Click here to load reader

SUPPLEMENTAL FIGURE LEGENDS Supplemental · PDF fileSUPPLEMENTAL FIGURE LEGENDS Supplemental Fig. 1. ... Schematic representation of zebrafish ATX gene with exons ... LPA 1 MO caused

  • View
    221

  • Download
    0

Embed Size (px)

Text of SUPPLEMENTAL FIGURE LEGENDS Supplemental · PDF fileSUPPLEMENTAL FIGURE LEGENDS Supplemental...

  • 1

    SUPPLEMENTAL FIGURE LEGENDS Supplemental Fig. 1. Sequence analysis of the zebrafish ATX. (A) Amino acid sequences of human, mouse and zebrafish ATXs. The catalytic center is indicated by the red triangle. (B) Phylogenic analysis of NPP family in human, mouse and zebrafish. Zebrafish ATX (zgc:63550) is localized in the cluster of atx/npp2. Supplemental Fig. 2. ATX expression was attenuated by morpholino antisense oligonucleotides (MOs). (A) Schematic representation of zebrafish ATX gene with exons represented as black boxes. The positions of the morpholinos employed in this study are indicated by gray bars above exons 2 and 4, and the position of primers used for the RT-PCR analysis are indicated by arrows. (B) ATX MO1 caused the deletion of exon 2 and resulted in a 160-bp PCR fragment compared to the intact 263-bp fragment in ATX MO1 5-mis MO-injected embryos. (C) ATX MO2 caused the partial deletion of exon 4 and resulted in a 500-bp PCR fragment compared to the intact 514-bp fragment in untreated embryos. Supplemental Fig. 3. Sequence analysis of the zebrafish LPA receptors. (A) Amino acid sequences of human, mouse and zebrafish LPA2-6 receptors. (B) Phylogenic analysis of LPA receptors in human, mouse and zebrafish. Supplemental Fig. 4. Each LPA receptor expression was attenuated by MOs. (A-D) Blocking of splicing by MOs was confirmed by RT-PCR. (A) LPA1 MO caused the deletion of exon 2 and resulted in a 453-bp PCR fragment compared to the intact 1208-bp fragment in untreated embryos as shown previously (28). (B) LPA2a MO caused the deletion of exon 2 and resulted in a 456-bp PCR fragment compared to the intact 1382-bp fragment in untreated embryos. (C) LPA2b MO caused the deletion of exon 2 and resulted in a 476-bp PCR fragment compared to the intact 897-bp fragment in untreated embryos. (D) LPA3 MO caused the partial deletion of exon 2 and resulted in a 819-bp PCR fragment compared to the intact 937-bp fragment in untreated embryos. (E-I) Translation blocking induced by MOs. Each MO against LPA4, LPA5a, LPA5b, LPA6a or LPA6b inhibited the translation of the egfp gene cloned downstream of the 5-UTR of LPA4, LPA5a, LPA5b, LPA6a or LPA6b containing the target sequence of each MO respectively. Scale bar: 200 m. Supplemental Fig. 5. Effects of LPA1/LPA4 double MOs on vascular formation. Confocal images of fli1:EGFP embryos injected with LPA4 MO2 alone (A) and LPA1 MO with LPA4 MO2 (B) at 48 hpf. Lateral views, anterior to the left. Embryos injected with LPA4 MO2 did not show vascular defects, whereas embryos injected with both LPA1 MO and LPA4 MO2 showed severe vascular defects such as stalling (asterisk) and abnormal connection around horizontal myoseptum of SA (arrowhead) that were identical to those in ATX morphant embryos. Scale bar: 50 m.

  • Supplemental Fig. 1

    C

    mN

    pp4

    mNpp6

    mN

    pp7

    hNPP

    4

    zNpp2/zATX

    (zgc:63550)

    zNpp5

    zNpp

    7b

    hNPP1

    mNpp1

    A

    Human Mouse

    Zebrafish (zgc:63550)

    60 59 55

    120 119 115

    180 179 175

    240 240 235

    300 300 295

    360 360 355

    420 420 415

    480 480 474

    540 540 534

    600 600 588

    660 660 648

    720 720 708

    780 780 767

    840 839 827

    863 862 850

    B

  • Supplemental Fig. 2

    514bp263bpfw1-rv1

    GAPDH

    160bpfw2-rv2

    GAPDH

    A MO1 MO2

    fw1 primer (exon1)

    fw2 primer (exon2) rv2 primer (exon6)

    rv1 primer (exon3)

    1 2 4 5 6 253

    1 kb

    500bp

    B C

  • A human LPA2 mouse LPA2 zebrafish LPA2azebrafish LPA2b

    human LPA5 mouse LPA5 zebrafish LPA5azebrafish LPA5b

    human LPA3 mouse LPA3 zebrafish LPA3

    human LPA4 mouse LPA4 zebrafish LPA4

    human LPA6 mouse LPA6 zebrafish LPA6azebrafish LPA6b

    mLPA4 hLPA4

    zLPA3 mLPA1 hLPA1

    zLPA5b

    mLPA

    6

    zLPA

    2b

    zLPA

    6a B

    Supplemental Fig. 3

  • Exon 1 Exon 2 Exon 3

    E 1 E 2 E 3Normal :

    Exon 1 Exon 2 Exon 3

    E 1 E 2 E 3Normal :

    E 1 E 7

    Normal :

    E1 E2 E3

    E1 E 2 E 3Normal :

    897bp

    1208bp

    937bp

    E 1 E 3MO treated :

    GAPDH

    453bp

    E 2 E 3

    476bp

    E 4 E 5E 6

    E1 E 2 E 3MO treated :

    819bp

    E 1 E 3MO treated :

    MO treated :

    fw primer rv primer fw primer rv primer

    fw primer rv primer fw primer rv primer

    GAPDH

    E 1 E 7E 2 E 3 E 4E 5E 6

    E 1 E 7E 3 E 4E 5E 6

    GAPDH GAPDH

    1382bp

    456bp

    LPA2b MO LPA3 MO

    LPA1 MO LPA2a MO

    A B

    C D

    Supplemental Fig. 4

  • Phenol red LPA4 MO1

    LPA4-EGFP mRNA (24 hpf)

    Phenol red LPA6a MO Phenol red LPA6b MO

    LPA4 MO2

    LPA6a-EGFP mRNA (24 hpf) LPA6b-EGFP mRNA (24 hpf)

    E

    H I

    Supplemental Fig. 4

    Phenol red LPA5a MO Phenol red LPA5b MO

    LPA5a-EGFP mRNA (24 hpf) LPA5b-EGFP mRNA (24 hpf)F G

  • LPA1 MO + LPA4 MO2

    LPA4 MO2

    * B

    A

    Supplemental Fig. 5

  • Supplemental Table 1

    The list of oligonucleotides used for cloning ATX and LPA receptors

    forward primer reverse primer

    zATX 1st AGAGAGCCACCAGACGCACGTCAAC ACCTTGGACATGCTAATGCAGGGAG

    zATX 2nd(pBluescript) GGGGTACCACCATGCTGCAACTTAAATGGGTATTC GAATTCTCAGATCTCACTTTCGTATGTGTGC

    zATX(pCAGGS-MCS-

    myc) GGAATTCCACCATGCTGCAACTTAAATGGGTATTC AAAACTCGAGGATCTCACTTTCGTATGTGTGCAAG

    zATX (T205A) GGGTACCACCATGCTGCAACTTAAATGGGTATTC, GTACCCTACAAAAGCCTACCCAAATTTG CAAATTTGGGTAGGCTTTTGTAGGGTAC,

    CCAATCACCTTATCAACATCCC LPA1 1st ACAGAGCCGAGCAACAATC CCTGCTGGTTTATTACGTGAG

    LPA1 2nd AAGGATGATAGACAATGCTAC CGGGGTACCTCAGACCACTGAATGGTCATTATG

    LPA2a 1st AAACGGGCAGATGGACTTC CAGGGAGAAATGGTTTTTCCATC

    LPA2a 2nd AAGGTATTTAACAGCTGTGAG CGGGGTACCTCAAGACAATGGGCTTTGTG

    LPA2b 1st CCAATCACTGACCTCTGAGAC CTTTCAAGTCAAGGTCTCCAAATC

    LPA2b 2nd AAGGTTTGCTACAACAACGAGAC CGGGGTACCTTCAGCTGTCGCTGGACTC

    LPA3 1st GTCCTAGTGGGTTTTGTCCAAAG TCTCACCTGCAGCAGGATTG

    LPA3 2nd AAGGCCAGGCACAACATCTGCTAC CGGGGTACCTCAGGACTTGAGCATCTCCTG

    LPA4 1st AACAGGAGTACATCTACTGCAAG TGCTCTGTGAAAGGGTTTCACTG

    LPA4 2nd AAGGCCAGTCTTGTTCTTAATGAG CGGGGTACCTCAGAACTGAGTCTCACCAAC

    LPA5a 1st CAACACAGCACTTCTCTTAAACAC GTTTGGTTCTTCTTGCGTAACC

    LPA5a 2nd AAGACTTCAAACAACACTACAGTC CGGGGTACCGGTTCTTTATTGTCCAGTCCAAC

    LPA5b 1st CGGAACACCTTTAACCCAG CTTAGGAGCTCCGTAGAAAC

    LPA5b 2nd AAGAATCAAAACTTCACCAACAC CGGGGTACCCAGCTGGTCAAGACCTATC

    LPA6a 1st CGACTTCTGCGGAGAGGATTG CCCTATAAGAGCCCACCGTTTAC

    LPA6a 2nd AAGTACAATACAAGTCTTGAGATGG CGGGGTACCCCTCATACGTGGGACTCATTG

    LPA6b 1st GCAACCTCTGAACGGTAAGAC GTTATCAGTCTGCTATATCCTGTCC

    LPA6b 2nd AAGATGACTGAGAGGAGCAACTG CGGGGTACCCCTATTTGCTGTGTGATCTTTGG

    The recognition sites for restriction endonucleases used for cloning are underlined.

  • Supplemental Table 2

    forward primer forward primer

    LPA1 MO GCGAGTGATTTCTGGACCTTTCAGC GCCTTTTTCACAGTCTCTTCTTGCG

    LPA2a MO CCAGATGAAGAGCGTTTCC CAGGGAGAAATGGTTTTTCCATC

    LPA2b MO TGAGACTCGATTCCCTGAG GACGACGGTCTTCATCAG

    LPA3 MO 1st ATGGAGAGTGAACCGAGAAC CGGGGTACCTCAGGACTTGAGCATCT

    LPA3 MO 2nd ATGGAGAGTGAACCGAGAAC ATGGGGTTCATGACGGAGTTG

    ATX MO 1 1st GTGCCGAGGTTTGAGTAG ACAGTGGTCATCAAAGTCTG

    ATX MO 1 2nd TCGTTCAGTGTGGAAGAGAG ACAGGTTGTCACAGCGAC

    ATX MO 2 1st AGTAGTCGTTCAGTGTGGAAGAGAG TCAGGATAAAGCCCCGTTG

    ATX MO 2 2nd TCCGTTATGTGGCTTTTCTCA ACCGTGCCTCCTCTTTTCA

Search related