TGF-b receptor-mediated albumin uptake into astrocytes is involved in neocortical epileptogenesis

doi:10.1093/brain/awl317 Brain (2007), 130, 535–547

TGF-b receptor-mediated albumin uptake intoastrocytes is involved in neocorticalepileptogenesis

Sebastian Ivens,1 Daniela Kaufer,3,4 Luisa P Flores,3 Ingo Bechmann,2 Dominik Zumsteg,5

Oren Tomkins,6 Ernst Seiffert,1 Uwe Heinemann1 and Alon Friedman1,6

1Institute of Neurophysiology, 2Center of Anatomy, Charite University Medicine, Berlin, Germany, 3Department ofIntegrative Biology and 4Helen Wills Neuroscience Institute, UC Berkeley, Berkeley, CA, USA, 5Krembil NeuroscienceCentre, Toronto Western Hospital, University of Toronto, Toronto, ON, Canada and 6Departments of Physiology andNeurosurgery, Zlotowski Center for Neuroscience, Ben-Gurion University of the Negev, Beer-Sheva, Israel

Correspondence to: Dr Alon Friedman, Departments of Physiology and Neurosurgery, Soroka University Medical Centreand Zlotowski Center for Neuroscience, Ben-Gurion University, Beer-Sheva 84105, IsraelE-mail: [email protected]

It has long been recognized that insults to the cerebral cortex, such as trauma, ischaemia or infections, mayresult in the development of epilepsy, one of the most common neurological disorders. Human and animalstudies have suggested that perturbations in neurovascular integrity and breakdown of the blood–brain barrier(BBB) lead to neuronal hypersynchronization and epileptiform activity, but the mechanisms underlying theseprocesses are not known. In this study, we reveal a novel mechanism for epileptogenesis in the injured brain.We used focal neocortical, long-lasting BBB disruption or direct exposure to serum albumin in rats (51 and13 animals, respectively, and 26 controls) as well as albumin exposure in brain slices in vitro. Most treated slices(72%, n = 189) displayed hypersynchronous propagating epileptiform field potentials when examined 5–49 daysafter treatment, but only 14% (n = 71) of control slices showed similar responses. We demonstrate that directbrain exposure to serum albumin is associated with albumin uptake into astrocytes, which is mediatedby transforming growth factor b receptors (TGF-bRs). This uptake is followed by down regulation of inward-rectifying potassium (Kir 4.1) channels in astrocytes, resulting in reduced buffering of extracellular potassium.This, in turn, leads to activity-dependent increased accumulation of extracellular potassium, resulting infacilitated N-methyl-D-aspartate-receptor-mediated neuronal hyperexcitability and eventually epileptiformactivity. Blocking TGF-bR in vivo reduces the likelihood of epileptogenesis in albumin-exposed brains to 29.3%(n = 41 slices, P < 0.05). We propose that the above-described cascade of events following common brain insultsleads to brain dysfunction and eventually epilepsy and suggest TGF-bRs as a possible therapeutic target.

Keywords: astrocytes; blood–brain barrier; epileptogenesis; neocortex; transforming growth factor beta receptors

Abbreviations: ACSF¼ artificial CSF; BBB¼ blood–brain barrier; DOC¼ deoxycholic acid; FITC¼ fluorescein isothiocyanate;GFAP ¼ glial fibrillary acidic protein; [K+]o ¼ extracellular potassium concentration; NMDA ¼ N-methyl-D-aspartate;TGF-bRs ¼ transforming growth factor b receptors

Received June 8, 2006. Revised September 19, 2006. Accepted October 14, 2006. Advance Access publication November 21, 2006.

IntroductionEpilepsy, affecting 0.5–2% of the population worldwide, is

one of the most common neurological disorders. While the

characteristic electrical activity in the epileptic cortex has

been extensively studied, the mechanisms underlying

epileptogenesis are still poorly understood. Focal neocortical

epilepsy often develops following traumatic, ischaemic or

infectious brain injury. Under these conditions, vasculature

damage is common and includes a local compromise of the

� 2006 The Author(s).This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

by guest on March 18, 2016

http://brain.oxfordjournals.org/D

ownloaded from

http://creativecommons.org/licenses/

http://brain.oxfordjournals.org/

blood–brain barrier (BBB; Tomkins et al., 2001; Neuwelt,

2004; Abbott et al., 2006). Ultrastructural studies of human

epileptic tissue demonstrating increased micropinocytosis

and fewer mitochondria in endothelial cells, a thickening of

the basal membrane, and abnormal tight junctions further

support the notion of lasting BBB dysfunction in at least

some forms of epilepsy (Kasantikul et al., 1983; Cornford

and Oldendorf, 1986; Cornford, 1999). Indeed, clinical and

animal studies showed that vascular damage and, specifi-

cally, opening of the BBB is often observed in epileptic brain

regions, but was generally believed to result from the seizure

activity, rather than contribute to its generation (Cornford,

1999). However, conversely to that option, we have observed

in some post-traumatic patients a long-lasting BBB opening

corresponding to abnormal cortical function as revealed by

EEG analyses (Korn et al., 2005). These observations led us

to hypothesize that BBB dysfunction may have a direct role

in the pathogenesis of epilepsy. Supporting this hypothesis

of primary BBB lesions as an initial event leading to

neocortical epilepsy, we demonstrated that opening of the

BBB in the rat somatosensory cortex exposes the secluded

brain microenvironment to serum components, resulting in

the delayed development of epileptiform activity (Seiffert

et al., 2004). However, the mechanisms underlying cortical

dysfunction following BBB injury are unknown. Here we

have set out to elucidate these mechanisms, in an animal

model of BBB disruption.

Experimental evidence suggests that astrocytes display

modified properties in epileptic tissue from human and

animal (Pollen and Trachtenberg, 1970; Bordey and

Sontheimer, 1998; Hinterkeuser et al., 2000; Jauch et al.,

2002; Eid et al., 2005) and are likely to play a key role in the

pathogenesis of epilepsy (Seifert et al., 2006). Since astrocytes

are known to be contributors to BBB formation (Ballabh

et al., 2004) and enhanced immunolabelling against the

astrocytic marker, glial fibrillary acidic protein (GFAP), is

observed to follow a breach in the integrity of the BBB

(Seiffert et al., 2004), we hypothesized that these cells may

play a role in epileptogenesis after BBB disruption.

In this study, we investigated the mechanisms underlying

epileptogenesis induced by BBB opening. We demonstrate

for the first time in a rat model the role played by astrocytes

in epileptogenesis and propose a cascade of events that takes

place during the window period of epileptogenesis, i.e. after

BBB opening and before the development of epileptiform

activity. Surprisingly, we have identified transforming

growth factor b receptor (TGF-bR) as a key player in the

cellular response, and demonstrate an effective blockade of

the cascade, and the resulting epileptiform activity, by

blocking TGF-bRs.

Material and methodsIn vivo experimentsAll experimental procedures were approved by the ethical commit-

tees dealing with experiments on animals at Charite University

Medicine, Berlin and Ben-Gurion University of the Negev,

Beer-Sheva. The in vivo experiments were performed as described

previously in Wistar rats (Seiffert et al., 2004). For the ‘treated rats’,

we added to the artificial CSF (ACSF) the BBB-disrupting agent

deoxycholic acid sodium salt (DOC, 2 mM, Sigma-Aldrich,

Steinheim, Germany) or bovine serum albumin (BSA, 0.1 mM,

>98% in agarose-cell electrophoresis; Merck, Darmstadt, Germany,

ordering number 1.12018.0025), corresponding to 25% of serum

albumin concentration (0.4 mM determined for 10 rats, see also

Geursen and Grigor, 1987; osmolarity 303–305 mOsmol/l). ACSF

alone was applied to the sham-operated controls. The composition

of the ACSF was (in mM): 129 NaCl, 21 NaHCO3, 1.25 NaH2PO4,

1.8 MgSO4, 1.6 CaCl2, 3 KCl, 10 glucose. In some experiments, the

cortex was exposed (30 min) to ACSF containing the TGF-bR1

kinase activity inhibitor SB431542 (100 mM, Tocris, Bristol, UK) in

dimethyl sulphoxide (DMSO, 0.1%, Merck) and TGF-bR2

antibody (50 mg/ml, Santa Cruz Biotechnology, Santa Cruz, USA)

and subsequently exposed to BSA (0.1 mM) for 30 min. The

control brains for these experiments were superfused with ACSF

containing 0.1% DMSO, followed by ACSF with DMSO and BSA

(0.1 mM).

In vitro slice preparationBrain slices were prepared by standard techniques (Kaufer et al.,

1998; Pavlovsky et al., 2003; Seiffert et al., 2004). To study albumin

uptake, slices were incubated in a submerged chamber containing

ACSF with 0.004–0.1 mM fluorescein isothiocyanate (FITC)-

conjugated albumin (Sigma-Aldrich, Germany, osmolarity 311–

312 mOsmol/l) for 5–60 min. In some experiments, slices were

incubated with non-labelled BSA (0.004, 0.04 and 0.4 mM,

osmolarity 308–311 mOsmol/l) in the presence of FITC-albumin,

with 0.004–0.04 mM FITC-labelled dextran (70 kDa, Sigma-

Aldrich) or with 0.04 mM Texas-Red-conjugated ovalbumin

(Invitrogen, Karlsruhe, Germany). To block TGF-bRs, slices were

incubated (60 min) in ACSF containing SB431542 (in DMSO) or

with TGF-bR2 antibody. FITC-albumin (0.004 mM) was then

added, and the slices were incubated for another 25 min. Following

incubation, slices were washed with oxygenated ACSF (30 min) in a

submerged chamber and prepared for histological analysis

(see below).

Electrophysiological recordingsFor electrophysiological recordings, we used brain slices prepared

as mentioned above. Following the slicing procedure slices were

transferred immediately to the recording chamber, maintained

at 36�C, as reported previously from our laboratory (Seiffert et al.,

2004). For detection of epileptiform activity we recorded

field potentials from 10 positions along the treated/sham-treated

region in cortical layer 4, stimulating on the border of white to grey

matter. Extracellular potassium concentrations ([K+]o) were

measured with ion-sensitive microelectrodes (ISMEs, Lux and

Neher, 1973; Jauch et al., 2002). For K+-ionophoresis, double-

barrelled theta glass electrodes with slightly angled tips were filled

with 1 M KCl and 154 mM NaCl and glued to the ISME

(tip distance: 50–80 mm). K+ was applied by ionophoresis (60 s,

150–1000 nA). Injections were repeated at least three times at 5 min

intervals to confirm stability. Intracellular recordings were

performed with sharp microelectrodes using standard techniques

(Seiffert et al., 2004).

536 Brain (2007), 130, 535–547 S. Ivens et al.



ownloaded from


Drug applicationKir and K+ leak currents were blocked by BaCl2 (100 mM and

2 mM, respectively), dissolved in sulphate-free ACSF (Ransom and

Sontheimer, 1995; Jauch et al., 2002). To isolate astrocytic currents,

the following drugs were applied in combination before BaCl2application: 30 mM 2-amino-5-phosphovaleric acid (APV), 30 mM

6-cyano-7-nitroquinoxyline-2,3-dione (CNQX), 10 mM bicuculline

and 1 mM tetrodotoxin (TTX) (all from Tocris, Bristol, UK) were

used to block N-methyl-D-aspartate (NMDA), AMPA/KA, and

GABA receptors and voltage activated Na+-channels, respectively.

Drugs were applied by addition to the ACSF.

Evaluation of BBB integrityTwo approaches were used to estimate BBB integrity: (i) ex vivo

measurements following intra-peritoneal injection with 2 ml of 2%

Evans blue (Sigma, St Louis, USA) (Friedman et al., 1996; Seiffert

et al., 2004); and (ii) image analyses of in vivo MRI measurements

by using a 7 tesla scanner (Pharmascan 70/16 AS, Bruker Biospin,

Ettlingen, Germany) with a 16 cm horizontal bore magnet and a

9 cm (inner diameter) shielded gradient having a maximum

strength of 300 mT/m. Rats were anaesthetized with 1.5%

isoflurane delivered in 100% O2 via a face mask and then placed

in the centre of a 38 mm RF coil on a heated pad. Respiration and

pulse rate were continuously monitored (monitoring unit Model

1025; SA Instruments, Inc., Stony Brook, New York). Coronal slices

were imaged (35 slices, slice thickness = 0.5 mm). The field of view

was 3 · 3 cm, and the matrix was 256 · 256, resulting in an

in-plane resolution of 117 mm. Two brain imaging sequences were

performed: (i) T1-weighted 2D turbo spin echo with RARE factor

2 (TR 1141.7 ms, TE 13.2 ms, 8 averages, total scan time 19 min: 30

s), in which the sequence was repeated before and after the

injection of the BBB non-permeable agent gadolinium diethylene

triamine pentaacetate (Gd-DTPA, 0.5 mol/l, 0.5 ml/200 g body

weight; Magnevist, Schering, Berlin, Germany); and (ii)

T2-weighted sequence with RARE factor 4 (TR 5046.6 ms, TE

36.5 ms, 5 averages, total scan time 26 min: 54 s). Spatially

matching T1 images were compared for statistically significant

differences in signal enhancement, reflecting changes in BBB

permeability (Tomkins et al., 2001).

HistologyFor histological experiments, rat brains were fixed by transcardial

perfusion with 4% paraformaldehyde in 0.1 M phosphate-buffered

saline. After perfusion, brains were kept in the same fixative at

4�C overnight. Brains were then removed from the skull, dissected,

and treated with 96% alcohol overnight and subsequently paraffin

embedded in accordance with routine procedures. Eight to ten

micrometre coronal sections were mounted. Immunohistochem-

istry was performed on 10 mm paraffin sections. Sections were

incubated with primary antibodies at 4�C overnight. We used

rabbit antibodies against GFAP (1 : 400, DakoCytomation,

Glostrup, Denmark), microtubule-associated protein 2 (MAP2,

1 : 500, Sigma) and Kir 4.1 (1 : 200, Alomone Labs, Jerusalem,

Israel). Signal detection was achieved by incubation with secondary

antibody for 2 h at room temperature. Alexa Fluor 568 goat anti-

rabbit antibody (1:200, MoBiTec, Gottingen, Germany) was used

for red fluorescence, and biotinylated goat anti-rabbit antibody

(1:250, Vector, Peterborough, UK) followed by a standard ABC-

DAB development was used for non-fluorescent staining (Bech-

mann et al., 2000). To verify double-labelling throughout the entire

extent of the cells, we examined them in orthogonal planes with a

Zeiss Axiovert 510 confocal microscope (Thornwood, New York).

Upper and lower thresholds were set with the range indicator

function. We obtained optical stacks of 1 mm thick sections

through putatively double-labelled cells.

Gene expressionmRNA levels were determined using quantitative RT–PCR by real-

time kinetic analysis with an iQ5 detection system (Bio-Rad).

Primer pairs specific to GFAP (forward: 1138+ 50AGAAAACCG-CATCACCATTC30; reverse: 1287� 50TCCTTAATGACCTCGCC-ATC30), Kir 4.1 (forward: 150+ 50GAGACGACGCAGACAGA-GAG30; reverse: 310� 50CCACTGCATGTCAATGAAGG30) and

actin (forward: 1012+ 50GGGAAATCGTGCGTGACATT30;reverse: 1081� 50GCGGCAGTGGCCATCTC30) were used. Real-

time PCR data were analysed using the Livak 2-Delta Delta C(T)

calculation method (Livak and Schmittgen, 2001). Presented are

percentages of gene expression level of the treated hemisphere, as

compared with the non-operated contralateral hemisphere. Actin

mRNA levels were used as internal controls for variations in sample

preparation.

Data acquisition and analysisSignals were amplified (SEC-10L, NPI, Tamm, Germany), filtered

at 3 and 0.03 KHz (field potential, K+ signal, respectively),

displayed on an oscilloscope, digitized on-line (CED-1401,

Cambridge, UK) and stored for off-line analysis. Data and bar

graphs are presented throughout as means 6 SEM. Differences

between treated and control slices were determined by the non-

parametric Mann–Whitney test for independent samples. The effect

of pharmacological agents was tested with the non-parametric

Wilcoxon signed rank test for related variables. We performed all

statistical tests using SPSS 12.0.1 for Windows. P < 0.05 was taken

as the level of statistical significance.

ResultsBrain exposure to serum albuminleads to cortical dysfunctionIn order to study the consequences of an open BBB on brain

function, we employed an established in vivo model of

disturbing BBB using DOC sodium salt. Using this model we

produce a localized, highly reproducible perturbation in the

BBB by opening a cranial window over the somatosensory

region through which the exposed cortex is superfused with

DOC solution (2 mM) for 30 min. In vivoMRI obtained 24 h

after exposure to DOC confirmed BBB opening by showing

local enhancement of the T1 signal following injection of

Gd-DTPA. Both a local increase in cortical diameter and an

increased T2 signal indicated local vasogenic brain oedema

(Fig. 1A and B, n = 4). The MRI images also demonstrated

that there was no penetrating injury or significant

intracortical bleeding due to the treatment, supporting

previous histological analyses (Seiffert et al., 2004).

Treatment with either DOC or BSA induced indistin-

guishable hypersynchronized epileptiform activity in the

treated region, as expected (see below and Seiffert et al.,

2004). In the cortices of control sham-operated animals,

TGF-b receptors and epileptogenesis Brain (2007), 130, 535–547 537



ownloaded from


brief electrical stimulation of the white matter evoked

electrophysiological responses in a small cortical region

(<2 mm in width). These responses were characterized by a

short fixed latency (<7.5 ms), consistent with direct

stimulation of nearby cortical columns (Fig. 1C and E). In

contrast, in BSA- and in DOC-treated brains, these ‘early’,

short latency responses, were followed by long-lasting

paroxysmal field potentials that could be evoked in the

entire treated region (�3–5 mm, Fig. 1C, D and F). A tested

slice was regarded to display abnormal epileptiform activity

only when a clear, delayed all-or-none paroxysmal response

was observed >50 ms after low intensity white matter

stimulation (<2 · Ithreshold). The integral of the field

potential was measured 50–500 ms after stimulation and was

Fig. 1 Focal BBB disruption causes prominent cortical dysfunction. (A) T2 sequence MRI of a rat brain 24 h following BBB opening. Notelocal brain swelling due to vasogenic oedema in the treated region (arrows). (B) Colour-coded T1 image showing areas of significant signalchange after gadolinium-DTPA injection. Colour bar represents percentage of contrast enhancement. White arrows point to theintraventricular choroid plexus, normally lacking a BBB. (C) Electrophysiological recordings from sham-operated, DOC- and albumin(alb)-treated cortices one week after treatment. The filled bar graphs represent the averaged integral of the evoked field potential50–500 ms after stimulation (marked with dotted line) and the empty bar graphs the percentage of slices with paroxysmal activity.(D) Simultaneous recordings from an albumin-treated cortex one week after treatment. Electrode numbers are displayed on the left. Insetshows a photograph of a treated slice; the dots represent typical locations of recording (white) and stimulating (black) electrodes. The linerepresents the region of the exposed cortex in the treated (T) or sham-operated (S) animals. (E and F) Voltage maps representingextracellular recordings from 11 electrodes positioned along a sham (E) and a treated (F) slice one week after surgery. Note the propagatedevoked activity in the treated slice. x-axis represents time and y-axis distance along the cortex. Colour bar represents voltage amplitudes.Black arrows point out location and time of stimulation.




ownloaded from


found to be similar in DOC- and albumin-treated slices but

significantly lower in control slices (Fig. 1C). In both control

and treated brains, the early evoked synaptic response was

limited to a narrow band of cortex, while the paroxysmal

prolonged activity was propagating along a wide cortical

area within the treated region (Fig. 1D–F). Simultaneous

recordings from treated slices using multiple electrodes

revealed similar propagating epileptiform activity 1 week

after treatment for both DOC and albumin-treated slices

(6.18 6 1.98 and 5.31 6 1.75 mm/s, respectively, n = 4 for

each group, Fig. 1D–F). Clear epileptiform activity was

recorded in 72% of slices (DOC: n = 100 out of 139, BSA:

36 out of 50 slices) from over 90% of the treated rats (DOC:

n = 47 of 51, BSA: 12 of 13 rats), but in only 9.1% of slices

(2 of 22) from sham-operated rats (1 of 7) and in 16.3% of

slices (8 of 49) from the non-treated contralateral hemi-

sphere of treated rats (6 of 19 animals, Pearson x2 test,

P < 0.001). These findings point to reorganization of

the BBB-disrupted cortex in a manner similar to the

chronically injured (Prince and Tseng, 1993), undercut

(Hoffman et al., 1994), or maldeveloped cortex (Jacobs et al.,

1996). We observed spontaneous recurrent partial seizures

in three of our treated animals, sometime followed by

secondary generalization. The observed behavioural sponta-

neous seizures, while not investigated in detail under this

study, support the notion that paroxysmal activity observed

in the in vitro slice preparation indeed reflects abnormal

epileptic network activity in vivo (video; available as

supplementary material at Brain Online).

Albumin is selectively transportedinto astrocytesLike BBB opening, direct application of serum albumin in

vivo causes cortical dysfunction (Fig. 1). To confirm that our

BBB opening protocol results in diffusion of serum albumin

into the brain’s extracellular space, we injected Evans blue

intra-peritoneally and then traced the BBB non-permeable

albumin–Evans blue complex (red fluorescence, Fig. 2A) in

brain capillaries (Ehrlich, 1885; Friedman et al., 1996). While

in control brains fluorescence was limited to the intra-

capillary space, after BBB opening Evans blue–albumin

complex was observed around the capillaries (Fig. 2A). Six

to eight hours post-treatment, the albumin–dye complex

was detected inside some cellular elements (Fig. 2A, arrows).

In order to confirm the inclusion of albumin in the protein–

dye complexes, we performed immunohistochemistry stain-

ing with an antibody directed against serum albumin.

Albumin antibody staining produced a similar staining to

the Evans blue dye distribution (data not shown), further

verifying the penetration of serum albumin into the brain

microenvironment.

To further explore the mechanisms underlying albumin

uptake by brain cells, we directly exposed cortical slices to

albumin labelled with FITC or biotin. Prominent intracel-

lular staining was evident in the neocortex and hippocampus

of all slices (242.2 6 10.3 cells/mm2, n = 269 windows from

50 sections, 10 slices). The number of stained cells increased

during the first 40 min of exposure (87.96 20.0, 93.86 60.5,

223.0 6 25 and 270.0 6 13.6 cells/mm2 for 5, 10, 30 and

40 min, respectively), during which staining clearly shifted

from extranuclear sites (membrane and/or cytoplasma) to

the nucleus (Fig. 2B–D and G). Many labelled cells exhibi-

ted processes that were directed towards blood vessels,

resembling astrocytic end feet (Fig. 2C, left panel).

In addition, labelled albumin was found in the cytoplasm

(but not the nucleus) of other cells around blood vessels,

probably perivascular cells (Bechmann et al., 2001). To

control the specificity of albumin uptake, slices were exposed

to either FITC-dextran (70 kDa), which has a molecular

weight similar to that of albumin, or to ovalbumin labelled

with Texas Red (45 kDa). In the latter experiments, labelling

was limited to the cytoplasm of perivascular cells and was

never found in parenchymal cells (Fig. 2C right panel, D).

To identify the brain cells that take up FITC-albumin,

immunohistochemical labelling for astrocytes and neurons

was performed using antibodies directed against GFAP

and MAP2 as markers, respectively. Confocal analysis of

co-labelled cells revealed that most of the FITC-albumin-

containing cells expressed GFAP, but none expressed MAP2

(Fig. 2E and F). In addition, a small number of labelled cells

were both non-GFAP and non-MAP2 positive. These cells

were not characterized in this study: they could be non-

GFAP expressing astrocytes, pericytes and/or microglia. To

test the nature of the uptake process a competition assay

was performed in the presence of increasing amounts of

non-labelled albumin in the bathing solution. FITC-albumin

uptake was reduced in a dose-dependent manner as expected

for a receptor-mediated process (Fig. 2H). Taken together,

the selectivity of ligand uptake (albumin but not dextran

and ovalbumin), the selectivity of cell-type uptake (astro-

cytes but not neurons), the sub-cellular localization of

labelled albumin and the dose-dependency in the competi-

tion assay strongly suggest that the process of albumin

uptake into the brain cellular compartments is mediated via

a specific receptor.

Serum albumin induces epileptiformactivity in vitroIn the in vitro brain slices, albumin uptake by astrocytes was

faster and more efficient in comparison to that observed

in the in vivo paradigm. If albumin uptake has a role in

the development of BBB dysfunction, we would expect that

the induction of cortical dysfunction by albumin may also

be accelerated in vitro. We tested this hypothesis by

continuous recordings of population activity (n = 26) or

single neuron responses (n = 5) to albumin wash-in

(0.1 mM). Albumin wash-in for 1–3 h resulted in one slice

(10%, n = 10) showing abnormal, paroxysmal responses.

Exposure to albumin for 4–6 h resulted in robust

hypersynchronized, prolonged paroxysmal responses in




ownloaded from


15 of 16 slices (94%; Fig. 3). All control slices washed with

ACSF for a similar time showed normal field potentials

(n = 5). A gradual transformation from normal, brief

synaptic responses to epileptiform activity was also observed

during continuous (>3 h) intracellular recordings from all

five neurons exposed to albumin-containing ACSF (Fig. 3B).

The epileptiform activity persisted despite >4 h of wash-out

with albumin-free ACSF, pointing to a lasting cortical

dysfunction.

TGF-b receptors mediate albuminuptake into astrocytesThe experiments described so far suggested that the rapid

transport of albumin is receptor mediated and that this

Fig. 2 Albumin is preferentially transported into astrocytes. (A) Sections from control and BBB-treated animals 6 h following intra-peritoneal injection of Evans blue. Note the separation between intravascular Evans blue–albumin complex (red) and cellular elements of thebrain (DAPI staining in blue) in controls, compared with the extracellular and intracellular staining under BBB opening. Arrows markapparent membrane processes of stained cells. (B) Direct exposure of brain slices in vitro to FITC-albumin resulted in fast extranuclear(5 and 10 min), and nuclear staining (30 min) of cells. (C) Cellular elements labelled with FITC-albumin resembled astrocytes (arrows) andperivascular cells (open arrows). Inset: Co-localization of FITC-albumin and DAPI nuclear staining. FITC-dextran was taken up only byperivascular cells (right panel). (D) Co-administration of FITC-albumin and Texas Red-ovalbumin: Uptake of ovalbumin is limited toperivascular cells. Inset: Co-localization of albumin and ovalbumin in perivascular cells but not in a nearby parenchymal cell. (E and F)Confocal imaging of FITC-albumin labelled cells showing co-localization with cells positively immunolabelled for GFAP (astrocytes, E) butnot for MAP2 (neurons, F). In all insets scale bar represents 10 mm. (G) Number of stained cells at different times after exposure toFITC-albumin (n = 15 sections, three slices at each time point). (H) Addition of non-labelled BSA resulted in a dose-dependent decreasein the number of FITC-albumin labelled cells (n = 15 sections, three slices at each time point).




ownloaded from


transport is followed by a delayed and robust change in

network neuronal responses. TGF-bR type 2 (TGF-bR2) has

been recently found to function as an albumin-binding

protein in lung endothelial cells (Siddiqui et al., 2004).

To test the possibility that TGF-bRs mediate albumin uptake

into brain astrocytes, we exposed cortical slices to either

the TGF-bR type 1 (TGF-bR1) kinase activity inhibitor,

SB431542, and/or to antibodies against TGF-bR2. SB431542

reduced the number of FITC-albumin-labelled-cells in a

dose-dependent manner (Fig. 4A–C). Similarly, in the

presence of anti-TGF-bR2 antibodies, the number of

labelled cells was reduced and the labelled fraction showed

mainly membrane staining, with no nuclear staining (Fig. 4B

and D). These findings suggest that the transport of albumin

into cells is dependent on TGF-bRs.

To probe the role of TGF-bRs in the generation of

abnormal electrophysiological responses, we exposed rat

cortices in vivo to albumin in the presence and absence of

TGF-bR antagonists. Extracellular recordings in vitro one

week after treatment revealed paroxysmal activity in 76.3%

of the slices from albumin-exposed rats as compared with

29.3% of the slices from rats exposed to both albumin and

TGF-bR antagonists (45 of 59 slices, n = 13 animals

compared with 12 of 41 slices, n = 6 animals, Pearson x2 test,

P < 0.001, Fig. 4E and F). Thus, the application of TFG-bR

antagonists at the time of exposure of the brain environment

to serum albumin effectively blocks the consequent

generation of epileptiform activity. These findings validate

the involvement of TGF-bR-mediated albumin transport in

the generation of abnormal brain activity following albumin

exposure.

Extracellular buffering of K+ is impairedduring epileptogenesisPrevious studies of the injured cortex, the BBB-disrupted

cortex and the albumin-exposed cortex all show a window

of at least several days before epileptiform activity can be

recorded (e.g. Hoffman et al., 1994; Seiffert et al., 2004).

Within this period of epileptogenesis an astrocytic reaction

is established, as shown by enhanced immunostaining

against the GFAP. The pioneer works of Kuffler and Potter

(1964) established that astrocytes control the brain’s

extracellular environment, particularly by buffering rises

in [K+]o during neuronal activity. Thus, we tested the

hypothesis that during this window period of epileptogen-

esis, i.e. following treatment but prior to the onset of

epileptiform activity, [K+]o buffering is impaired (Pollen and

Trachtenberg, 1970; D’Ambrosio et al., 1999). Using ISMEs,

we measured changes in [K+]o following neuronal activation

24 h after BBB disruption. In all slices, a low-frequency

(20 s interval) stimulation of the white matter showed

normal field responses for treated animals similar to that

recorded from sham and non-operated control rats, thus

excluding epileptiform activity at this early stage (field

potential amplitude; stimulation at five times threshold

intensity: 1.58 6 0.29 mV, n = 9, 1.53 6 0.28 mV, n = 7 and

1.59 6 0.17 mV, n = 13, for BBB-treated, sham and non-

operated rats, respectively, Fig. 5A). During repetitive

stimulation (25 Hz, 2 s, one stimulation train), the rate of

increase of [K+]o (time to 50% of maximum: 0.71 6 0.04,

0.67 6 0.03 and 0.71 6 0.03 s) and the maximal increase in

[K+]o (4.84 6 0.67, 5.40 6 1.07 and 4.34 6 0.59 mM) were

similar in treated and control brains. In contrast, the decay

in [K+]o was slightly, but significantly, slower in treated

than in sham-operated or control slices (decay time to 50%

of maximal [K+]o: 1.91 6 0.1 s, n = 11; 1.51 6 0.06 s, n = 7;

and 1.50 6 0.07 s, n = 15, respectively, P < 0.01, Fig. 5B).

Interestingly, the reduced [K+]o clearance following stimula-

tion returned to control values within four weeks

after treatment with DOC (1.91 6 0.1 s, n = 11, 1.65 6

0.14 s, n = 2, 1.51 6 0.05 s, n = 4 for 1, 7 and 30 days,

respectively; Fig. 5C).

Fig. 3 Serum albumin induces epileptogenesis in vitro.Extracellular (A) and intracellular (B) electrophysiologicalrecordings in slices exposed to BSA. Numbers on the leftindicate hours of exposure. Paroxysmal activity developed fully5–6 h after exposure. (C) Bar graph shows the averaged integral(50–500 ms after stimulation) of the evoked responses in31 slices (see text for details).




ownloaded from


Reduced inward-rectifying K+ currentsin the albumin-exposed cortexThe reduced clearance of [K+]o during epileptogenesis

implied a down regulation of astrocytic K+ channels.

It has been demonstrated that the inwardly rectifying K+

channels play a particularly important role in K+ buffering

(Ransom and Sontheimer, 1995; D’Ambrosio et al., 1999).

We performed local K+ application by ionophoresis and

pharmacological manipulations to further explore the

mechanisms underlying reduced [K+]o clearance. To abolish

neuronal firing and synaptic responses, thus excluding

neuronal contribution to [K+]o changes, these experiments

were conducted in the presence of NMDA, AMPA/KA and

GABA receptors as well as voltage activated Na+-channel

blockers. We applied low (100 mM) and high (2 mM)

concentrations of Ba2+ to differentially block inward-

rectifying K+ currents (IKIR) and leak K+ currents (IKL),

respectively (Ransom and Sontheimer, 1995; Jauch et al.,

2002). Before the application of Ba2+ we performed a series

of ionophoretic K+ applications to determine a stable

baseline of [K+]o increases during injection (amplitude of

[K+]o increase during injection: 1.52 mM 6 0.05, n = 41

injections). After wash in of low concentrations of Ba2+,

[K+]o increase during ionophoresis was elevated in control

brains by 77 6 15% (n = 5 slices, 5 animals), whereas in

brains of treated animals this increase was significantly

lower (31 6 5% increase, n = 5 slices, 5 animals, P < 0.05,

Fig. 5D–F). No difference was found when Ba2+ concentra-

tions were elevated to 2 mM to block IKL (68 6 12% versus

66 6 5%, control versus treated, respectively, Fig. 5F). These

experiments indicate a reduction in IKIR in the presence of

normal IKL 24 h following treatment. Six hours of in vitro

exposure to serum albumin (Fig. 3) was similarly associated

with a reduced effect of 100 mM Ba2+ on ionophoretically

induced increases in [K+]o (31 6 4 and 68 6 12% in treated

and controls, respectively, P < 0.05). Since the Kir 4.1

channel has been shown to be expressed in cortical

astrocytes, especially in the processes of astrocytes wrapping

synapses and blood vessels (Higashi et al., 2001; Hibino et al.,

2004), we performed immunostaining experiments to reveal

Kir 4.1 channel levels following treatment with DOC. We

found that Kir 4.1 immunolabelling was indeed limited to

morphologically identified astrocytes (Fig. 5G, also con-

firmed by GFAP immunostaining, data not shown) and to

blood vessels. Twenty-four hours after treatment, Kir 4.1

channel immunolabelling was markedly reduced, whereas

Fig. 4 TGF-b receptors mediate albumin uptake and epileptogenesis. (A and B) Microscopic sections of brain slices exposed for30 min to FITC-albumin in the presence or absence of anti-TGF-bR2 antibodies. No nuclear staining is observed in the presence ofanti-TGF-bR2 antibodies (see higher magnification in the inset and quantification in D). (C) Number of FITC-albumin labelled cells isreduced by the TGF-bR1 antagonist SB431542 in a dose-dependent manner. (D) Percentage of cells with nuclear FITC-albumin labelling inthe absence (control) and presence (+Ab) of anti-TGF-bR2 antibodies. (E) Traces showing epileptiform activity recorded in vitro oneweek following in vivo exposure to albumin and a brief normal response in slices from a cortex exposed to albumin in the presence ofTGF-bR blockers. (F) Bar graph representing percentage of slices showing paroxysmal epileptiform activity in brains treated with albuminin the absence (Alb) and presence (+blockers) of TGF-bR blockers. All recordings were obtained one week following treatment in thepresence of ACSF (see text for details).




ownloaded from


GFAP labelling was enhanced, as expected (Fig. 5G and H;

Seiffert et al., 2004). Furthermore, quantitative real-time RT–

PCR showed significant higher GFAP and lower Kir 4.1

mRNA levels 14–48 h following in vivo exposure to either

DOC or albumin (Fig. 5I, n = 5 for each group). These

accumulating results suggest an early transcriptional down

regulation of Kir 4.1 channels, yielding a lower level of Kir 4.1

functional protein and resulting in reduced [K+]o buffering.

Activity-dependent [K+]o accumulationand subsequent neuronal hyperexcitabilityduring epileptogenesisFinally, we studied the effect of reduced [K+]o clearance on

neuronal excitability. The observed slowing of [K+]oclearance suggested K+ accumulation during low-frequency

stimulation. Indeed, while the increase in [K+]o during the

first stimulus was similar for DOC-treated and control

brains (0.093 6 0.013 versus 0.095 6 0.019 mM, respec-

tively), during the 50th stimulus (0.67 Hz), [K+]o peak levels

increased to 315 6 39% of the first stimulus in treated

brains, but only to 193 6 11% in controls (n = 7, P < 0.05;

Fig. 6A). Stimulus-induced [K+]o enhanced accumula-

tion was associated with the appearance of all-or-none,

paroxysmal, prolonged negative deflections in the field

responses. The latter were associated with a further increase

in [K+]o and were blocked by the NMDA-receptor

antagonist, MK-801 (Fig. 6B). Intracellular recordings

from identified pyramidal neurons confirmed that repetitive

stimulation was associated with long depolarization shifts,

which upon further membrane depolarization induced

action potentials (Fig. 6C–D).

Fig. 5 Abnormal [K+]o buffering 24 h following treatment is due to a transcriptional downregulation of Kir 4.1 channels. (A) Representativetraces showing normal evoked field potentials recorded 24 h after treatment in sham-operated (S) and treated (T) cortices. (B) Twosuperimposed traces of the [K+]o signals in response to a 2 s, 25 Hz stimulation (marked as underlying bar). [K+]o signals were normalized tomaximal increase (100%, 4.34 and 4.84 mM for control and treated, respectively). (C) [K+]o decay time to 50% of its maximal value 1 day(1d), 1 week (1w) and 1 month (1m) after treatment as well as 1 day after sham-operation (s) and in non-operated controls (c) (n = 11, 2, 4,7 and 15, respectively). (D and E) Representative traces showing the effect of Ba2+ on ionophoretically induced [K+]o increase in treated andcontrol slices before (D) and after (E) addition of 0.1 mM Ba2+. (F) Summary of Ba2+ effect on [K+]o increase. (G and H) Images of GFAPimmunostaining in cortical sections 24 h after treatment compared with controls. Insets: Higher magnifications of GFAP (left) and Kir 4.1(right) immunostaining in consecutive sections from the same brain. Note the enhanced GFAP and reduced Kir immunostaining inmorphologically identified astrocytes. Black arrows point to astrocyte processes towards neighbouring vessels. (I) % change in mRNAlevels for GFAP and Kir 4.1 in albumin or DOC-treated cortices compared with the contralateral, non-treated hemisphere(n = 5 for each group).




ownloaded from


DiscussionIn this study, we outlined a novel mechanism underlying

epileptogenesis in the BBB-injured cerebral cortex.

Our experiments were designed in light of accumulating

clinical evidence supporting a causative role between lasting

enhanced BBB permeability and epilepsy (Tomkins et al.,

2001; Avivi et al., 2004; Korn et al., 2005). We confirmed

that both in vivo and in vitro exposure to serum albumin can

induce hypersynchronized responses to a single stimulation.

The observed paroxysmal events recorded in the BBB/

albumin-treated cortex were similar to those described in

cortical slices from chronic animal models of epilepsies

(e.g. the chronically injured cortex: Prince and Tseng, 1993;

Jacobs et al., 1996; chemical kindling: Barkai et al., 1994;

or pilocarpine treatment: Sanabria et al., 2002). Similar

to the above-mentioned models of neocortical epilepsy,

spontaneous interictal-like hypersynchronous activity was

only rarely recorded in the BBB-treated cortex in vitro

(see Fig. 5 in Seiffert et al., 2004). While EEG recordings are

needed to characterize the in vivo correlates for the parox-

ysmal responses recorded in vitro, the clear spontaneous

seizures observed in few of the BBB-treated rats support the

relevance of this model in studying epileptogenesis.

Similar to lesional neocortical epilepsy in man and to

the above-mentioned models in experimental animals the

epileptogenic effect of albumin is delayed. This latent period

suggests that the underlying mechanism cannot be explained

solely in terms of simple binding to a channel/receptor,

but rather that it involves a slower biological process,

such as a transcriptional response. In contrast to the in vivo

condition, in vitro exposure to albumin showed the

development of paroxysmal activity within 4–6 h, perhaps

reflecting a more efficient diffusional equilibration or uptake

of albumin or additional injury-related processes occurring

in the slice preparation. The rapid uptake of albumin in vitro

also stresses the in vivo efficiency of the BBB in limiting the

incursion of serum proteins (e.g. by the strong uptake

capacity of the perivascular cells), even when the endothelial

barrier is disrupted (e.g. in the presence of DOC).

On the basis of our findings, we now propose a new

mechanism for the uptake of albumin and its effect on

astrocytes. It is noteworthy that astrocytes are normally

exposed to albumin only during brain development when

the BBB is not yet fully developed (at this stage brain

astrocytes do indeed display lower IKIR and reduced K+

buffering; Kressin et al., 1995). Hence, the presence of

specific albumin uptake in adulthood is surprising but may

serve to reduce vasogenic oedema following BBB disruption.

The findings of this study—kinetics of albumin entry into

astrocytes, the specificity of albumin (labelled dextran or

ovalbumin were not transported) and the reduced transport

of albumin in the presence of non-labelled albumin—all

point to a receptor-mediated uptake. TGF-bR emerged as a

possible candidate in light of the following pieces of evidence

from previous studies: uptake of albumin is modulated

by TGF-bRs in the kidney (Gekle et al., 2003) and lung

endothelial cells (Siddiqui et al., 2004); brain astrocytes

express TGF-bRs (Vivien et al., 1998); and TGF-bR

expression is increased following brain injury (Morganti-

Kossmann et al., 2002). The observation in this study

that albumin uptake was inhibited by the TGF-bR1 kinase

activity inhibitor, SB431542, suggests that the uptake

depends on intracellular TGF-bR signalling. It is noteworthy

that exposing brain slices to anti-TGF-bR antibodies

blocked the uptake of albumin into the cells but did not

prevent the surface membrane staining (Fig. 4B), suggesting

that albumin binds to another site at the same receptor or to

an additional surface receptor. It remains to be further

studied whether albumin transport to the nucleus directly

triggers altered gene expression and to what extent other

intracellular signalling pathways are involved. Previous

studies in cultured astrocytes from rat brains show

that albumin induces calcium signalling (Nadal et al.,

Fig. 6 Activity-dependent K+ accumulation and neuronalhyperexcitability 24 h following BBB disruption. (A) Recording of[K+]o increase during slow (0.67 Hz) repetitive stimulationshows excessive [K+]o accumulation in the treated cortex.(B) Superimposed (1st, 3rd and 5th) field potential responsesduring repetitive 0.67 Hz stimulation. Note the MK-801 sensitive,late negative deflection of the field potential in the treated slice.(C) Intracellular recording from a single identified pyramidalneuron in a treated slice showing depolarizing after-potentialsinduced by low-frequency (0.4 Hz) repetitive stimulation(resting potential = �75 mV). (D) Recording from the same cellas in C. Stimulus-induced depolarizing after-potentials led to actionpotential firing when the resting potential was set to �60 mV(overshooting action potentials are truncated).




ownloaded from


1995) and that TGF-bR activation causes a rapid down

regulation of Kir channels (Perillan et al., 2002) further

supporting a direct role for the interactions between

albumin and TGF-b signalling systems in modulating

astrocyte functions. Since TGF-b1 may be secreted in a

latent form non-covalently bound to extracellular matrix

proteins (Munger et al., 1997), we cannot entirely rule out

an alternative hypothesis that albumin exerts its action by

increasing the bioavailability of TGF-b1.

We confirmed that the astrocyte reaction (observed

as increased GFAP expression) is associated with reduced

K+ buffering capacity as early as 24 h after brain exposure

to albumin in vivo. Slowing of [K+]o decay was observed

both in the presence of apparently normal cortical

excitability (to a single stimulation) and during the initial

period of abnormal activity, but returned to control values

within 4 weeks, despite the continuous presence of abnormal

electrophysiological responses. The period of reduced

K+ buffering was similar to the period observed in which

an increase in the number of GFAP-labelled astrocytes was

observed (Seiffert et al., 2004). Astrocytic reaction is

prominent in a wide variety of brain insults, in both

animals and man, and while it may be important in

stabilization of the injured tissue (e.g. scar formation), it

seems to interfere with neuronal regeneration (Silver and

Miller, 2004). Abnormal K+ buffering in the injured brain

has been reported previously (D’Ambrosio et al., 1999;

Anderova et al., 2004), but this is the first report showing

that abnormal K+ buffering precedes—and may be associated

with—the development of epileptiform activity (see below).

Furthermore, we showed that while K+ clearance gradually

returns to normal values, hyperexcitability is maintained.

We also demonstrated that reduced K+ uptake by astrocytes

(as we employed sodium channel and synaptic receptor

blockers to block neuronal activity; Jauch et al., 2002) is

associated with reduced IKIR and not IKL. This conclusion

was initially supported by the augmenting effect of low

concentrations of Ba2+ on ionophoretically induced K+

signals. Ba2+ also affects a number of voltage- and calcium-

dependent K+ channels in neurons. However, since we

blocked transmitter receptors and voltage-dependent Na+

channel in these experiments, effects of Ba2+ on neuronal

excitability are unlikely. The reduced IKIR in the BBB-treated

cortex is consistent with previous studies showing a loss of

IKIR in reactive cortical astrocytes in rats around freeze

lesions (Bordey et al., 2001), ischaemic insults (Koller et al.,

2000) and direct injuries (Schroder et al., 1999) as well as in

epileptic Tsc1 knockout mice (Jansen et al., 2005) and

human subjects with temporal lobe epilepsy (Bordey and

Sontheimer, 1998; Hinterkeuser et al., 2000; Jauch et al.,

2002). Interestingly, all these cortical insults are frequently

associated with enhanced BBB permeability. Only Kir 4.1

and 5.1 channels have been shown to be expressed in the

neocortex (Hibino et al., 2004) and their key role in

buffering activity-dependent [K+]o increases is supported by

studies showing that their expression is limited to the

astrocytic membrane domains facing blood vessels or in the

processes surrounding synapses (Higashi et al., 2001). Our

immunolabelling experiments and the determination of

mRNA levels suggest a rapid downregulation of Kir channel

expression together with the upregulation of GFAP. At this

point, however, we cannot rule out additional changes in

Kir channels’ rectification properties (Bordey et al., 2001)

and/or their re-distribution in the cell membrane (Warth

et al., 2005). A downregulation of Kir channels will not only

affect potassium buffering but also lead to depolarization of

astrocytes and thereby reduce the efficacy of glutamate

transport into astrocytes, thus contributing to the facilitated

emergence of epileptiform discharges.

We showed here that even a relatively small reduction in K+-

buffering capacity may be functionally significant, since it

augments activity-dependentK+ accumulation and consequent

NMDA receptor activation (Fig. 6). The activation of NMDA

receptors may be due to K+ accumulation at the synaptic cleft

and consequent depolarization at the post-synaptic site (thus

increasing the likelihood of NMDA receptor opening) and/or

by reduced glutamate transport into depolarized astrocytes. A

plausible hypothesis would be that the increased, repeated

activation of NMDA receptors leads to non-specific synaptic

plasticity, thus strengthening excitatory synapses and causing

hyperexcitability (Li and Prince, 2002; Shao and Dudek, 2004).

This premise would also explain the efficacy of NMDA-

receptor antagonists in improving cortical functions after brain

injury and in some neurodegenerative disorders—all condi-

tions in which the BBB is frequently impaired (Hickenbottom

and Grotta, 1998; Sonkusare et al., 2005).

In summary, we conclude that following brain insults,

exposure of brain cells to albumin—themost abundant serum

protein—leads to cortical dysfunction, recorded as epilepti-

form hypersynchronous activity. We suggest that the

development of cortical dysfunction is mediated by TGF-

bRs, which facilitate albumin uptake into astrocytes and down

regulation of Kir currents. This, in turn, causes abnormal

accumulation of [K+]o and consequent NMDA-receptor-

dependent pathological plasticity. Since a wide spectrum of

common neurological disorders is associated with BBB

disruption, we propose that amelioration of neural injury in

these conditions may be achieved via targeting the TGF-bRs.

AcknowledgementsThe authors thank K. Froehlich, J. Mahlo and H. Levy for

technical assistance. This study was supported by the

Sonderforschungsbereich 507 and TR3 (AF and UH), the

German-Israeli Foundation for Scientific Research and

Development (AF) and the Mary Elizabeth Rennie Epilepsy

Foundation research grant (DK). Funding to pay the Open

Access publication charges for this article was provided by

the Sonderforschungsbereich 507.

References

Abbott NJ, Ronnback L, Hansson E. Astrocyte-endothelial interactions at the

blood-brain barrier. Nat Rev Neurosci 2006; 7: 41–53.




ownloaded from


Anderova M, Antonova T, Petrik D, Neprasova H, Chvatal A, Sykova E.

Voltage-dependent potassium currents in hypertrophied rat astrocytes

after a cortical stab wound. Glia 2004; 48: 311–26.

Avivi E, Tomkins O, Korn A, Pavlovsky L, Shelef I, Friedman A. Blood-brain-

barrier disruption in humans: a window to neurodegenerative diseases. In:

Silman I, Fisher A, Anglister L, Michaelson D, Soreq H, editors. Cholinergic

mechanisms. London: Martin Dunitz; 2004. p. 423–9.

Ballabh P, Braun A, Nedergaard M. The blood-brain barrier: an overview:

structure, regulation, and clinical implications. Neurobiol Dis 2004;

16: 1–13.

Barkai E, Grossmann Y, Gutnick MJ. Long-term changes in neocortical

activity after chemical kindling with systemic pentylenetetrazole: an

in vitro study. J Neurophysiol 1994; 72: 72–83.

Bechmann I, Lossau S, Steiner B, Mor G, Gimsa U, Nitsch R. Reactive

astrocytes upregulate Fas (CD95) and Fas ligand (CD95L) expression but

do not undergo programmed cell death during the course of anterograde

degeneration. Glia 2000; 32: 25–41.

Bechmann I, Kwidzinski E, Kovac AD, Simburger E, Horvath T, Gimsa U, et al.

Turnover of rat brain perivascular cells. Exp Neurol 2001; 168: 242–9.

Bordey A, Sontheimer H. Properties of human glial cells associated with

epileptic seizure foci. Epilepsy Res 1998; 32: 286–303.

Bordey A, Lyons SA, Hablitz JJ, Sontheimer H. Electrophysiological

characteristics of reactive astrocytes in experimental cortical dysplasia.

J Neurophysiol 2001; 85: 1719–31.

Cornford EM. Epilepsy and the blood brain barrier: endothelial cell responses

to seizures. Adv Neurol 1999; 79: 845–62.

Cornford EM, Oldendorf WH. Epilepsy and the blood-brain barrier. Adv

Neurol 1986; 44: 787–812.

D’Ambrosio R, Maris DO, Grady MS, Winn HR, Janigro D. Impaired K+

homeostasis and altered electrophysiological properties of post-traumatic

hippocampal glia. J Neurosci 1999; 19: 8152–62.

Ehrlich P. Das Sauerstoffbeduerfnis des Organismus: Eine Farbenanalytische

Studie. Hirschwald 1885; 8: 167.

Eid T, Lee TS, ThomasMJ, Amiry-MoghaddamM, Bjornsen LP, Spencer DD,

et al. Loss of perivascular aquaporin 4 may underlie deficient water and

K+ homeostasis in the human epileptogenic hippocampus. Proc Natl Acad

Sci USA 2005; 102: 1193–8.

Friedman A, Kaufer D, Shemer J, Hendler I, Soreq H, Tur-Kaspa I, et al.

Pyridostigmine brain penetration under stress enhances neuronal

excitability and induces early immediate transcriptional response. Nat

Med 1996; 2: 1382–5.

Gekle M, Knaus P, Nielsen R, Mildenberger S, Freudinger R, Wohlfarth V,

et al. Transforming growth factor-beta1 reduces megalin- and cubilin-

mediated endocytosis of albumin in proximal-tubule-derived opossum

kidney cells. J Physiol 2003; 552: 471–81.

Geursen A, Grigor MR. Serum albumin secretion in rat milk. J Physiol 1987;

391: 419–27.

Hibino H, Fujita A, Iwai K, Yamada M, Kurachi Y. Differential assembly of

inwardly rectifying K+ channel subunits, Kir4.1 and Kir5.1, in brain

astrocytes. J Biol Chem 2004; 279: 44065–73.

Hickenbottom SL, Grotta J. Neuroprotective therapy. Semin Neurol 1998;

18: 485–92.

Higashi K, Fujita A, Inanobe A, Tanemoto M, Doi K, Kubo T, et al. An

inwardly rectifying K+ channel, Kir4.1, expressed in astrocytes surrounds

synapses and blood vessels in brain. Am J Physiol Cell Physiol 2001;

281: C922–31.

Hinterkeuser S, Schroder W, Hager G, Seifert G, Blumcke I, Elger CE, et al.

Astrocytes in the hippocampus of patients with temporal lobe epilepsy

display changes in potassium conductances. Eur J Neurosci 2000;

12: 2087–96.

Hoffman SN, Salin PA, Prince DA. Chronic neocortical epileptogenesis in

vitro. J Neurophysiol 1994; 71: 1762–73.

Jacobs KM, Gutnick MJ, Prince DA. Hyperexcitability in a model of cortical

maldevelopment. Cereb Cortex 1996; 6: 514–23.

Jansen LA, Uhlmann EJ, Crino PB, Gutmann DH, Wong M. Epileptogenesis

and reduced inward rectifier potassium current in tuberous sclerosis

complex-1-deficient astrocytes. Epilepsia 2005; 46: 1871–80.

Jauch R, Windmuller O, Lehmann TN, Heinemann U, Gabriel S.

Effects of barium, furosemide, ouabaine and 4,40-diisothiocyanatostilbene-2,20-disulfonic acid (DIDS) on ionophoretically-induced changes in

extracellular potassium concentration in hippocampal slices from rats

and from patients with epilepsy. Brain Res 2002; 925: 18–27.

Kasantikul V, Brown WJ, Oldendorf WH, Crandall PC. Ultrastructural

parameters of limbic microvasculature in human psychomotor epilepsy.

Clin Neuropathol 1983; 2: 171–8.

Kaufer D, Friedman A, Seidman S, Soreq H. Acute stress facilitates

long-lasting changes in cholinergic gene expression. Nature 1998;

393: 373–7.

Koller H, Schroeter M, Jander S, Stoll G, Siebler M. Time course of inwardly

rectifying K+ current reduction in glial cells surrounding ischemic brain

lesions. Brain Res 2000; 872: 194–8.

Korn A, Golan H, Melamed I, Pascual-Marqui R, Friedman A. Focal cortical

dysfunction and blood-brain barrier disruption in patients with

postconcussion syndrome. J Clin Neurophysiol 2005; 22: 1–9.

Kressin K, Kuprijanova E, Jabs R, Seifert G, Steinhauser C. Developmental

regulation of Na+ and K+ conductances in glial cells of mouse hippocampal

brain slices. Glia 1995; 15: 173–87.

Kuffler SW, Potter DD. Glia in the leech central nervous system: physiological

properties and neuron-glia relationship. J Neurophysiol 1964; 27:

290–320.

Li H, Prince DA. Synaptic activity in chronically injured, epileptogenic

sensory-motor neocortex. J Neurophysiol 2002; 88: 2–12.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods

2001; 25: 402–8.

Lux HD, Neher E. The equilibration time course of [K+]o in cat cortex. Exp

Brain Res 1973; 17: 190–205.

Morganti-Kossmann MC, Rancan M, Stahel PF, Kossmann T. Inflammatory

response in acute traumatic brain injury: a double-edged sword. Curr

Opin Crit Care 2002; 8: 101–5.

Munger JS, Harpel JG, Gleizes PE, Mazzieri R, Nunes I, Rifkin DB. Latent

transforming growth factor-beta: structural features and mechanisms of

activation. Kidney Int 1997; 51: 1376–82.

Nadal A, Fuentes E, Pastor J, McNaughton PA. Plasma albumin is a potent

trigger of calcium signals and DNA synthesis in astrocytes. Proc Natl Acad

Sci USA 1995; 92: 1426–30.

Neuwelt EA. Mechanisms of disease: the blood-brain barrier. Neurosurgery

2004; 54: 131–40.

Pavlovsky L, Browne RO, Friedman A. Pyridostigmine enhances

glutamatergic transmission in hippocampal CA1 neurons. Exp Neurol

2003; 179: 181–7.

Perillan PR, Chen M, Potts EA, Simard JM. Transforming growth factor-

beta 1 regulates Kir2.3 inward rectifier K+ channels via phospholipase C

and protein kinase C-delta in reactive astrocytes from adult rat brain.

J Biol Chem 2002; 277: 1974–80.

Pollen DA, Trachtenberg MC. Neuroglia: gliosis and focal epilepsy. Science

1970; 167: 1252–3.

Prince DA, Tseng GF. Epileptogenesis in chronically injured cortex: in vitro

studies. J Neurophysiol 1993; 69: 1276–91.

Ransom CB, Sontheimer H. Biophysical and pharmacological characteriza-

tion of inwardly rectifying K+ currents in rat spinal cord astrocytes.

J Neurophysiol 1995; 73: 333–46.

Sanabria ER, da Silva AV, Spreafico R, Cavalheiro EA. Damage,

reorganization, and abnormal neocortical hyperexcitability in the

pilocarpine model of temporal lobe epilepsy. Epilepsia 2002; 43

(Suppl 5): 96–106.

Schroder W, Hager G, Kouprijanova E, Weber M, Schmitt AB, Seifert G, et al.

Lesion-induced changes of electrophysiological properties in astrocytes

of the rat dentate gyrus. Glia 1999; 28: 166–74.

Seifert G, Schilling K, Steinhauser C. Astrocyte dysfunction in neurological

disorders: a molecular perspective. Nat Rev Neurosci 2006; 7: 194–206.

Seiffert E, Dreier JP, Ivens S, Bechmann I, Tomkins O, Heinemann U, et al.

Lasting blood-brain barrier disruption induces epileptic focus in the rat

somatosensory cortex. J Neurosci 2004; 24: 7829–36.




ownloaded from


Shao LR, Dudek FE. Increased excitatory synaptic activity and local

connectivity of hippocampal CA1 pyramidal cells in rats with kainate-

induced epilepsy. J Neurophysiol 2004; 92: 1366–73.

Siddiqui SS, Siddiqui ZK, Malik AB. Albumin endocytosis in endothelial

cells induces TGF-beta receptor II signaling. Am J Physiol Lung Cell Mol

Physiol 2004; 286: L1016–26.

Silver J, Miller JH. Regeneration beyond the glial scar. Nat Rev Neurosci 2004;

5: 146–56.

Sonkusare SK, Kaul CL, Ramarao P. Dementia of Alzheimer’s disease and

other neurodegenerative disorders—memantine, a new hope. Pharmacol

Res 2005; 51: 1–17.

Tomkins O, Kaufer D, Korn A, Shelef I, Golan H, Reichenthal E, et al.

Frequent blood-brain barrier disruption in the human cerebral cortex.

Cell Mol Neurobiol 2001; 21: 675–91.

Vivien D, Bernaudin M, Buisson A, Divoux D, MacKenzie ET, Nouvelot A.

Evidence of type I and type II transforming growth factor-beta receptors in

central nervous tissues: changes induced by focal cerebral ischemia.

J Neurochem 1998; 70: 2296–304.

Warth A, Mittelbronn M, Wolburg H. Redistribution of the water channel

protein aquaporin-4 and the K+ channel protein Kir4.1 differs in low-

and high-grade human brain tumors. Acta Neuropathol (Berl) 2005;

109: 418–26.




ownloaded from


Documents

TGF-b receptor-mediated albumin uptake into astrocytes is involved in neocortical epileptogenesis