Cloning and Characterization of the human UDP

1

Cloning and Characterization of the human UDP glucuronosyltransferase

1A8, 1A9 and 1A10 gene promoters

DIFFERENTIAL REGULATION THROUGH AN INITIATOR-LIKE REGION

Philip A. Gregory 1, Dione A. Gardner-Stephen 1, Rikke H. Lewinsky, Kym N. Duncliffe,

and Peter I. Mackenzie

Department of Clinical Pharmacology, Flinders University School of Medicine, Flinders

Medical Centre, Bedford Park, South Australia, 5042.

1 These authors contributed equally to this work

Running Title: Differential regulation of the UGT1A8, 1A9 and 1A10 genes

Corresponding author:

Peter I. Mackenzie, Ph.D.

Department of Clinical Pharmacology,

Flinders Medical Centre,

Bedford Park, SA. 5042,

Australia.

Phone: +61-8-8204-5394

Fax: +61-8-8204-5114

E-mail: [email protected]

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on July 7, 2003 as Manuscript M305565200 by guest on February 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2

Summary

The human UDP glucuronosyltransferases, UGT1A8, 1A9 and 1A10 are closely related in

sequence and have a major role in the elimination of lipophilic chemicals by glucuronidation.

UGT1A8 and 1A10 are exclusively expressed in the gastrointestinal tract whereas UGT1A9

is mainly expressed in the liver and kidneys. In order to determine the factors contributing to

the extrahepatic expression of these UDP glucuronosyltransferases, we have cloned and

characterised the promoters of the UGT1A8, 1A9 and 1A10 genes and studied their

regulation in the colon cell line, Caco2. Their transcription start sites were mapped and a

functional overlapping Sp1/initiator-like site was identified which strongly contributed to

UGT1A8 and 1A10 promoter activity. The high promoter activity of UGT1A8 and 1A10

correlated with the binding of nuclear proteins (complex B) to this region. Two base pair

differences in the corresponding site in the UGT1A9 promoter prevented the binding of

complex B and reduced promoter activity. Although Sp1 was able to bind to the Sp1/initiator-

like site, its binding was dispensable for promoter activity. However, the binding of Sp1 to a

second Sp1 site 30 bp 5’ to the Sp1/initiator-like site greatly enhanced the activity of the

UGT1A8 and 1A10 promoters. These results provide evidence that the UGT1A8, 1A9 and

1A10 genes are differentially regulated through an initiator element in their 5’ flanking

regions.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

3

Introduction

Glucuronidation represents one of the major pathways through which the body is able to

deactivate and excrete a wide range of lipophilic compounds including drugs, environmental

pollutants, dietary chemicals, and endogenous compounds such as bilirubin, steroids and bile

acids (1). Accommodation of such a structurally diverse range of chemicals is provided by

the superfamily of UDP glucuronosyltransferase (UGT)1 enzymes, of which there are 16

known functional enzymes in humans to date. UGT’s are classified into two families, UGT1

and UGT2, based on their amino acid sequence similarity (2). The UGT2 family is further

subdivided into UGT2A and UGT2B subfamilies, each encompassing genes encoded by six

unique exons located on chromosome 4 (3,4). In contrast, the UGT1A subfamily is encoded

by a single gene locus on chromosome two, recently shown to span >200 kb (5). Eight

functional UGT1A enzymes have been shown to be expressed in humans (UG1A1, 1A3,

1A4, 1A6, 1A7, 1A8, 1A9 and 1A10) and four pseudogenes (1A2, 1A11, 1A12, 1A13) have

been identified. (6). Each UGT1A form contains a unique exon 1, which is joined to a shared

set of exons 2-5 through RNA splicing. Characterization of the UGT1A locus has shown that

the first exon of each individual form is organised in series upstream of exon 2 (5,7). The first

exons are separated from each other by 5’ flanking regions of 5 to 23 kb in length. There is

much accumulated evidence suggesting the 5’ flanking region of each UGT1A exon 1

contains promoter elements capable of regulating their expression. Analysis of the promoters

of the human UGT1A1 and 1A6 genes showed that they were functional in liver and colon

cells respectively (8). Studies on the rat UGT1A6 and UGT1A7 genes have also shown that

their promoter regions are capable of stimulating transcription in liver cells (9,10). In

addition, UGT1A genes have recently been demonstrated to be induced by the nuclear

receptors constitutive active receptor (CAR), aryl hydrocarbon receptor (AHR), pregnane X


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

4

receptor (PXR) and peroxisome proliferator-activated receptor (PPAR) through binding to

their promoter regions (9,11-14).

The tissue specificity of UGT1A expression has recently been an area of intense study. While

the liver is considered to be the major site of glucuronidation, the importance of the

gastrointestinal tract in the glucuronidation of ingested chemicals has been shown by the

expression of multiple UGT1A enzymes in these tissues (15). The liver is known to express

the UGT1A forms 1A1, 1A3, 1A4, 1A6, and 1A9 (16-19), but not the 1A7, 1A8 and 1A10

genes. These three isoforms are expressed exclusively in extrahepatic tissues, particularly in

the tissues of the gastrointestinal tract (20-23). The functional UGT1A genes are divided into

two clusters, the UGT1A7-10 cluster of genes being > 70 % similar in their first exon

sequence and < 60% similar to the other UGT1A genes (including the UGT1A3-5 cluster)

(5). Unlike the UGT1A1-6 genes, which have interindividual variation in expression in the

gastrointestinal tract, UGT1A7-10 appear to be consistently expressed in these tissues

(24,25). This unique pattern of expression of the UGT1A7-10 gene cluster suggests that

coordinated, tissue specific mechanisms of regulation may be important for their expression.

Both the human UGT1A1 and UGT1A6 genes utilize TATA boxes to initiate transcription

(12,26). However, initiation of gene transcription by RNA polymerase II may also occur

through initiator regions in the promoters of genes. TATA box dependent mechanisms of

transcription are well characterised, the first step involving the binding of transcription factor

IID (TFIID) to A/T rich sequences generally located 25-30 bp upstream of the transcription

start site, and subsequent formation of a preinitiation complex containing RNA polymerase II

(27). In contrast, the mechanism of transcription initiation through initiator regions is less

clearly understood. Initiator regions are found in both TATA-containing and TATA-less


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

5

promoters, and generally encompass the transcription start site (28). The initiator site is

sufficient for direct transcription alone, but transcription is often enhanced through upstream

TATA box or Sp1 binding sites (29-31). Although the sequence requirements of initiator sites

vary, they loosely adhere to a Py Py A+1 N T/A Py Py consensus, where Py represents a

pyrimidine(32). The relative strength of the initiator site appears to be enhanced by the

presence of further pyrimidine residues surrounding the core consensus site (32,33). A wide

range of proteins have been demonstrated to bind to initiator-like sites including TFIID (34-

36), RNA polymerase II (29), Ying Yang 1 (YY1) (37,38), Upstream Stimulating Factor

(USF) (39-41), Sp1 (38), TFII-I (40,42), E2F-1 (43), GA-binding proteins (GABP) (44), c-

myc (45,46), and various members of the TAFII family (47,48). However, it is not clear what

factors influence the binding of different proteins to initiator sites.

In order to examine the mechanisms contributing to the differential regulation of the

UGT1A8-10 genes in extrahepatic tissues, we have cloned and characterized the promoters of

each gene, and studied their regulation in the colon cell line Caco2. The transcription start

sites of UGT1A8, 1A9 and 1A10 were mapped, and a nearby overlapping Sp1/initiator-like

site was identified which strongly contributed to UGT1A8 and 1A10 promoter activity.

Initiation of transcription through TATA box dependent mechanisms was not observed for

these UGT genes.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

6

Experimental Procedures

Isolation of the UGT1A8, 1A9 and 1A10 genes and 5’ flanking regions

The UGT1A8, 1A9 and 1A10 promoter regions were isolated from a human placenta lambda

genomic library (Clontech) after several rounds of screening for their adjacent exons. Briefly,

a 480 bp EcoRI/NcoI fragment was prepared from exon 1 of the UGT1A8 (corresponding to

bases 96 to 576) and labelled with 32P-dATP by random priming using the DECAprime II

DNA labelling kit (Ambion). Hybond-N membranes (Amersham Biosciences) from plaque

lifts were denatured, neutralised and UV cross-linked as in the manufacturers protocol

(PT1010-1). Prehybridisation was carried out in a solution of 5 X SSC, 5 x Denhardt’s and

0.5% SDS for 4 hours at 42°C before hybridisation with 1 x 106 cpm/µl of probe overnight.

Membranes were then washed serially twice in 2 x SSC, 0.1% SDS for 5 minutes at room

temperature, and twice in 0.1 X SSC, 0.1% SDS for 30 minutes at 65°C followed by

exposure to autoradiographic film with intensification at –70°C overnight. Positive plaques

were picked and screened by restriction digestion and sequencing for appropriate inserts from

the UGT1A locus.

Transcription Start Site Mapping

Transcription start sites were mapped using the First Choice RNA Ligase Mediated -Rapid

Amplification of cDNA Ends (RLM-RACE) kit designed to amplify cDNA only from full

length capped RNA (Ambion). Total RNA was isolated from Caco2 cells using the Qiagen

RNeasy midi kit (Qiagen). Five µg of total RNA was treated with calf intestinal phosphatase

(CIP), phenol-chloroform extracted, and decapped using tobacco acid pyrophosphatase

(TAP), according to the manufacturer’s protocol. Resulting full-length RNA was ligated with

the 5’ RACE adapter provided and reverse transcribed according to the manufacturer’s


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

7

instructions. A pool of UGT1A8, 1A9 and 1A10 cDNAs were initially amplified by PCR

using a common reverse primer within exon 1 (5’-+227 GTCTTCACTGTGCAATTCAGTG

+206-3’) and the 5’RACE outer primer provided. The conditions used were as follows: 94°C

for 4 min followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, and then

72°C for 10 min. A TAP negative control was also amplified to confirm the specificity of the

RACE product. To isolate the UGT1A8, 1A9 and 1A10 cDNAs, nested PCRs were carried

out with 1/10th of the original PCR using the 5’ RACE inner primer provided and 1A8 (5’-+94

GCACTACCAGCAGCTTCCCTGCCTCAGC +67-3’), 1A9 (5’-+124

TTTCTCCACCACCGACCT +141-3’) and 1A10 (5’-+49 TAGACACACACATAAAGGAAC

+29-3’) specific exon 1 reverse primers under the following conditions: UGT1A8 (as above

but for 30 cycles), 1A9 and 1A10 (as above but with annealing temperature of 50°C and for

30 cycles). Resulting PCR products were purified with the QIAquick PCR purification kit

(Qiagen) and cloned into the pCR-Blunt vector (Invitrogen) according to the manufacturer’s

protocol. Several clones were selected and sequenced to confirm the position of each

transcription start site.

Construction of Luciferase Reporter Constructs

The proximal ~1kb of the UGT1A8 and 1A10 promoters were amplified from the lambda

clones isolated above by PCR and directionally cloned into the KpnI and MluI sites of the

pGL3-basic reporter vector (Promega). The primers used for the construction were the 1A8-

1034for and 1A10-1036for specific forward primers with the 1A8/10rev common reverse

primer (Table 1). The proximal 1kb of the UGT1A9 promoter was amplified using the 1A9-

1000for and 1A9rev primers (Table 1) and cloned non-directionally into a PstI site generated

in the multiple cloning region of the pGL3 basic vector (pGL3 +). pGL3+ was generated by

ligating the fragment generated by annealing two overlapping oligonucleotides (5’-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

8

CGCGTCTGCAGGAATTCGCTAGCCCGGGC-3’ and 5’-

TCGAGCCCGGGCTAGCGAATTCCTGCAGA-3’) into pGL3-basic digested with MluI

and XhoI. The resulting construct has PstI and EcoRI sites inserted between the existing MluI

and NheI sites. Mutations in the UGT1A8, 1A9 and 1A10 Sp1/initiator-like region were

generated using the QuikChange site-directed mutagenesis kit (Stratagene) with the forward

(for) and reverse (rev) primers pairs shown in Table 1 (primers are named by gene and then

the base mutated, see Figure 1; the only exception being the 1A8 –1036/+45 3’Sp1 mutant

which was made with the 1A8mut3’Sp1for and 1A8mut3’Sp1rev primers). The proximal 55

bp of the UGT1A8 promoter was amplified by PCR using the 1A8-55for and 1A8/10rev

primers. The upstream Sp1 site was mutated by PCR using the 1A8-55mut5’Sp1for and

1A8/10rev primers (Table 1). The resulting PCR products were cloned into the KpnI and

MluI sites of the pGL3-basic vector.

Cell Culture and Transfection

Caco2 cells obtained from the American Type Culture Collection were cultured in

Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal calf serum,

1mM sodium pyruvate, 0.1mM mixture of nonessential amino acids (all from Invitrogen) and

80mg/ml gentamycin at 37°C in 5% CO2. Cells were plated into 24-well plates at a density of

7.5 x 104 cells/well and transfected the following day with 0.5µg of promoter construct, and

0.025µg of the renilla vector pRL-null (Promega) using 2µl/well of Lipofectamine 2000™

according to the manufacturer’s protocol (Invitrogen). After 48 hours, the cells were

harvested in 100µl of 1 x passive lysis buffer and 20µl assayed for luciferase and renilla

activity using the Dual-Luciferase Reporter Assay System (Promega). Luminescence was

measured using a Packard TopCount luminescence and scintillation counter (Mt Waverly,

Victoria, Australia).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

9

Nuclear Extracts and Electrophoretic Mobility Shift Assay (EMSA)

Nuclear extracts were prepared from Caco2 cells essentially as described by Schreiber et al.

(49). The sense strand of the UGT1A8, 1A9 and 1A10 oligonucleotides used for EMSA are

shown in Figures 2B, 5B, and 7C. Probes were made by annealing complementary sense and

anti-sense oligonucleotides, followed by end-labelling with 32P-ATP using T4 polynucleotide

kinase, and purification through G25 columns (Amersham). Reactions were carried out with

5µg of Caco2 nuclear extract, 1µg of poly(dI-dC) and unlabelled competitor oligonucleotides

(if needed) in a 15µl reaction containing 25mM Tris-HCl (pH 7.6), 100mM KCl, 0.5mM

DTT, 5mM MgCl2, 0.5mM EDTA and 10% glycerol for 10 mins on ice. 50,000 cpm of probe

(0.5-1 ng) was added to the reaction mixture, which was incubated for a further 30 minutes at

room temperature. For supershift assays, antibodies (Santa Cruz) were added directly after

the addition of labelled probe. DNA-protein complexes were resolved in 0.5 x TBE on 4%

non-denaturing polyacrylamide gels.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

10

Results

Characterization of the UGT1A8, 1A9 and 1A10 promoters

The promoter regions of the UGT1A8, 1A9 and 1A10 genes were isolated from a human

placenta genomic library by screening with a UGT1A8 exon 1 probe. Several clones were

selected and identified as containing the UGT1A8, 1A9 or 1A10 exon 1 by sequencing.

Comparison of the proximal ~1kb of the UGT1A8, 1A9 and 1A10 promoters showed a high

degree of sequence similarity (>75%) with several putative regulatory elements. Figure 1

shows an alignment of the proximal 149 bases (UGT1A8 promoter relative to the ATG start

codon) of each promoter, highlighting a conserved T-repeat region, two putative Sp1 binding

sites (GC-box), as well as several differences in nucleotide sequence. It has been previously

suggested by Gong et al. (5) that the T-repeat region may function as a TATA box for the

UGT1A8, 1A9 and 1A10 genes. To investigate this possibility, the transcription start sites of

the genes were mapped using RNA ligase-mediated RACE, in order to amplify only full-

length capped transcripts. After the second round of PCR, which was specific for UGT1A8,

1A9 or 1A10, the amplified product was cloned into the pCR-Blunt vector and the sequence

of several clones obtained. For the UGT1A8 gene, 10 clones were sequenced with two

transcription start sites found at 46 (5 clones) and 49 (5 clones) bp from the ATG initiation

codon (Figure 1). Similarly, two separate transcription start sites were found for the

UGT1A10 gene at 46 (10 clones) and 48 (10 clones) bp from the ATG initiation codon

(Figure 1). For the UGT1A9 gene, only one transcription start site was identified from 11

clones at 37 bp from the ATG initiation codon (Figure 1). The position of the transcription

start sites was >50 bp from the T-region suggesting that an initiator-like mechanism, rather

than a TATA-dependent mechanism, may be important in initiating UGT1A8, 1A9 and 1A10

transcription. Although canonical initiator sites (Py Py A+1 N T/A Py Py) (32) were not


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

11

identified, an initiator-like region was found overlapping the 3’ putative Sp1 binding site in

the three promoters (Figure 1). As the UGT1A8 and 1A10 promoters differ from the

UGT1A9 promoter in 4 positions near the overlapping Sp1/initiator-like region, we decided

to investigate whether this region bound nuclear proteins in EMSA assays.

Nuclear proteins differentially bind to the UGT1A8, 1A9 and 1A10 Sp1/initiator-like region

Double-stranded oligonucleotide probes corresponding to nucleotides –34 to +5 of the

UGT1A8 promoter (Figure 2B, bases referenced from the 5’ transcription start site) were

synthesized and incubated with nuclear extracts from the colon-derived cell line Caco2 in

EMSA assays. Probes were also synthesized to the identical region in the UGT1A9 and 1A10

genes (Figure 2B) and compared to the UGT1A8 probe. As shown in Figure 2A, two major

complexes (labelled A and B) were observed using the UGT1A8 wild-type (wt) probe, and

several minor complexes also formed (lane 1). The UGT1A10wt probe appeared to form the

same complexes as the UGT1A8wt probe (lane 10), whereas the UGT1A9wt probe only

formed the top complex A and the minor complexes (lane 7). There are four differences in

sequence between the UGT1A8 and 1A9 genes in this region (Figure 1, labelled 1-4), but

only the one difference at base 2 between UGT1A8 and UGT1A10. To determine which of

these differences influence the protein binding patterns observed, probes were synthesized

incorporating the nucleotide changes as shown in Figure 2B (labelled mut 1-4). Mutation of

base 1 in the UGT1A8 gene (UGT1A8m1) did not have any impact on the binding of nuclear

proteins (lane 2). Mutation of base 2 (UGT1A8m2) appeared to slightly diminish the

formation of complex B but did not affect complex A (lane 3). Mutation of base 3

(UGT1A8m3) completely abolished the formation of complex B and increased the formation

of complex A, indicating this base is crucial for complex B formation (lane 4). Mutation of

base 4 in the UGT1A8 gene (UGT1A8m4, lane5) altered the intensity of complex A and the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

12

mobility of complex B. Mutation of both bases 3 and 4 in the UGT1A8 gene (UGT1A8m3/4,

lane 6) resulted in the formation of complexes similar to those bound by UGT1A9wt (lane 7).

Confirmation that complex A and B formation is dependent on bases 3 and 4 is supported by

data showing that the equivalent mutations in the UGT1A9 gene (UGT1A9m3/4, lane 10)

result in complexes similar to those formed on UGT1A8wt (lane 1). The complexes formed

on UGT1A9m3 (lane 8) and UGT1A9m4 (lane 9) were also similar to those formed on

UGT1A8m4 (lane 5) and UGT1A8m3 (lane 4) respectively. Mutation of bases 3 and 4 in the

UGT1A10 gene also resulted in UGT1A9-like complex formation (data not shown). These

results confirm that bases 3 and 4 are important for complex A and B formation in the

UGT1A8 and 1A10 genes, and that differences in these nucleotides in the UGT1A9 gene

prevent the formation of complex B. Therefore, we decided to investigate whether the base 3

and 4 differences in the Sp1/initiator-like region of UGT1A8, 1A9 and 1A10 genes influence

their respective promoter activities.

Nucleotide differences in the UGT1A8, 1A9 and 1A10 Sp1/ initiator-like region influence

promoter activity

The activity of the proximal 1kb of the UGT1A8, 1A9 and 1A10 promoters was measured by

transient transfection of promoter-luciferase constructs into the Caco2 cell line. Figure 3

shows that both the UGT1A8 and UGT1A10 promoters are highly active, having a relative

luciferase activity of 14- and 16-fold over the pGL3 basic vector. In contrast, the UGT1A9

promoter had only a 2-fold relative luciferase activity over pGL3-basic. To determine

whether the differences at nucleotides 3 and 4 in the Sp1/initiator-like region influenced

promoter activity, mutant constructs were prepared containing the same mutations used in the

EMSA probes (Figure 2B). Mutation of base 3 in the context of the 1kb UGT1A8 and 1A9

promoters decreased UGT1A8 promoter activity from 14-fold to 9-fold above pGL3-basic,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

13

but slightly increased UGT1A9 promoter activity from 2-fold to 3-fold (Figure 3). Similarly,

mutation of base 4 decreased UGT1A8 promoter activity quite sharply to 5-fold and slightly

increased UGT1A9 promoter activity to 3-fold. Mutation of both nucleotides sharply

decreased UGT1A8 and UGT1A10 promoter activity to 5-fold and 2-fold, and significantly

increased UGT1A9 promoter activity to 6-fold. These results indicate that the Sp1/initiator-

like region is important for promoter activity of the UGT1A8, 1A9 and 1A10 genes and that

differences in protein binding to this region between the UGT1A8/1A10 and UGT1A9 genes

correlates directly with their promoter activity. The higher promoter activity of the UGT1A8

and 1A10 genes appears to be, in part, due to the complex B formation on the Sp1/initiator-

like region as the loss of this complex (Fig 2A; lanes 4, 5 and 6) results in lower promoter

activity. Similarly, the lower promoter activity of UGT1A9 appears to be, in part, due to the

lack of complex B formation, as when this complex is able to form (Fig 2A; lane 10) the

resulting promoter activity is higher. Therefore, we further investigated the Sp1/initiator-like

region, examining the proteins present in complexes A and B.

Sp1 is present in complex A of the UGT1A8, 1A9 and 1A10 Sp1/initiator-like region

To determine whether Sp1 was able to bind to the UGT1A8, 1A9 and 1A10 Sp1/initiator-like

region, supershift assays were performed with the UGT1A8, 1A9 and 1A10 wt probes

(Figure 2B) using a monoclonal Sp1 specific antibody. As shown in Figure 4, addition of the

Sp1 antibody significantly reduced the formation of complex A, but not complex B with the

UGT1A8wt and the UGT1A9wt probes (comparing lanes 1 and 5, and 6 and 7). The same

reduction in complex A formation was also observed with the UGT1A10wt probe (data not

shown). Furthermore, the mobility of complex A was similar to that of the complex formed

on the Sp1 consensus (Sp1 con) probe (lane 8). This indicates that complex A in the

UGT1A8, 1A9 and 1A10 genes contains Sp1, and that complex B does not contain this


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

14

protein. These observations were confirmed by competition studies using unlabelled

UGT1A8wt, UGT1A8mut3/4 and Sp1 consensus probes. Addition of a 50-fold molar excess

of the UGT1A8wt probe decreased the formation of both complexes A and B (lane 2),

whereas addition of an equal amount of the UGT1A8mut3/4 or Sp1 con probe decreased the

formation of complex A only (lane 3 and 4). In each case, the minor complexes were not

competed out and therefore represent non-specific binding to the probe. These results implied

that complex A formation with the UGT1A8wt and UGT1A8mut3/4 probes are identical and

dependent on the binding of Sp1.

Sp1 and complex B bind to overlapping sites in the UGT1A8 Sp1/initiator-like region

Having established that bases 3 and 4 are important for both complex A and B formation

(Figure 2) and that complex A contains Sp1 (Figure 4), it appeared likely that Sp1 and

complex B were binding to overlapping regions of the Sp1/initiator-like site and that complex

B consisted of initiator-like proteins. In order to test this hypothesis, probes were synthesized

containing mutations in the regions 5’ (UGT1A8 5’mut) and 3’ (UGT1A8 3’mut) to the

Sp1/initiator site to prevent the binding of complex B and Sp1 respectively in EMSA (Figure

5). Mutation of four bases in the 3’ region inhibited Sp1 binding and increased complex B

formation (lane 2) compared with the wild type probe (lane 1). Similarly, mutation of three

bases in the 5’ region inhibited complex B formation and increased binding of the Sp1

complex (lane 3). Taken together, these results suggest that Sp1 binding is dependent on

bases 3’ of the Sp1/initiator-like site, complex B formation is dependent on bases within the

5’ region of the Sp1/initiator-like site, and that binding to their respective, overlapping sites is

competitive. To determine the identity of the proteins composing complex B, competition

studies and supershift assays were carried out using competitor oligonucleotides and

antibodies to known initiator binding proteins. In particular, the UGT1A8/1A10 initiator-like


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

15

site appeared to closely resemble Ying Yang 1 (YY1) and GA-binding protein (GABP) sites

found in the murine cytochrome c oxidase subunit Vb and cytochrome c oxidase subunit IV

promoters (38,50). However, despite extensive testing using competitor oligonucleotides

and/or antibodies to these factors and the initiator-like binding proteins USF1, USF2, TFII-I,

TafII250, c-myc and E2F-1, the identity of the proteins in complex B could not be resolved

(data not shown).

Binding of Sp1 to the overlapping Sp1/initiator-like site is not essential for UGT1A8

promoter activity

Transfection of the UGT1A8, 1A9 and 1A10 promoters and their base 3 and 4 mutants

showed that the binding of complex B was needed for maximal promoter activity (Figure 3).

To determine whether the binding of Sp1 to the Sp1/initiator-like site was essential for

UGT1A8 promoter activity, an Sp1 mutant construct corresponding to the UGT1A8 3’mutant

probe in Figure 5 was generated and tested in transfection assay. When compared to the wild-

type 1A8-1036/+45 construct (100%), the 1A8-1306/+45 3’ Sp1mut construct had slightly

elevated promoter activity (Figure 6), which most likely reflects the increase in complex B

binding to this mutant promoter (see Figure 5). This data indicates that complex B formation,

in the absence of Sp1 binding, is sufficient for maximal UGT1A8 promoter activity.

The activity of the UGT1A8 promoter is not dependent on the T-region but is enhanced by an

Sp1 binding site 30 bp upstream from the Sp1/initiator-like site.

It has previously been suggested that the UGT1A8, 1A9 and 1A10 T-region (see Figure 1)

may function as a TATA box in initiating their transcription (5). However, our data

demonstrates that UGT1A8 and 1A10 are strongly regulated through the Sp1/initiator-like

element, which is more indicative of TATA-independent transcription. In addition, the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

16

UGT1A8, 1A9 and 1A10 promoters have a conserved Sp1 site located 30 bp upstream of the

functional Sp1/initiator-like region (Figure 1). Sp1 sites are frequently found to enhance the

activity of TATA-less, initiator-containing promoters (30,31,51). Therefore, to determine the

importance of the T-region and the upstream Sp1 site in UGT1A8 and 1A10 regulation,

approximately 50 base pairs of the proximal promoters were cloned into the pGL3-basic

vector and tested in transfection assays. The proximal 50 bp promoter fragments contain the

upstream Sp1 site and Sp1/initiator-like region, but not the upstream T-region. As shown in

Figure 7A, the proximal 50bp UGT1A8 construct (1A8 –55/+45) had a moderate activity of

approximately 2.5-fold over the pGL3-basic vector. A similar result was also obtained with

the proximal 50bp UGT1A10 promoter (data not shown). This suggests that the Sp1/initiator-

like region is capable of stimulating UGT1A8 and 1A10 promoter activity in the absence of

the T-region. Mutation of three bases in the upstream Sp1 site (1A8 –55/+45 upstream

Sp1mut) significantly decreased the activity of the proximal 50 bp UGT1A8 (Figure 7A) and

1A10 (data not shown) promoters to levels similar to background (Figure 7A), indicating this

site is important in enhancing UGT1A8 and 1A10 transcription. The importance of the

upstream Sp1 site was also confirmed by experiments showing that mutation of this site in

the context of the 1kb UGT1A8 promoter construct resulted in an ~80% decrease in promoter

activity (data not shown). The binding of Sp1 to the upstream Sp1 site was confirmed by gel

shift assay with a probe corresponding to the upstream UGT1A8/10 Sp1 site (Figure 7C). The

formation of two major complexes with the UGT1A8/10 upstream Sp1 wt probe (Figure 7B,

labelled C and D, lane 1) was observed. The formation of both complexes was reduced by a

50-fold molar excess of UGT1A8/10 upstream Sp1 wt (lane 2) and Sp1 consensus (Sp1 con,

lane 3) probes. Addition of an equal amount of the UGT1A8/10 upstream Sp1 mut probe

decreased the formation of complex D, but not complex C, suggesting that complex C

formation was dependent on the intact Sp1 site (lane 4). The presence of Sp1 in complex C


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

17

was confirmed by the supershifting of complex C, but not complex D, with a monoclonal Sp1

antibody (lane 5). Taken together, these results suggest that the UGT1A8 and 1A10

promoters are regulated through an overlapping Sp1/initiator-like site, which is highly

dependent on an upstream Sp1 site, and appears to be TATA-independent.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

18

Discussion

The UGT1A gene locus represents a unique structure in which eight functional UGT1A

enzymes are encoded by a separate exon 1 alternatively spliced to a shared set of exons 2-5.

The complex, tissue-specific expression of the UGT1A genes appears to be regulated by

promoter elements in the 5’ region flanking their respective first exon. To date, only the

promoter region of the human UGT1A1 has been extensively characterised. The UGT1A1

promoter contains a functional TATA box consisting of a polymorphic TA repeat region. The

TA repeat region has been shown to vary between 5 and 8 repeats, the length inversely

correlating with the activity of the UGT1A1 promoter (52). Comparison of the UGT1A2p,

UGT1A3, UGT1A4, UGT1A5 and UGT1A6 promoters suggests that these genes have a

TATA box in a similar position to the UGT1A1 gene (7), but their function is still to be

tested. In this study, we have characterised the promoters of the UGT1A8, UGT1A9 and

UGT1A10 genes and have shown that an overlapping Sp1/initiator-like site differentially

regulates their activity. A putative TATA box (T region) located upstream of the overlapping

Sp1/initiator-like site was not essential for UGT1A8 and 1A10 promoter activity indicating

these promoters are likely to be TATA-less in Caco2 cells. In support of this hypothesis, an

Sp1 binding site upstream of the overlapping Sp1/initiator site, a common feature of TATA-

less promoters, was demonstrated to be important for UGT1A8 and 1A10 promoter activity.

However, it is possible that the T-region may function as a TATA box to regulate the

UGT1A8, 1A9 and 1A10 promoters in other cell types.

Despite the high level of sequence similarity between the proximal UGT1A8, 1A9 and 1A10

promoters (>75%), the activity of the UGT1A8 and 1A10 proximal ~1kb promoters were

shown to be 7-8 fold higher than the equivalent UGT1A9 promoter in the Caco2 colon cell


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

19

line (Figure 3). The difference in promoter activity strongly, but not entirely, correlated with

the binding of complex B to the Sp1/initiator-like site in the UGT1A8 and 1A10 genes.

Mutation of the two base differences in the UGT1A9 Sp1/initiator-like site allowed complex

B to bind, but only increased UGT1A9 promoter activity by 3-fold (still ~2.5 fold lower than

UGT1A8 and 1A10 promoter activity). These results suggest that the difference in promoter

activities of the UGT1A8/1A10 and 1A9 genes are due to the action of other activating or

repressing elements within their proximal ~1kb promoters. Interestingly, this difference in

regulation between the UGT1A8/1A10 and 1A9 genes is at least partially reflected in their

tissue-specific expression pattern. UGT1A8 and 1A10 share a common pattern of expression

in that they, in addition to UGT1A7, are the only UGT’s found to be expressed exclusively in

extrahepatic tissues (20-23). In particular, the expression of UGT1A8 and 1A10 appears to be

concentrated in the tissues of the gastrointestinal tract. UGT1A8 and UGT1A10 expression

has been detected in the small intestine and colon, with UGT1A10 also being found in the

stomach (20-23). In contrast, UGT1A9 is expressed in both the liver and extrahepatic tissues,

but its extent of expression in the gastrointestinal tract is limited to the colon (19,22).

Preliminary results in our laboratory have shown that UGT1A8, 1A9 and 1A10 are expressed

at low, but similar levels in the Caco2 colon cell line (data not shown). Therefore, it is

possible that regions upstream of the proximal promoter studied here may effectively regulate

UGT1A9 expression in the colon.

Gel shift assays showed that the UGT1A8/1A10 Sp1/initiator-like site is composed of

individual, but overlapping binding sites for Sp1 and an initiator-like protein (complex B)

(Figures 2, 4 and 5). The structure and location of the UGT1A8/1A10 Sp1/initiator-like site is

atypical of initiator elements, which generally overlap the transcription start site with the

consensus sequence Py Py A+1 N T/A Py Py (32). However, there is much accumulated


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

20

evidence suggesting that the range of elements possessing initiator function is diverse.

Studies on the mitochondrial cytochrome C oxidase genes have shown that initiator-like

elements binding Ying Yang 1 (YY1) and GA-binding proteins (GABP) proteins are able to

accurately direct transcription (38,53). The murine cytochrome c oxidase subunit Vb

(COXVb) promoter is similar to the UGT1A8 and 1A10 promoters, in that it contains an

initiator-like site that overlaps with a binding site for Sp1. The COXVb initiator-like site was

shown to competitively bind Sp1 and the initiator-like protein YY1, with the binding of YY1

being sufficient to direct transcription (38). Similarly, the binding of complex B to the

UGT1A8/1A10 Sp1/initiator-like site, in the absence of Sp1 binding, was sufficient for

UGT1A8 promoter activity (Figure 5 and 6). However, despite their apparent similarity in

function, gel shift assays with a YY1 consensus oligonucleotide probe failed to demonstrate

competition for complex B, indicating YY1 was not present in this complex (data not shown).

The UGT1A8/1A10 initiator-like site was also similar in sequence to the tandemly repeated

GABP binding sites in the cytochrome c oxidase subunit IV (COXIV) promoter (50). The

COXIV GABP sites were sufficient to activate and direct transcription initiation of the

COXIV gene in the absence of a TATA box or other initiator elements(53). However,

extensive testing using competitor oligonucleotides and/or antibodies to GABP and the

initiator-like binding proteins USF1, USF2, TFII-I, TAFII250, c-myc and E2F-1

demonstrated that these proteins were not present in complex B (data not shown). Initiator

regions have also been shown to interact directly with the multi-subunit TFIID complex, but

these interactions have only been observed in the presence of an upstream TATA box

(35,36,54). Therefore, it is likely that the protein(s) composing complex B are initiator-like

binding proteins not yet tested or identified.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

21

Transfection and gel shift assays demonstrated that an upstream Sp1 site was important for

activation of the UGT1A8 and 1A10 promoters (Figure 7). It is intriguing that the binding of

Sp1 to this site enhances promoter activity, whereas the binding of Sp1 to the Sp1/initiator-

like site is not necessary for activity. This suggests that the context in which Sp1 binds is

important for activity and that the affinity of each site for Sp1 may determine the effect of

this transcription factor on rates of transcription. Sp1 sites are frequently found in TATA-

less, initiator-containing promoters, where they enhance the activity and accuracy of

transcription initiation. Although the mechanism of Sp1-mediated activation is not fully

elucidated, Sp1 in the right context, has been demonstrated to interact with components of the

TFIID complex and stabilise their binding to initiator elements (34,55-57). Sp1 has also been

shown to interact with the initiator-like protein YY1 and synergistically enhance transcription

through the adeno-associated virus P5 initiator site (37). Our data suggests that the

UGT1A8/1A10 Sp1/initiator-like site was highly dependent on the upstream Sp1 site to

enhance promoter activity, as mutation of this Sp1 site decreased UGT1A8 promoter activity

to background levels (Figure 7A). The upstream Sp1 site was also present in the UGT1A9

promoter, but the lack of the functional Sp1/initiator-like site appeared to negate the effect of

the Sp1 site. Interestingly, UGT1A9 transcription was accurately initiated at 37 bp from the

ATG, in the absence of the functional Sp1/initiator-like site (Figure 1). The position of

UGT1A9 transcription initiation varied from UGT1A8 and 1A10, being located 10 bp

downstream of their 3’ transcription start sites. These findings suggest that the Sp1/initiator-

like site may play an important role in directing the position of transcription initiation in

UGT1A8 and 1A10, and that UGT1A9 may be regulated through a different initiator site.

The sequences surrounding the UGT1A8, 1A9 and 1A10 transcription start sites also closely

resembled the initiator consensus sequence and the importance of these sites in transcription

initiation needs to be assessed.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

22

In summary, we have characterised the UGT1A8, 1A9 and 1A10 gene promoters and

demonstrated that these genes are differentially regulated through an overlapping Sp1/

initiator-like element in their proximal promoters. The UGT1A8/1A10 initiator-like site has

several properties that are characteristic of initiator sites including its sequence similarity to

the consensus initiator site, its proximity to the transcription start site, and its dependence on

an upstream Sp1 site to promote transcription.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

23

Acknowledgements

This work was supported by grants from the Cancer Council of South Australia and the

National Health and Medical Research Council of Australia. P.I.M. is a National Health and

Medical Research Council Senior Principle Research Fellow.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

24

References

1. Dutton, G. J. (1980) Glucuronidation of drugs and other compounds, CRC Press Inc.,

Boca Raton, FL

2. Mackenzie, P. I., Owens, I. S., Burchell, B., Bock, K. W., Bairoch, A., Belanger, A.,

Fournel-Gigleux, S., Green, M., Hum, D. W., Iyanagi, T., Lancet, D., Louisot, P.,

Magdalou, J., Chowdhury, J. R., Ritter, J. K., Schachter, H., Tephly, T. R., Tipton, K.

F., and Nebert, D. W. (1997) Pharmacogenetics 7, 255-269

3. Monaghan, G., Clarke, D. J., Povey, S., See, C. G., Boxer, M., and Burchell, B.

(1994) Genomics 23, 496-499

4. Turgeon, D., Carrier, J. S., Levesque, E., Beatty, B. G., Belanger, A., and Hum, D. W.

(2000) J. Mol. Biol. 295, 489-504

5. Gong, Q. H., Cho, J. W., Huang, T., Potter, C., Gholami, N., Basu, N. K., Kubota, S.,

Carvalho, S., Pennington, M. W., Owens, I. S., and Popescu, N. C. (2001)

Pharmacogenetics 11, 357-368.

6. Tukey, R. H., and Strassburg, C. P. (2000) Annu. Rev. Pharmacol. Toxicol. 40, 581-

616

7. Ritter, J. K., Chen, F., Sheen, Y. Y., Tran, H. M., Kimura, S., Yeatman, M. T., and

Owens, I. S. (1992) J. Biol. Chem. 267, 3257-3261

8. Bernard, P., Goudonnet, H., Artur, Y., Desvergne, B., and Wahli, W. (1999) Mol.

Pharmacol. 56, 526-536

9. Emi, Y., Ikushiro, S., and Iyanagi, T. (1996) J. Biol. Chem. 271, 3952-3958

10. Metz, R. P., and Ritter, J. K. (1998) J. Biol. Chem. 273, 5607-5614

11. Sugatani, J., Kojima, H., Ueda, A., Kakizaki, S., Yoshinari, K., Gong, Q. H., Owens,

I. S., Negishi, M., and Sueyoshi, T. (2001) Hepatology 33, 1232-1238.

12. Munzel, P. A., Lehmkoster, T., Bruck, M., Ritter, J. K., and Bock, K. W. (1998) Arch.

Biochem. Biophys. 350, 72-78.

13. Xie, W., Yeuh, M. F., Radominska-Pandya, A., Saini, S. P., Negishi, Y., Bottroff, B.

S., Cabrera, G. Y., Tukey, R. H., and Evans, R. M. (2003) Proc. Natl. Acad. Sci. U. S.

A. 100, 4150-4155

14. Barbier, O., Villeneuve, L., Bocher, V., Fontaine, C., Torra, I. P., Duhem, C., Kosykh,

V., Fruchart, J. C., Guillemette, C., and Staels, B. (2003) J. Biol. Chem. 278, 13975-

13983


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

25

15. Tukey, R. H., and Strassburg, C. P. (2001) Mol. Pharmacol. 59, 405-414

16. Ritter, J. K., Crawford, J. M., and Owens, I. S. (1991) J. Biol. Chem. 266, 1043-1047

17. Mojarrabi, B., Butler, R., and Mackenzie, P. I. (1996) Biochem. Biophys. Res.

Commun. 225, 785-790

18. Harding, D., Fournel-Gigleux, S., Jackson, M. R., and Burchell, B. (1988) Proc. Natl.

Acad. Sci. U. S. A. 85, 8381-8385

19. Wooster, R., Sutherland, L., Ebner, T., Clarke, D., Da Cruz e Silva, O., and Burchell,

B. (1991) Biochem. J. 278 ( Pt 2), 465-469

20. Mojarrabi, B., and Mackenzie, P. I. (1998) Biochem. Biophys. Res. Commun. 247,

704-709

21. Strassburg, C. P., Oldhafer, K., Manns, M. P., and Tukey, R. H. (1997) Mol.


22. Strassburg, C. P., Manns, M. P., and Tukey, R. H. (1998) J. Biol. Chem. 273, 8719-

8726

23. Cheng, Z., Radominska-Pandya, A., and Tephly, T. R. (1998) Arch. Biochem.

Biophys. 356, 301-305

24. Strassburg, C. P., Nguyen, N., Manns, M. P., and Tukey, R. H. (1998) Mol.


25. Strassburg, C. P., Kneip, S., Topp, J., Obermayer-Straub, P., Barut, A., Tukey, R. H.,

and Manns, M. P. (2000) J. Biol. Chem. 275, 36164-36171

26. Brierley, C. H., Senafi, S. B., Clarke, D., Hsu, M. H., Johnson, E. F., and Burchell, B.

(1996) Adv. Enzyme Regul. 36, 85-97

27. Orphanides, G., Lagrange, T., and Reinberg, D. (1996) Genes Dev. 10, 2657-2683

28. Smale, S. T. (1997) Biochim. Biophys. Acta. 1351, 73-88

29. Carcamo, J., Buckbinder, L., and Reinberg, D. (1991) Proc. Natl. Acad. Sci. U. S. A.

88, 8052-8056

30. Smale, S. T., and Baltimore, D. (1989) Cell 57, 103-113

31. O'Shea-Greenfield, A., and Smale, S. T. (1992) J. Biol. Chem. 267, 1391-1402

32. Javahery, R., Khachi, A., Lo, K., Zenzie-Gregory, B., and Smale, S. T. (1994) Mol.

Cell. Biol. 14, 116-127

33. Lo, K., and Smale, S. T. (1996) Gene 182, 13-22

34. Kaufmann, J., and Smale, S. T. (1994) Genes Dev. 8, 821-829

35. Wang, J. C., and Van Dyke, M. W. (1993) Biochim. Biophys. Acta. 1216, 73-80


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

26

36. Bellorini, M., Dantonel, J. C., Yoon, J. B., Roeder, R. G., Tora, L., and Mantovani, R.

(1996) Mol. Cell. Biol. 16, 503-512

37. Seto, E., Shi, Y., and Shenk, T. (1991) Nature 354, 241-245

38. Basu, A., Park, K., Atchison, M. L., Carter, R. S., and Avadhani, N. G. (1993) J. Biol.

Chem. 268, 4188-4196

39. Du, H., Roy, A. L., and Roeder, R. G. (1993) EMBO J. 12, 501-511

40. Roy, A. L., Meisterernst, M., Pognonec, P., and Roeder, R. G. (1991) Nature 354,

245-248

41. Breen, G. A., and Jordan, E. M. (1998) Gene Expr. 7, 163-170

42. Cheriyath, V., Novina, C. D., and Roy, A. L. (1998) Mol. Cell. Biol. 18, 4444-4454

43. Means, A. L., and Farnham, P. J. (1990) Mol. Cell. Biol. 10, 653-661

44. Yu, M., Yang, X. Y., Schmidt, T., Chinenov, Y., Wang, R., and Martin, M. E. (1997)

J. Biol. Chem. 272, 29060-29067

45. Li, L. H., Nerlov, C., Prendergast, G., MacGregor, D., and Ziff, E. B. (1994) EMBO J.

13, 4070-4079

46. Roy, A. L., Carruthers, C., Gutjahr, T., and Roeder, R. G. (1993) Nature 365, 359-361

47. Chalkley, G. E., and Verrijzer, C. P. (1999) EMBO J. 18, 4835-4845

48. Martinez, E., Chiang, C. M., Ge, H., and Roeder, R. G. (1994) EMBO J. 13, 3115-

3126

49. Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids

Res. 17, 6419

50. Carter, R. S., Bhat, N. K., Basu, A., and Avadhani, N. G. (1992) J. Biol. Chem. 267,

23418-23426

51. Smale, S. T., Schmidt, M. C., Berk, A. J., and Baltimore, D. (1990) Proc. Natl. Acad.

Sci. U. S. A. 87, 4509-4513

52. Beutler, E., Gelbart, T., and Demina, A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95,

8170-8174

53. Carter, R. S., and Avadhani, N. G. (1994) J. Biol. Chem. 269, 4381-4387

54. Verrijzer, C. P., Chen, J. L., Yokomori, K., and Tjian, R. (1995) Cell 81, 1115-1125

55. Chiang, C. M., and Roeder, R. G. (1995) Science 267, 531-536

56. Emili, A., Greenblatt, J., and Ingles, C. J. (1994) Mol. Cell. Biol. 14, 1582-1593

57. Tanese, N., Saluja, D., Vassallo, M. F., Chen, J. L., and Admon, A. (1996) Proc. Natl.

Acad. Sci. U. S. A. 93, 13611-13616


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

27

Footnotes

1 The abbreviations used are: UGT, UDP glucuronosyltransferase; bp, base pair; kb,

kilobase(s); PCR, polymerase chain reaction; DMEM, Dulbecco’s Modified Eagles Medium;

RLM-RACE, RNA Ligase Mediated- Rapid Amplification of cDNA ends; EMSA,

Electrophoretic Mobility Shift Assay; GABP, GA-binding protein; USF, Upstream

Stimulatory Factor; YY1, Ying Yang 1


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

28

Figure Legends

FIG. 1. Alignment of the UGT1A8, 1A9 and 1A10 proximal promoters and location of

putative transcription factor binding sites. Approximately 150 bp of the proximal

UGT1A8, 1A9 and 1A10 promoters were aligned from the methionine (ATG) initiation

codon (shown in bold italics). Identical bases in the UGT1A9 and 1A10 genes compared to

the UGT1A8 gene are indicated with a period, non-identical bases with the base change, and

missing bases with a dash. The transcription start sites of each gene are marked with a bold

base. The putative Sp1 sites, initiator binding site, and the T-region are boxed. Several base

differences near the overlapping Sp1/initiator-like site have been highlighted (numbered 1-4).

FIG. 2. Electrophoretic mobility shift assay of the UGT1A8, 1A9 and 1A10

Sp1/initiator-like region. A, Double-stranded oligonucleotide probes (50,000cpm)

corresponding to wild-type and mutant UGT1A8, 1A9 and 1A10 Sp1/initiator-like regions (-

34/+8 of UGT1A8) were incubated with 5µg Caco2 nuclear extracts and resolved on a 4%

non-denaturing polyacrylamide gel. The two major complexes, A and B, are indicated with

arrows, and the minor complexes are bracketed (labelled with an asterisk). B, Sequences of

the sense strand of the oligonucleotide probes used in A are shown. Identical bases are

marked with a dash and mutations at positions 1-4 are indicated by the appropriate nucleotide

change. The overlapping Sp1/initiator-like site has been boxed.

FIG. 3. Expression of the UGT1A8, 1A9, and 1A10 wild-type and Sp1/initiator-like

mutant proximal promoters in Caco2 cells. Promoter constructs containing the proximal

1kb of the UGT1A8, 1A9 and 1A10 genes were generated as described in the “Experimental

Procedures”. The length of each promoter is expressed relative to the most 5’ transcription

start site (being designated +1). Mutations of bases 3 and 4 were generated by site directed


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

29

mutagenesis as described in “Experimental Procedures”. 0.5µg of the wild-type (black bars),

base 3 mutant (white bars), base 4 mutant (gray bars), and base 3 and 4 double mutant

(hatched bars) promoter constructs were transfected into Caco2 cells with 0.025µg of the

pRL-null vector as an internal control of transfection efficiency. Cells were harvested 48

hours post-transfection and assayed for firefly and renilla luciferase activities. Relative

luciferase activities are expressed as a fold-induction over the promoterless pGL3-basic

vector (set at a value of 1). The results shown are a representative experiment of three

individual experiments performed in triplicate (± SD).

FIG. 4. Sp1 binds to the UGT1A8, 1A9 and 1A10 Sp1/initiator-like region. Double-

stranded oligonucleotide probes (50,000cpm) corresponding to the UGT1A8 and 1A9

Sp1/initiator-like regions (see Figure 2B) were incubated with 5µg Caco2 nuclear extracts

and resolved on a 4% non-denaturing polyacrylamide gel. Unlabelled competitor

oligonucleotides were added at a 50-fold molar excess before the addition of labelled probe.

The Sp1 monoclonal antibody was added after the addition of labelled probe and incubated

for 30 minutes before loading. The two major complexes, A and B, are labelled with arrows.

FIG. 5. Sp1 and complex B competitively bind to the UGT1A8 Sp1/initiator-like region.

A, Double-stranded oligonucleotide probes (50,000cpm) corresponding to the UGT1A8

Sp1/initiator-like region (wild-type and mutant) were incubated with 5µg Caco2 nuclear

extracts and resolved on a 4% non-denaturing polyacrylamide gel. The two major complexes,

A and B, are labelled with arrows. B, Sequences of the sense strand of the oligonucleotide

probes used in A are shown. Identical bases are marked with a dash and the nucleotide

changes are indicated by the base shown. The overlapping Sp1/initiator-like site has been

boxed.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

30

FIG. 6. Sp1 binding to the UGT1A8 Sp1/initiator-like region is not essential for

promoter activity. An Sp1 mutant promoter construct with the same sequence as the

UGT1A8 3’mutant probe (Figure 5B) was generated as described in the “Experimental

Procedures”. 0.5µg of the wild-type and mutant promoter constructs were transfected into

Caco2 cells with 0.025µg of the pRL-null vector as an internal control of transfection

efficiency. Cells were harvested 48 hours post-transfection and assayed for firefly and renilla

luciferase activities. The relative luciferase activities of the mutant construct is expressed as a

percentage change in promoter activity relative to the wild-type construct (set at a value of

100%). The results shown are a representative experiment of three individual experiments

performed in triplicate (± SD).

FIG. 7. An Sp1 site upstream of the Sp1/initiator-like site enhances UGT1A8 promoter

activity. A, A promoter construct containing the proximal 55 bp of the UGT1A8 promoter

was generated as described in the “Experimental Procedures”. A promoter construct of equal

length containing a mutated upstream (5’) Sp1 site was generated as above using a forward

primer with a three base mutation in the Sp1 site (1A8-55mut5’Sp1for; Table 1). 0.5µg of the

wild-type and 5’ Sp1mutant promoter constructs were transfected into Caco2 cells with

0.025µg of the pRL-null vector as an internal control of transfection efficiency. Cells were

harvested 48 hours post-transfection and assayed for firefly and renilla luciferase activities.

Relative luciferase activities are expressed as a fold-induction over the promoterless pGL3-

basic vector (set at a value of 1). The results shown are a representative experiment of two

individual experiments performed in triplicate (± SD). B, The UGT1A8/10 5’ Sp1 wild-type

(wt) probe (50,000cpm) was incubated with 5µg Caco2 nuclear extracts and resolved on a 4%

non-denaturing polyacrylamide gel. Unlabelled competitor oligonucleotides were added at a


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

31

50-fold molar excess before the addition of labelled probe. The Sp1 monoclonal antibody was

added after the addition of labelled probe and incubated for 30 minutes before loading. The

two major complexes, C and D, are labelled with arrows. C, Sequences of the sense strand of

the UGT1A8/10 5’ Sp1 wild-type and mutant (mut) probes are shown. Identical bases are

marked with a dash and the Sp1 mutation is indicated by the base changes. The 5’ Sp1 site

has been boxed.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Table 1 Primers used to create luciferase promoter constructs and mutants The proximal ~1kb UGT1A8, 1A9 and 1A10 promoters were amplified by PCR using the 1A8-1034for, 1A9-1000for and 1A10-1036for forward primers, with the 1A8/10rev and1A9rev reverse primers respectively. Resulting PCR products were subsequently cloned into the pGL3-basic vector (see “Experimental Procedures”). The wild-type and upstream Sp1 mutant 1A8-55/+45 regions were amplified using the 1A8-55for and 1A8-55mut5’Sp1for forward primers with the 1A8/10rev reverse primer and subsequently cloned into the pGL3 vector (see “Experimental Procedures”). Mutations in the UGT1A8, 1A9 and 1A10 Sp1/initiator-like regions were generated using the remaining forward and reverse primer pairs according to the Quikchange site directed mutagenesis kit (Stratagene). Mutations are represented by a bold base and the restriction sites used for cloning are underlined.

Primer Nucleotide Sequence 1A8-1034for 5’- TTTTGGTACCTACGTTTAAACAACCAG -3’ 1A9-1000for 5’- ACGCATCTGCAGGTTCTTGCCGAAGCCTTC -3’ 1A10-1036for 5’- CTGGGGTACCTGTACTGTCGTATAC -3’ 1A8/10rev 5’- AGCCACGCGTGAACTGCAGCCCGAGCC -3’ 1A9rev 5’- AGCCATCTCGAGCAGAGAACTGCAGCTGAGAGC -3’ 1A8mut3for 5’- GTGCCTGTAGTTCTCCCGCCTACTGTATCATAGC -3’ 1A8mut3rev 5’- GCTATGATACAGTAGGCGGGAGAACTACAGGCAC -3’ 1A8mut4for 5’- GTGCCTGTAGTTCTTCCACCTACTGTATCATAGCAGC -3’ 1A8mut4rev 5’- GCTGCTATGATACAGTAGGTGGAAGAACTACAGGCAC -3’ 1A8mut3/4for 5’- GTGCCTGTAGTTCTCCCACCTACTGTATCATAGC -3’ 1A8mut3/4rev 5’- GCTATGATACAGTAGGTGGGAGAACTACAGGCAC -3’ 1A9mut3for 5’- GTGCTGGTATTTCTTCCACCTACTGTATCATAGGAGC -3’ 1A9mut3rev 5’- GCTCCTATGATACAGTAGGTGGAAGAAATACCAGCAC -3’ 1A9mut4for 5’- GTGCTGGTATTTCTCCCGCCTACTGTATCATAGGAGC -3’ 1A9mut4rev 5’- GCTCCTATGATACAGTAGGCGGGAGAAATACCAGCAC -3’ 1A9mut3/4for 5’- GTGCTGGTATTTCTTCCGCCTACTGTATCATAGGAGC -3’ 1A9mut3/4rev 5’- GCTCCTATGATACAGTAGGCGGAAGAAATACCAGCAC -3’ 1A10mut3/4for 5’- GTGCCTGTACTTCTCCCACCTACTGTATCATAGC -3’ 1A10m3/4rev 5’- GCTATGATACAGTAGGTGGGAGAAGTACAGGCAC -3’ 1A8mut3’Sp1for 5’- GCCTGTAGTTCTTCCGCCTTGGGTGTCATAGCAGCTTAGAATCC -3’ 1A8mut3’Sp1rev 5’- GGATTCTAAGCTGCTATGACACCCAAGGCGGAAGAACTACAGGC-3’ 1A8-55for 5’- TTTTGGTACCATACACGCCCTCTATTG -3’ 1A8-55mut5’Sp1for 5’- TTTTGGTACCATACATAACCTCTATTGGGGTCA -3’


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

by guest on February 16, 2018 http://www.jbc.org/ Downloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Peter I. MackenziePhilip A.. Gregory, Dione A. Gardner-Stephen, Rikke H. Lewinsky, Kym N. Duncliffe and

gene promoters. Differential regulation through an initiator-like regionCloning and characterization of the UDP glucuronsyltransferase 1A8, 1A9 and 1A10

published online July 7, 2003J. Biol. Chem.

10.1074/jbc.M305565200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M305565200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M305565200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/07/07/jbc.M305565200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/07/07/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/07/07/jbc.M305565200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

Cloning and Characterization of the human UDP