeculate that the abnormal susceptibility of red-haired fair-complexioned individuals to sunburn and skin cancer is duenot only to the lack of photoprotective eumelanin and to theprooxidant and photosensitizing properties of pheomelanin,but also to the failure of loss of function of Mc1r-carryingmelanocytes to produce sufficient levels of DHICA as keymediator in cell-protecting mechanisms. Besides providingadditional insights into melanocytekeratinocyte cross talk,these results may contribute to an understanding of the anti-oxidant, antiapoptotic, and photoprotective effects currentlyattributed to DCT (Jiang et al., 2010; Panzella et al., 2011)and concur to expand the scope of melanogenesisbeyond pigmentation and related visually perceivable phe-nomena.

    MATERIALS AND METHODSCell cultures and treatments

    Primary cultures of NHKs were isolated and grown as previously

    described (Kovacs et al., 2010). For each experiment at least

    three different donors were used. To evaluate cell differentiation,

    NHKs were maintained in growth factor-free medium. For calcium-

    mediated differentiation, calcium concentration was switched to

    1.2 mM.

    DHICA was prepared by oxidation of 3,4-dihydroxy-L-phenyl-

    alanine according to a reported procedure (Edge et al., 2006).

    6H5MICA was prepared as described in Wakamatsu and Ito (1988).

    Both compounds were dissolved in DMSO. Control keratinocytes

    were treated with DMSO at the volume equals to that present in

    DHICA- and 6H5MICA-treated cells.

    Figure 5. 5,6-Dihydroxyindole-2-carboxylic acid (DHICA) induces peroxisome proliferator-activated receptor (PPAR)a messenger RNA (mRNA)expression and partially acts through its activation. (a) Expression of PPARa, PPARb/d, and PPARg mRNA evaluated by quantitative real-time reversetranscriptasePCR (qRT-PCR) after 6 hours of treatment with DHICA. Values are normalized against the expression of glyceraldehyde-3-phosphate

    dehydrogenase (GAPDH) and are expressed relative to untreated cells. (b) PPARa mRNA level evaluated by qRT-PCR on normal human keratinocytes (NHKs)transfected with siRNA specific for PPARa (siPPARa) or nonspecific siRNA (siCtr). (c) Involucrin and Filaggrin mRNA expression evaluated by qRT-PCR in NHKstransfected with siPPARa or siCtr, and treated for 24 hours with DHICA. Values are normalized against the expression of GAPDH and are expressed relativeto untreated control cells. (d, e) Immunofluorescence with anti-K1 and anti-K10 antibodies of NHKs transfected with siPPARa or siCtr following treatmentwith DHICA for 48 hours and corresponding quantitative analysis of the percentage of positive cells. Bar 20mm. DAPI, 4-6-diamidino-2-phenylindole.

    www.jidonline.org 1203

    D Kovacs et al.DHICA as a Paracrine-Protecting Messenger

  • For UVA irradiation, NHKs were incubated in medium without

    phenol-red and irradiated at a dose of 10 J cm2 using a Bio-Sunirradiation apparatus (Vilbert Lourmat, Marne-la-Vallee, France)

    with maximum emission at 365 nm in the UVA spectral region

    (340450 nm).

    The study was approved by the Medical Ethical Committee of the

    San Gallicano Dermatologic Institute and was conducted according

    to the Declaration of Helsinki Principles. Participants gave their

    written informed consent.

    MTT assay

    Cells were incubated with MTT (1 mg ml1) for 2 hours at 371C andlysed in DMSO. The absorbance at 570 nm was measured by

    a spectrophotometer mQUANT (Biotek Instruments, Winooski, VT).Results represent the mean valueSD from three different experi-

    ments in quadruplicate.

    Cell viability

    Cells were harvested by incubation in 0.5% trypsin and 0.2% EDTA,

    and cell viability was measured by Trypan blue exclusion assay.

    Real-time RT-PCRTotal RNA was isolated and processed as previously described

    (Flori et al., 2011). Sequences of the primers used are indicated

    in Table 1.

    RNA interference experiments

    For the RNA interference experiments, NHKs were transfected with

    100 pmols siRNA (h) specific for PPARa (sc-36307; Santa CruzBiotechnology, Santa Cruz, CA). An equivalent amount of non-

    specific siRNA (sc-44234; Santa Cruz Biotechnology) was used

    as a negative control. Cells were transfected as previously described

    (Flori et al., 2011). The results represent the average of two

    independent experiments.

    For immunocytochemical and immunofluorescence staining

    method see Supplementary Information online.

    Enzymatic antioxidant activities

    Enzymatic activities were determined on the supernatants, by a

    Lambda 25 UV/Vis spectrophotometer (Perkin-Elmer, London, UK).

    SOD activity was evaluated according to the method of Spitz and

    Oberley (1989). Catalase activity was determined as previously

    described (Maresca et al., 2010). Results are reported as mean

    valuesSD from two different experiments in triplicate and

    expressed as U mg1 protein.

    Western blot analysis

    Cells were lysed and processed as previously reported (Flori et al.,

    2011). Membranes were incubated with anti-Cu Zn SODpolyclonal antibody (1:1,000) (SOD-110 Stressgen Biotechnologies,

    Victoria, BC, Canada) or anti-catalase mAb (1:1,000) (Sigma-Aldrich

    Srl, Milan, Italy). b-tubulin (1:10,000) (Sigma-Aldrich) was used toestimate the protein equal loading. Densitometric analysis was

    performed using GS-800 Calibrated Image Densitometer (Bio-Rad

    Laboratories Srl, Milan, Italy).

    For flow cytometry and membrane fatty-acid analysis methods

    see Supplementary Information online.

    Statistical analysis

    Statistically significant differences were calculated using the

    Students t-test. The minimal level of significance was Po0.05.

    CONFLICT OF INTERESTThe authors state no conflict of interest.

    ACKNOWLEDGMENTSThis work was partially supported by the grant onc-ord/32/07 from Ministerodella Salute, Italy.

    SUPPLEMENTARY MATERIAL

    Supplementary material is linked to the online version of the paper at http://www.nature.com/jid

    REFERENCES

    Alani RM, Hasskarl J, Grace M et al. (1999) Immortalization of primaryhuman keratinocytes by the helixloophelix protein, Id-1. PNAS96:963741

    Baker SS, Baker RD Jr (1992) Antioxidant enzymes in the differentiatedCaco-2 cell line. In Vitro Cell Dev Biol 28A:6437

    Table 1. Primers used for the real-time reversetranscriptasePCR analysis

    Oligonucleotide sequences (5030)Exon

    numberAmpliconsize (bp)

    Filaggrin

    Sense: GAAGACAAGGATCGCACCAC

    antisense: ATGGTGTCCTGACCCTCTTG

    3 76

    GAPDH

    Sense: TGCACCACCAACTGCTTAGC

    antisense: GGCATGGACTGTGGTCATGAG

    9 198

    Involucrin

    Sense: ACCCATCAGGAGCAAATGAAA

    antisense: TGCCAGAAGGTGCCT

    2 59

    Loricrin

    Sense: TCATGATGCTACCCGAGGTTTG

    antisense: CAGAACTAGATGCAGCCGGAGA

    2 87

    PPARa

    Sense TCATCAAGAAGACGGAGTCG

    antisense: CGGTTACCTACAGCTCAGAC

    9 211

    PPARb/d

    Sense TGACCTGCGGCAACTGG

    antisense: AGCGGATCAAGAAGACCGAA

    8 61

    PPARg

    Sense: GCCAAGCTGCTCCAGAAAAT

    antisense: TGATCACCTGCAGTAGCTGCA

    10 73

    1204 Journal of Investigative Dermatology (2012), Volume 132

    D Kovacs et al.DHICA as a Paracrine-Protecting Messenger

  • Bikle DD, Ratnam A, Mauro T et al. (1996) Changes in calcium respon-siveness and handling during keratinocyte differentiation. Potential roleof the calcium receptor. J Clin Invest 97:108593

    Costin GE, Valencia JC, Wakamatsu K et al. (2005) Mutations in dopachrometautomerase (Dct) affect eumelanin/pheomelanin synthesis, but do notaffect intracellular trafficking of the mutant protein. Biochem J391:24959

    DAcquisto F, Carnuccio R, dIschia M et al. (1995) 5,6-Dihydroxyindole-2-carboxylic acid, a diffusible melanin precursor, is a potent stimulator oflipopolysaccharide-induced production of nitric oxide by J774 macro-phages. Life Sci 57:PL4016

    Edge R, dIschia M, Land EJ et al. (2006) Dopaquinone redox exchange withdihydroxyindole and dihydroxyindole carboxylic acid. Pigment Cell Res19:44350

    Flori E, Mastrofrancesco A, Kovacs D et al. (2011) 2,4,6-Octatrienoic acid is anovel promoter of melanogenesis and antioxidant defence in normalhuman melanocytes via PPAR-g activation. Pigment Cell Melanoma Res24:61830

    Fuchs E (1990) Epidermal differentiation: the bare essentials. J Cell Biol111:280714

    Gauden M, Pezzella A, Panzella L et al. (2008) Role of solvent, pH, andmolecular size in excited-state deactivation of key eumelanin buildingblocks: implications for melanin pigment photostability. J Am Chem Soc130:1703843

    Guyonneau L, Murisier F, Rossier A et al. (2004) Melanocytes andpigmentation are affected in dopachrome tautomerase knockout mice.Mol Cell Biol 24:3396403

    Hanley K, Jiang Y, He SS et al. (1998) Keratinocyte differentiation isstimulated by activators of the nuclear hormone receptor PPARalpha.J Invest Dermatol 110:36875

    Hatta S, Mishima Y, Ichihashi M et al. (1988) Melanin monomers withincoated vesicles and premelanosomes in melanin synthesizing cells.J Invest Dermatol 91:1814

    Imokawa G (2004) Autocrine and paracrine regulation of melanocytesin human skin and in pigmentary disorders. Pigment Cell Res 17:96110

    Inoue I, Goto S, Matsunaga T et al. (2001) The ligands/activatorsfor peroxisome proliferator-activated receptor alpha (PPARalpha) andPPARgamma increase Cu2+,Zn2+-superoxide dismutase and decreasep22phox message expressions in primary endothelial cells. Metabolism50:311

    Ito S (2009) Melanins seem to be everywhere in the body, but for what?Pigment Cell Melanoma Res 22:123

    Jiang S, Liu XM, Dai X et al. (2010) Regulation of DHICA-mediatedantioxidation by dopachrome tautomerase: implication for skinphotoprotection against UVA radiation. Free Radic Biol Med 48:114451

    Jiao Z, Zhang ZG, Hornyak TJ et al. (2006) Dopachrome tautomerase(Dct) regulates neural progenitor cell proliferation. Dev Biol 296:396408

    Koch WH, Chedekel MR (1987) Photochemistry and photobiology ofmelanogenic metabolites: formation of free radicals. Photochem Photo-biol 46:22938

    Komuves LG, Hanley K, Lefebvre AM et al. (2000) Stimulation of PPARalphapromotes epidermal keratinocyte differentiation in vivo. J InvestDermatol 115:35360

    Kovacs D, Cardinali G, Aspite N et al. (2010) Role of fibroblast-derivedgrowth factors in regulating hyperpigmentation of solar lentigo. Br JDermatol 163:10207

    Lin H, Hou CC, Cheng CF et al. (2007) Peroxisomal proliferator-activatedreceptor-alpha protects renal tubular cells from doxorubicin-inducedapoptosis. Mol Pharmacol 72:123845

    Mao-Qiang M, Fowler AJ, Schmuth M et al. (2004) Peroxisome-proliferator-activated receptor (PPAR)-c activation stimulates keratinocyte differen-tiation. J Invest Dermatol 123:30512

    Maresca V, Flori E, Bellei B et al. (2010) MC1R stimulation by alpha-MSHinduces catalase and promotes its re-distribution to the cell peripheryand dendrites. Pigment Cell Melanoma Res 23:26375

    Memoli S, Napolitano A, dIschia M et al. (1997) Diffusible melanin-relatedmetabolites are potent inhibitors of lipid peroxidation. Biochim BiophysActa 1346:618

    Michard Q, Commo S, Belaidi JP et al. (2008) TRP-2 specifically decreasesWM35 cell sensitivity to oxidative stress. Free Radic Biol Med 44:102331

    Novellino L, dIschia M, Prota G (1998) Nitric oxide-induced oxidation of5,6-dihydroxyindole and 5,6-dihydroxyindole-2-carboxylic acid underaerobic conditions: non-enzymatic route to melanin pigments ofpotential relevance to skin (photo)protection. Biochim Biophys Acta1425:2735

    Novellino L, Napolitano A, Prota G (1999) 5,6-Dihydroxyindoles in thefenton reaction: a model study of the role of melanin precursors inoxidative stress and hyperpigmentary processes. Chem Res Toxicol12:98592

    Okuno Y, Matsuda M, Miyata Y et al. (2010) Human catalase gene isregulated by peroxisome proliferator activated receptor-gammathrough a response element distinct from that of mouse. Endocr J57:3039

    Pak BJ, Lee J, Thai BL et al. (2004) Radiation resistance of human melanomaanalysed by retroviral insertional mutagenesis reveals a possible role fordopachrome tautomerase. Oncogene 23:308

    Panzella L, Napolitano A, dIschia M (2011) Is DHICA the key to dopachrometautomerase and melanocyte functions? Pigment Cell Melanoma Res24:2489

    Pezzella A, Panzella L, Crescenzi O et al. (2009) Lack of visible chromophoredevelopment in the pulse radiolysis oxidation of 5,6-dihydroxyindole-2-carboxylic acid oligomers: DFT investigation and implications foreumelanin absorption properties. J Org Chem 74:372734

    Prota G (2000) Melanins, melanogenesis and melanocytes: looking at theirfunctional significance from the chemists viewpoint. Pigment Cell Res13:28393

    Reiners JJ Jr, Hale MA, Cantu AR (1988) Distribution of catalase and itsmodulation by 12-O-tetradecanoylphorbol-13-acetate in murine dermisand subpopulations of keratinocytes differing in their stages of differ-entiation. Carcinogenesis 9:125963

    Salinas C, Garca-Borron JC, Solano F et al. (1994) Dopachrome tautomerasedecreases the binding of indolic melanogenesis intermediates toproteins. Biochim Biophys Acta 1204:5360

    Sendoel A, Kohler I, Fellmann C et al. (2010) HIF-1 antagonizes p53-mediated apoptosis through a secreted neuronal tyrosinase. Nature465:57783

    Slominski A, Tobin DJ, Shibahara S et al. (2004) Melanin pigmentation inmammalian skin and its hormonal regulation. Physiol Rev 84:1155228

    Spitz DR, Oberley LW (1989) An assay for superoxide dismutase activity inmammalian tissue homogenates. Anal Biochem 179:818

    Toyama T, Nakamura H, Harano Y et al. (2004) PPARalpha ligands activateantioxidant enzymes and suppress hepatic fibrosis in rats. BiochemBiophys Res Commun 324:697704

    Vessey DA, Lee KH, Boyer TD (1995) Differentiation-induced enhancementof the ability of cultured human keratinocytes to suppress oxidativestress. J Invest Dermatol 104:3558

    Wakamatsu K, Ito S (1988) Preparation of eumelanin-related metabolites5,6-dihydroxyindole, 5,6-dihydroxyindole-2-carboxylic acid, and theirO-methyl derivatives. Anal Biochem 170:33540

    Yohn JJ, Norris DA, Yrastorza DG et al. (1991) Disparate antioxidant enzymeactivities in cultured human cutaneous fibroblasts, keratinocytes, andmelanocytes. J Invest Dermatol 97:4059

    Zhang X, Erb C, Flammer J et al. (2000) Absolute rate constants for thequenching of reactive excited states by melanin and related 5,6-dihydroxyindole metabolites: implications for their antioxidant activity.Photochem Photobiol 71:52433

    www.jidonline.org 1205

    D Kovacs et al.DHICA as a Paracrine-Protecting Messenger

    The Eumelanin Intermediate 5,6-Dihydroxyindole-2-Carboxylic Acid Is a Messenger in the Cross-Talk among Epidermal CellsIntroductionFigure 1 Normal human keratinocyte (NHK) growth in response to 5,6-dihydroxyindole-2-carboxylic acid (DHICA).(a) Cell growth evaluated by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide assay.Figure 2 5,6-Dihydroxyindole-2-carboxylic acid (DHICA) stimulates normal human keratinocyte (NHK) differentiation.(a) Messenger RNA transcript levels of Involucrin, Loricrin, and Filaggrin evaluated by quantitative real-time reverse transcriptase-PCR afteResultsDHICA inhibits cell growthDHICA induces the expression of differentiation markers

    Figure 3 5,6-Dihydroxyindole-2-carboxylic acid (DHICA) increases the activity and protein expression of intracellular enzymatic antioxidants.Superoxide dismutase (SOD) (a) and catalase (b) enzymatic activities on normal human keratinocytes treated with inDHICA induces activity and expression of antioxidant enzymesDHICA protects against UVA-induced cell damages and death

    Figure 4 5,6-Dihydroxyindole-2-carboxylic acid (DHICA) counteracts reactive oxygen species-induced cell damage and death following UVA irradiation.(a) Viability of primary keratinocytes irradiated with UVA 10thinspJthinspcm-2 after DHICA pretreatment (5 aDHICA induces PPARalpha mRNA expression and partially acts through its activation6-Hydroxy-5-methoxyindole-2-carboxylic acid (6H5MICA) does not affect proliferation and differentiation of NHKs

    DiscussionMaterials and MethodsCell cultures and treatments

    Figure 5 5,6-Dihydroxyindole-2-carboxylic acid (DHICA) induces peroxisome proliferator-activated receptor (PPAR)alpha messenger RNA (mRNA) expression and partially acts through its activation.(a) Expression of PPARalpha, PPARbetasoldelta, and PPARgamma mRMTT assayCell viabilityReal-time RT-PCRRNA interference experimentsEnzymatic antioxidant activitiesWestern blot analysisStatistical analysis

    CONFLICT OF INTERESTACKNOWLEDGMENTSSUPPLEMENTARY MATERIALREFERENCESTable 1 Primers used for the real-time reverse transcriptase-PCR analysis