718 Research Article

IntroductionCilia are highly evolutionarily conserved organelles. They canmediate many different sensory functions, which are dependent onthe cell type on which they are located (Berbari et al., 2009;Silverman and Leroux, 2009). In addition, cilia function in motilityat the level of both single-celled and multicellular organisms.Despite this array of functions, the basic structure of cilia appearsto be highly conserved irrespective of cell type (Pedersen et al.,2008; Rosenbaum and Witman, 2002). Cilia are nucleated from amother centriole/basal body and contain a ring of nine microtubuledoublets that run along the length of the cilium, known as theciliary axoneme. Some motile cilia also have a central microtubulepair to facilitate cilia bending. Early studies in the biflagellateChlamydomonas reinhardtii identified two intraflagellar transport(IFT) protein complexes (Complex A and Complex B), whichappear to traffic large protein aggregates or rafts from the basalbody to the distal tip of the cilium and back (Rosenbaum andWitman, 2002). It has been demonstrated that these IFT proteinsare highly conserved evolutionarily and many are required for ciliaformation, whereas others function peripherally to direct specificcargo into the cilia.

Despite the growing understanding of IFT function and ciliaassembly, there is much to learn about the regulation of ciliarytrafficking. Specifically, the primary cilium is believed to bebiochemically distinct from other subcellular compartments withrespect to protein and lipid content. Thus the cilia are able tospecifically segregate cilia proteins from non-cilia proteins(Rosenbaum and Witman, 2002). This segregation via

compartmentalization provides a mechanism that allows forexquisite regulation of cilia-mediated signaling (Pazour andBloodgood, 2008). How the cilia regulate import and export ofproteins is still unclear, but it might involve an electron-dense areaat the base of the cilia, which is known as the transition zone. Thisarea might function in a similar fashion to the tight junctions ofepithelia, which specifically segregate apical from basolateralplasma membrane domains by preventing the admixture by lateraldiffusion of membrane proteins from each domain. The ciliatransition zone might also function in a similar manner to thenuclear pore complex (NPC), a multi-protein complex that allowsthe regulated import and export of specific proteins between thecytosol and nucleus (Rosenbaum and Witman, 2002).

Indeed, a role for a transport mechanism to cilia and centrosomesthat appears to use the nuclear transport system involving Ran andImportin proteins has recently been uncovered. One study focusedon cilia and pericentrosomal trafficking by a splice variant of theCrumbs3 polarity protein (Fan et al., 2007). Another more recentwork focused on Kif17, a motor that is important in IFT (Dishingeret al., 2010). These cilia-targeted proteins appear to use classicalnuclear localization signals to mediate their transport. However,several other protein motifs have also been identified that facilitatetrafficking of proteins to the cilia (Pazour and Bloodgood, 2008).Most notably, a VxPx motif has been identified in Polycystin-2,CNGB1b and Rhodopsin, and is necessary for localization of theseproteins to cilia (Geng et al., 2006; Jenkins et al., 2006; Mazelovaet al., 2009). Recent work in the retina identified that this motifmight be bound by the small GTPase Arf4 (ADP-ribosylation

SummaryCiliopathies represent a newly emerging group of human diseases that share a common etiology resulting from dysfunction of thecilium or centrosome. The gene encoding the retinitis pigmentosa 2 protein (RP2) is mutated in X-linked retinitis pigmentosa. RP2localizes to the ciliary base and this requires the dual acylation of the N-terminus, but the precise mechanism by which RP2 istrafficked to the cilia is unknown. Here we have characterized an interaction between RP2 and Importin 2 (transportin-1), a memberof the Importin- family that regulates nuclear–cytoplasmic shuttling. We demonstrate that Importin 2 is necessary for localizationof RP2 to the primary cilium because ablation of Importin 2 by shRNA blocks entry both of endogenous and exogenous RP2 to thecilium. Furthermore, we identify two distinct binding sites of RP2, which interact independently with Importin 2. One binding siteis a nuclear localization signal (NLS)-like sequence that is located at the N-terminus of RP2 and the other is an M9-like sequencewithin the tubulin folding cofactor C (TBCC) domain. Mutation of the NLS-like consensus sequence did not abolish localization ofRP2 to cilia, suggesting that the sequence is not essential for RP2 ciliary targeting. Interestingly, we found that several missensemutations that cause human disease fall within the M9-like sequence of RP2 and these mutations block entry of RP2 into the cilium,as well as its interaction with Importin 2. Together, this work further highlights a role of Importin 2 in regulation of the entry ofRP2 and other proteins into the ciliary compartment.

Key words: Cilia, Importin, RP2, Retinitis pigmentosa

Accepted 25 October 2010Journal of Cell Science 124, 718-726 © 2011. Published by The Company of Biologists Ltddoi:10.1242/jcs.070839

Localization of retinitis pigmentosa 2 to cilia isregulated by Importin 2Toby W. Hurd1,*, Shuling Fan1,* and Ben L. Margolis1,2,‡

1Department of Internal Medicine, University of Michigan, Ann Arbor, MI 48109, USA2Department of Biological Chemistry, University of Michigan, Ann Arbor, MI 48109, USA*These authors contributed equally to this work‡Author for correspondence (bmargoli@umich.edu)

Jour

nal o

f Cel

l Sci

ence

factor 4). Furthermore, in conjunction with Rab11, FIP3 andASAP1 (Arf-GAP with SH3 domain, ANK repeat and PH-domain-containing protein 1), Arf 4 appears to regulate thebudding of cilia-destined vesicles from the trans-Golgi (Mazelovaet al., 2009).

In this paper, we focus on mechanisms that mediate thetrafficking of retinitis pigmentosa 2 (RP2, also known as proteinXRP2) to the cilia. RP2 is an X-linked gene that, when mutated,gives rise to retinitis pigmentosa (Hardcastle et al., 1999). The RP2gene encodes a 350 residue polypeptide that appears to beubiquitously expressed. Previous work has demonstrated that RP2is membrane-associated by dual acylation of the N-terminus,namely myristoylation at Gly2 and palmitoylation at Cys3 (Chappleet al., 2002). The N-terminal half of RP2 has both sequence andstructural similarity to Tubulin cofactor C (TBCC), a protein thatis involved in the formation of -tubulin–-tubulin heterodimers.Further work has shown that this domain binds and has GAPactivity towards the small G-protein Arl3 (Veltel et al., 2008).Most recently RP2 has been demonstrated to traffic to the ciliarybase and proposed to have a role in Golgi-to-cilia membranedelivery through its regulation of Arl3 (Evans et al., 2010). Toexamine the mechanism by which RP2 traffics to cilia, weperformed large-scale purification of RP2 and associated proteinsfrom renal epithelia. Using this approach, we identified Importin2 as a binding partner of RP2 that appears to regulate RP2trafficking into the cilia. This work adds further support to therecent findings that Importin proteins have a role in cilia trafficking.

ResultsRP2 localizes to primary cilium in epitheliaIt has been demonstrated that RP2 localizes to ciliary basal bodiesin several different cell types (Evans et al., 2010). Our laboratoryhas studied RP2 localization in MDCK cells. We consistentlyfound both endogenous RP2 (Fig. 1A) and exogenous EGFP-tagged RP2 (Fig. 1B) localized to primary cilia in fully polarizedMDCK cells. Confocal microscope images demonstrated that besideits ciliary localization, the exogenously expressed RP2–EGFP alsolocalized to both apical and basal membranes in polarized MDCKcells (Fig. 1C).

RP2 forms a complex with Importin-To elucidate the mechanism by which RP2 is trafficked to thecilium, a proteomic approach was adopted to identify newinteracting proteins. MDCK cells stably expressing either emptyvector (pQCXIP) or FLAG-tagged RP2 were generated (RP2–FLAG). Tandem mass spectrometry (MS) analysis of proteins thatco-immunoprecipitated with RP2–FLAG identified several proteinsincluding Importin 2 (Transportin-1), Importin 3 and -tubulin(Fig. 2A and supplementary material Table S1). These interactionswere confirmed by western blotting of RP2–FLAGimmunoprecipitates. All three endogenous proteins, Importin 2,Importin 3 and -tubulin, co-immunoprecipitated with RP2–FLAG (Fig. 2B). We have previously demonstrated that Importin1 interacts with another cilia protein, Crumbs3–CLP1, so weanalyzed whether Importin 1 also interacted with RP2 (Fan et al.,2007). Indeed, endogenous Importin 1 also efficiently co-immunoprecipitated with RP2–FLAG (Fig. 2B). Next, we examinedwhether these Importin proteins could co-immunoprecipitateendogenous RP2. MDCK cells were generated stably expressingMyc-tagged Importin 1, Importin 2 and Importin 3. Usingthese cells, we demonstrated that immunoprecipitation of the

719Importin 2 and RP2

Importin proteins with an anti-Myc antibody, but not a controlanti-HA antibody, could efficiently co-immunoprecipitateendogenous RP2 (Fig. 2C). To further test these interactions, RP2–FLAG and the Myc-tagged Importin proteins were transientlytransfected into HEK293 cells and anti-FLAG immunoprecipitationperformed. Interestingly, in this cell type, although none of theImportin proteins co-immunoprecipitated in the absence of RP2–FLAG, only Importin 2 co-immunoprecipitated with RP2–FLAG(Fig. 2D), suggesting that it is the major Importin binding partnerof RP2. Furthermore, GST–Importin-2 was able to precipitateendogenous RP2 from MDCK cell lysates (see below).

Importin 2 localizes to centrosome and ciliumWe examined the subcellular localization of Importin 2 in MDCKcells. When MDCK cells stably expressing Myc-tagged Importin2 were grown on Transwell filters for 7 days after confluence,Myc–Importin-2 was distributed in a punctate fashion along thelength of the ciliary axoneme (Fig. 3A). This was similar to what

Fig. 1. RP2 localizes to primary cilium in epithelia. (A)Endogenous RP2localizes to primary cilia in MDCK cells. MDCK cells were grown onTranswell filters for 7 days after confluence. Cells were then fixed andimmunostained with rabbit anti-RP2 antibody (green) and mouse anti-polyglutamylated tubulin (red) and nuclei were stained with DAPI (blue).(B)RP2–EGFP localizes to primary cilia. Fully polarized MDCK cells stablyexpressing RP2–EGFP (green) were stained with polyglutamylated tubulin(red, top panel) or g-tubulin (red, bottom panel). (C)RP2–EGFP localizes toboth apical and basolateral membranes. Fully polarized RP2–EGFP MDCKcells were fixed and stained with DAPI to indicate nuclei. Representative z-projections are shown. Scale bars: 10m.

Jour

nal o

f Cel

l Sci

ence

was observed in Odora cells (Dishinger et al., 2010). Next, weexamined the localization of Myc-tagged Importin 2 insubconfluent MDCK cells (1 day) and fully polarized MDCK cells(7 days). In these cells, Myc-tagged Importin 2 appeared to bealmost exclusively localized to the nucleus (Fig. 3B, top) atsubconfluence. However, as the cells became fully polarized, aredistribution of Myc–Importin-2 to a subapical region wasobserved (Fig. 3B, bottom). It is important to note that we used0.1% Triton X-100 to detect cilia staining of Importin 2, whereasto detect nuclear and cell body staining, we used 0.25% Triton X-100.

We have previously shown that Importin 1 and the polarityprotein Crumbs3–CLP1 interact and colocalize at centrosomes inmitotic cells and in primary cilium in fully polarized MDCK cells(Fan et al., 2007). Accordingly, we next examined whether Importin

720 Journal of Cell Science 124 (5)

Fig. 2. RP2 forms a complex with Importin proteins. (A)Large-scaleprotein purification of RP2-interacting proteins. MDCK cells stably expressingeither empty vector (pQCXIP) or RP2–FLAG were lysed andimmunoprecipitated with immobilized FLAG antibody. Immunoprecipitateswere extensively washed and separated by Bis-Tris PAGE. Resulting gels weresilver stained and bands of interest excised and submitted for MS/MS analysis.(B)RP2–FLAG was immunoprecipitated from stable MDCK cells and theimmunoprecipitates were subjected to Bis-Tris PAGE and blotted with theindicated antibodies. (C)MDCK cells stably expressing Myc-tagged Importin1, Importin 2 or Importin 3 were immunoprecipitated with either anti-HA(control) or anti-Myc antibody. Immunoprecipitates were subjected to Bis-TrisPAGE and western blotted with the antibodies indicated. (D)HEK293 cellswere transiently transfected with RP2–FLAG and Myc-tagged Importin 1,Importin 2 or Importin 3, respectively. Then cells were lysed andimmunoprecipitated with anti-FLAG antibody and immunoprecipitates weresubjected to Bis-Tris PAGE and blotted with the indicated antibodies.

Fig. 3. Importin 2 localizes to primary cilia and centrosomes inepithelia. (A)Importin 2 localizes to cilia. MDCK cells stably expressingMyc-tagged Importin 2 were grown on Transwell filters for 7 days afterconfluence, fixed with 4% paraformaldehyde, permeabilized with 0.1%Triton X-100 and stained with anti-Myc antibody (green) and anti-polyglutamylated tubulin antibody (red). (B)Importin 2 translocates fromnuclear to subapical regions during polarization in MDCK cells. MDCK cellsstably expressing Myc–Importin 2 were seeded onto Transwell filters andgrown for the times indicated (1 day or 7 days). Cells were then fixed,permeabilized with 0.25% Triton X-100 and immunostained with antibodiesagainst Myc (green) and ZO-1 (red); nuclei were stained with DAPI (blue).Images were captured by the confocal microscope to assemble X-Y and Z-stack images. (C)Importin 2 co-sediments with purified centrosomes.Centrosomes were isolated from fully polarized MDCK cells and separatedon a discontinuous sucrose gradient. Gradients were fractionated andfractions subjected to Bis-Tris PAGE and western blots probed with theindicated antibodies. Lysate (1%) is shown on the right. Actin control in thebottom panel indicates centrosomal fractions have minimal contamination bythe cytoskeleton. (D)Importin 2 localizes near centrosomes in confluentMDCK cells. MDCK cells were grown for 7 days after confluence onTranswell filters. Cells were then fixed with acetone and stained withantibodies against pericentrin (red) and Importin 2 (green). Nuclei werevisualized with DAPI (blue). Shown are X-Y and Z projections, respectively.(E)GFP–Importin-2 localizes to spindle poles. MDCK cells stablyexpressing GFP–Importin-2 (green) were seeded at low confluence oncoverslips. Cells were then fixed with acetone and centrosomes stained withanti-g-tubulin (red); nuclei are stained with DAPI (blue). (F)RP2–EGFPlocalizes to a pericentrosomal region during cell division. MDCK cells stablyexpressing RP2–EGFP (green) were treated as in E. Scale bars: 10m.

Jour

nal o

f Cel

l Sci

ence

2 is also associated with centrosomal fractions. We purifiedcentrosomes from confluent MDCK cells and examined whetherImportin 2 would co-sediment with the centrosome marker g-tubulin using a discontinuous sucrose gradient. Indeed, in the highdensity g-tubulin-positive fractions, enrichment of endogenousImportin 2 was observed (Fig. 3C). We used actin as a control toshow that this high-density g-tubulin fraction was not contaminatedby cytoskeletal components. In addition, when we looked at thelocalization of endogenous Importin 2 in confluent MDCK cells,it appeared that a subfraction localized to centrosomes (Fig. 3D).We next examined the localization of RP2 and Importin 2 inmitotic cells. A fraction of exogenously expressed EGFP–Importin-2 was enriched at the spindle poles of mitotic cells, as shown bycolocalization with the centrosome marker g-tubulin (Fig. 3E). Inaddition, EGFP-tagged RP2 was localized to a pericentrosomalregion (Fig. 3F), similarly to our previously reported data forCrumbs3–CLP1 and Importin 1 (Fan et al., 2007).

RP2 interacts with the C-terminus of Importin 2GST fused full-length Importin 2 was able to pull downendogenous RP2 (Fig. 4A). We examined which region of Importin2 was involved in the interaction with RP2. Importin proteinsshare a similar domain architecture with an N-terminal Ran-bindingdomain (RBD) followed by HEAT and Armadillo repeats (Fig.4C). Because the RBD mediates binding of the GTP-bound formof the small GTPase Ran to Importin proteins, we next testedwhether constitutively active Ran (Ran Q69L) could precipitate acomplex of Importin 2 and RP2. Importin 2 was efficientlyprecipitated by WT and Q69L Ran, but no RP2 was present in thecomplex (Fig. 4B). This is consistent with the ability of Ran-GTPto dissociate cargo from Importin . To examine which region ofImportin 2 is necessary for the interaction with RP2, a series ofImportin 2 N-terminal truncations were generated (Fig. 4C). Aspreviously demonstrated, full-length (FL) Myc–Importin-2 wasco-immunoprecipitated by RP2–FLAG (Fig. 4D). However,deletion of either the first 320 residues of Importin 2,encompassing the RBD and first set of HEAT repeats, or the first546 residues did not abolish this interaction (Fig. 4D). These datasuggest that the C-terminal domain of Importin 2 is sufficient tobind RP2, as has been shown with other cargoes (Stewart, 2007).

Knockdown of Importin 2 blocks RP2 ciliary targetingNext, we wanted to test the roles of Importin 2 in targeting of RP2to the cilium. We used two shRNA targeting sequences to knockdown Importin 2 and test its role in the ciliary targeting ofendogenous RP2 and RP2–EGFP in MDCK cells. Both of theshRNAs sufficiently reduced Importin 2 without affectingexpression of Importin 1 and RP2 (Fig. 5A). Cells without Importin2 grew normally, but RP2 did not travel efficiently to the cilia whenImportin 2 expression levels were reduced (Fig. 5B). We nextgenerated stably expressing RP2–EGFP cells by co-infecting RP2–EGFP into control shRNA and Importin 2 shRNA cells. Afterselection with G418, expression levels of Importin 2 were stillsuppressed, whereas expression of RP2–EGFP was similar in controland Importin 2 shRNA cells (supplementary material Fig. S1A,B).RP2–EGFP ciliary targeting was markedly reduced in cells in whichImportin 2 was knocked down (Fig. 5C). This lack of cilia targetingin knockdown cells was not related to cilia length or RP2–EGFPexpression (supplementary material Fig. S1C). These results arequantified in Fig. 5D, indicating significant impairment of RP2ciliary targeting after knockdown of Importin 2.

721Importin 2 and RP2

Binding sites on RP2 for Importin 2Importin complexes regulate the trafficking of proteins betweenthe cytosol and the nucleus. Proteins destined for the nucleuscontain a nuclear localization signal (NLS) consisting of either asingle cluster (monopartite) or two clusters (bipartite) of basicamino acid residues. Examination of the sequence of RP2 revealeda highly conserved basic cluster at the N-terminus resembling theconsensus K-R/K-x-K/R monopartite NLS (Fig. 6A). Followingthis putative NLS is a string of acidic residues that have previouslybeen shown to improve the efficacy of other NLS sequences (Fig.6A). This type of NLS sequence can bind Importin- proteins, butalso can bind directly to Importin- proteins (Jkel and Grlich,1998). To test whether this sequence mediates the interactionbetween RP2 and Importin 2, a series of expression constructswere generated driving expression of the N-terminus of RP2 fused

Fig. 4. RP2 interacts with the C-terminus of Importin 2. (A)GST–Importin 2 precipitates endogenous RP2. MDCK lysates were subjected toGST pull-down with either GST alone or GST–Importin-2 and subjected toBis-Tris PAGE. Western blots were probed with indicated antibodies.(B)Ran does not precipitate RP2. MDCK lysates were subjected to GSTpull-down with GST alone, wild-type (WT) Ran, dominant-negative (T24N)Ran or constitutively active (Q69L) Ran. Precipitates were analyzed as in A.(C)Schematic diagram showing domain organization of Importin 2 (RBD,Ran-binding domain; HEAT HEAT repeat) and N-terminal truncations.(D)The C-terminus of Importin 2 is sufficient to interact with RP2.HEK293 cells were transiently transfected with RP2–FLAG and either Myc-tagged Importin 2 full-length (FL), Importin 2 lacking the N-terminal 320residues (321-END) or the N-terminal 546 residues (547-END). Cells werelysed and subjected to FLAG immunoprecipitation. Immunoprecipitateswere subjected to Bis-Tris PAGE and blots probed with the antibodiesindicated.

Jour

nal o

f Cel

l Sci

ence

to EGFP. GST–Importin-2 pull down from HEK293 lysatestransfected with these constructs revealed that the first 15 residuesof RP2 are sufficient to mediate the interaction with Importin 2(Fig. 6B). In addition, the RP2–EGFP 1–15 fusion protein isefficiently trafficked to the primary cilium in MDCK cells(supplementary material Fig. S2A).

It has been previously demonstrated that targeting of RP2 to theplasma membrane requires myristoylation and palmitoylation ofGly2 and Cys3, respectively (Chapple et al., 2002). Furthermore,lipid modification is also required for targeting of RP2 to the basalbody (Evans et al., 2010). Thus we examined whether thesemodifications are also necessary for the interaction with Importin2. When HEK293 cells were co-transfected with Myc-taggedImportin 2 with WT, G2A point mutant (which blocksmyristoylation and palmitoylation) or the C3S point mutant (whichblocks only palmitoylation) and a R118H mutant (which blocksinteraction with the small GTPase Arl3) (Khnel et al., 2006) ofRP2–FLAG, both WT and R118H were efficiently co-immunoprecipitated with Myc–Importin-2. However, neither theG2A nor C3S mutants co-immunoprecipitated with Importin 2(supplementary material Fig. S2B). These results suggest that

722 Journal of Cell Science 124 (5)

membrane association of RP2 is a prerequisite for formation of anRP2–Importin-2 complex.

We further examined the RP2 sites required for interaction withImportin 2. MDCK cells were transfected with the followingFLAG-tagged RP2 mutants: G2A, an N-terminal deletion of thefirst 20 amino acids, the NLS mutant that converted KRRK toAAAA, R118H and another mutation in the C-terminus, R282W(Thiselton et al., 2000). Removal of the first 20 amino acids orlipid modification (G2A) severely impaired binding to Importin 2(Fig. 6C) as expected from the results previously obtained inHEK293 cells (supplementary material Fig. S2B).

At this point, we thought that Importin 2 would bind RP2through the N-terminal NLS sequence. Surprisingly, we found thatmutation of this polybasic NLS sequence (KRRK to AAAA) withoutmutating the sites of lipid modification did not abolish Importin 2binding (Fig. 6C). This indicated that RP2 must have an alternativeImportin 2 binding site. Another binding site for Importin 2 isthe M9 sequence found in heteronuclear ribonucleoprotein A1(hnRNPA1) (Pollard et al., 1996). Indeed, we found an M9-core-like sequence in RP2 (Fig. 6D), which appeared to be essential forImportin 2 binding to RP2 because point mutants of the M9

Fig. 5. Loss of Importin 2 inhibits RP2 ciliary trafficking.(A)Stable knockdown of endogenous Importin 2. MDCKcells were infected with retrovirus directing expression of twodifferent canine Importin 2 shRNAs or a control shRNA(luciferase shRNA) and stable pools were selected. Lysateswere subjected to Bis-Tris PAGE and blotted with theantibodies indicated. (B)Knockdown of Importin 2significantly reduces ciliary localization of endogenous RP2.Control shRNA (top panel) and Importin 2 shRNA (bottompanel) infected MDCK cells were grown for 7 days afterconfluence on Transwell filters, fixed and stained withantibodies against RP2 (green) and polyglutamylated tubulin(red). (C)Ablation of Importin 2 blocks ciliary localizationof exogenous RP2-EGFP. MDCK cells infected with controlshRNA (upper panel) and Importin 2 shRNA-2 (bottompanel) were stably transfected with RP2–EGFP (green) andtreated as in B. M-1 represents high magnification of RP2-EGFP in control shRNA cells and M-2 represents RP2–EGFPin Importin 2 shRNA cells. (D)Quantification of results fromexperiments depicted in C. 100 ciliated RP2–EGFP cells eachfrom control shRNA, Importin 2 shRNA1 and shRNA2 wereevaluated. Results represent the mean of three individualexperiments, shown as mean ± s.d. Scale bars: 10m.

Jour

nal o

f Cel

l Sci

ence

consensus residues of RP2 (C86Y, P95L or C108G) abolished theinteraction with Importin 2 (Fig. 6E). Interestingly, these residueshave been found to be mutated in patients with retinitis pigmentosa(Sharon et al., 2000). This suggests that the M9 sequence is part ofthe main Importin 2 binding site in RP2 because mutation in thissite severely reduced binding and the polybasic NLS binding sitewas unable to compensate for this.

The interaction between Importin 2 and M9 sequence ofRP2 is crucial for RP2 ciliary targetingThe results of the binding experiments correlated well whentrafficking of RP2 to the cilia was studied. As shown in Fig. 7A,mutation of the polybasic NLS region did not block Importin 2binding and did not prevent targeting to the cilia. By contrast,mutations within the M9 sequence blocked both Importin 2binding and cilia targeting (Fig. 7B).

723Importin 2 and RP2

DiscussionMutation of RP2 leads to retinitis pigmentosa but the exact role ofRP2 in photoreceptors is unclear (Evans et al., 2006). Recent workhas demonstrated that RP2 binds to the small G protein ARL3(Bartolini et al., 2002) and has GAP activity towards this GTPase(Veltel et al., 2008). A recent study (Evans et al., 2010)demonstrated that RP2 localizes to the basal body and is involvedin Golgi to ciliary base trafficking. In addition to basal bodystaining, we found that RP2 localized throughout the cilia in renalepithelial cells.

In this manuscript, we identified the binding of RP2 to Importin2 and found that this binding appears important in regulating thetargeting of RP2 to cilia. Importin proteins have been classicallythought to regulate nuclear traffic (for a review, see Stewart, 2007).Importin 1 uses Importin- proteins as adaptors to bind topolybasic NLS sequences on proteins to be imported into the

Fig. 6. Two distinct binding sites of RP2 interact independently with Importin 2. (A) The N-terminus of RP2 contains a nuclear localization signal (NLS)-likesequence. Blue, basic residues; red, acidic residues. (B)The first 15 residues of RP2 can interact with Importin 2. HEK293 cells were transiently transfected withEGFP alone, full-length RP2–EGFP or residues 1–15, 1–25 or 1–50 of RP2 fused to EGFP. Cell lysates were subjected to precipitation with GST–Importin-2.Precipitates were subjected to Bis-Tris PAGE and blots were probed with indicated antibodies. (C)Wild-type and mutant FLAG-tagged RP2 constructs weretransfected into MDCK cells. Lysates were than immunoprecipitated with anti-FLAG antibodies and lysates (input) or FLAG immunoprecipitates were resolved onBis-Tris gels. After transfer to nitrocellulose, the blots were probed with antibodies against Importin 2 (ImpB2) and FLAG. (D)RP2 contains an M9-likesequence. Alignment of a sequence from RP2 and the classic M9 sequence found in hnRNPA1 and the consensus M9 sequence that can mediate binding ofImportin 2. The alignment and terminology is from Bogerd and colleagues (Bogerd et al., 1999) with J representing a hydrophilic amino acid and Z, ahydrophobic amino acid. (E)Point mutations of the M9 consensus (C86Y, P95L or C108G) abolish the interaction between Importin 2 and RP2. FLAG-taggedRP2 with various mutations were transfected into HEK293 cells with Myc-tagged Importin 2. After immunoprecipitation with anti-FLAG antibody, proteins wereresolved on a Bis-Tris gel and transferred to nitrocellulose. Blotting was then performed with anti-FLAG or anti-Myc antibodies.

Jour

nal o

f Cel

l Sci

ence

nucleus. Ran GTP releases the cargo as well as Importin- proteinsfrom Importin 1 within the nucleus (for a review, see Cook et al.,2007). Importin 2 (also known as transportin-1) does not useImportin- proteins but rather directly interacts with cargoes,releasing them upon binding Ran GTP (Pollard et al., 1996;Bonifaci et al., 1997; Siomi et al., 1997). Importin 2 usually bindsa different sequence than Importin 1, such as the M9-likesequences we describe in RP2 (Michael et al., 1995; Weighardt etal., 1995; Bogerd et al., 1999). Mutation of this M9 sequence inRP2 impaired binding of RP2 to Importin 2 and impaired RP2trafficking to the cilia. We also identified a polybasic NLS sequencein the N-terminus of RP2. However, this polybasic sequence couldnot support Importin 2 binding in full-length RP2 when the M9sequence was mutated. We did observe trafficking to the cilia ofthe smaller 1–15 GFP–RP2 fragment, which contains only thelipid modified sites and the polybasic NLS. The trafficking of thisfragment might be different than that of the full-length RP2 becauseof its smaller size, which allows easier ciliary entry, or moreefficient interaction of the polybasic NLS in this smaller fragmentwith Importin proteins.

The binding and trafficking data reported here define additionalroles for Ran and its binding partners aside from nuclear trafficking.Indeed, studies have already identified additional cellular roles for

724 Journal of Cell Science 124 (5)

Ran and its binding partners. One of the best described additionalroles is the trafficking and regulation of proteins that are crucialfor spindle assembly during cell division (for a review, seeCiciarello et al., 2007; Clarke and Zhang, 2008; Kalab and Heald,2008). In this process, Importin proteins bind and inhibit factorssuch as HURP and TPX2, which are essential for microtubulespindle growth, and this inhibition is relieved by Ran-GTP (Grusset al., 2001; Nachury et al., 2001; Wiese et al., 2001; Silljé et al.,2006). Although these roles have been ascribed for Importin 1and its Importin- binding partners, Importin 2 might also havea role in mitotic spindle assembly (Lau et al., 2009). In this reportand other recent reports, we also suggest a further role for Importinproteins in centrosomal and cilia targeting (Dishinger et al., 2010;Fan et al., 2007). In the first of these studies, we demonstrated thetrafficking of a Crumbs3 splice isoform to the cilia andpericentrosomal region (Fan et al., 2007). We described a role forRan and Importin 1 in this trafficking. More recently, Verhey andco-workers have demonstrated a role for Importin 2 in thetrafficking of Kif17 to the cilia through an NLS sequence in the C-terminus (Dishinger et al., 2010). These data fit well with thehypothesis that Ran and Importin proteins control cilia traffic,possibly via the previously hypothesized ciliary pore at the base ofthe cilia (Rosenbaum and Witman, 2002). Others have noted thesimilarity between IFT proteins and nuclear pore proteins (Jekelyand Arendt, 2006) and the similarities of nuclear and cilia pores(Christensen et al., 2007).

Although the trafficking of RP2 to the cilia appeared to beregulated by Importin 2, we found that RP2 also bound to Importin1 and Importin 3. Knockdown of Importin 1 affects celldivision, thus it is not possible to detect its affect on cilia trafficking.Our preliminary data with knockdown of Importin 3 showed noeffect on RP2 trafficking (our unpublished observations). Bindingto Importin 2 was the strongest and was detected in three differentassays, so this might explain why cilia defects were seen primarilywith knockdown of Importin 2. We also found that the sites ofmyristoylation and palmitoylation on the N-terminus of RP2 areimportant for the binding of RP2 to Importin proteins. Recentstudies from Cheetham and co-workers have also found that lipidmodification is important for targeting to the cilia base (Evans etal., 2010). We have observed similar defects in cilia trafficking ofRP2 mutated at the lipid modification sites in polarized epithelialcells (Hurd et al., 2010). In fact, although mutation of the NLSsequences did not affect binding of Importin 2 to RP2 we foundthat mutation of the myristoylation site did impair Importin 2binding. This is somewhat consistent with our results withCrumbs3–CLP1 where we have found that the transmembranedomain is essential for binding of Importin proteins (Fan et al.,2007) (our unpublished observations). These results suggest thatmembrane attachment is essential for Importin binding to thesetargets, but it is not clear whether it is directly involved or isessential for other cofactors. In this regard, it is interesting to notethat some Importin proteins have been described to be membraneassociated (Hachet et al., 2004).

It is also interesting to note that although RP2 could bindImportin proteins, we could not detect RP2 in the nucleus ofepithelial cells despite trying several conditions, including UVstress, previously reported to send RP2 to the nucleus in HeLa andRPE cells (Yoon et al., 2006). If we removed the lipid anchor bymutating Gly2 to alanine, RP2 moved to the nucleus instead of thecilia (Hurd et al., 2010). Whether this involves binding to otherImportin proteins is unclear, because this mutation did block

Fig. 7. The interaction between Importin 2 and M9 sequence of RP2 iscrucial for RP2 ciliary targeting. (A)Mutation of NLS region of RP2 doesnot prevent RP2 ciliary targeting. MDCK cells were transfected with RP2–EGFP (green) with the NLS motif mutated (KRRK–AAAA). Cilia are stainedwith anti-polyglutamylated tubulin (red). (B)Point mutations in the M9sequence, either C89Y or P95L of RP2–EGFP blocks ciliary targeting. MDCKcells expressing EGFP–RP2 with point mutation of the M9 sequence, C89Y(top panel) or P95L (bottom panel) were grown for 7 days after confluence onTranswell filters. Cilia are stained with anti-polyglutamylated tubulin (red),whereas EGFP–RP2 is green. Scale bars: 10m.

Jour

nal o

f Cel

l Sci

ence

725Importin 2 and RP2

binding of Importin 2 to RP2. The role of lipid modification inprotein trafficking to the cilia and flagella has been described(Emmer et al., 2009; Hurd and Margolis, 2009; Saric et al., 2009).Recently Pazour and colleagues have described a cilia-traffickingmotif in the Fibrocystin gene (Follit et al., 2010). They identifieda sequence that contains lipid modification sites, as well as apolybasic region, to be necessary for targeting a fragment of thisprotein to the cilia. However, in their data they did not invoke theRan–Importin system, but rather describe interactions of thissequence with Rab8.

In summary, our data indicate an important role for the Importinproteins in cilia trafficking. Ran and Importin proteins have beenfound consistently in cilia and centrosomal proteomes (Andersenet al., 2003; Liu et al., 2007; Pazour et al., 2005), and combinedwith studies such as those presented here, leave little doubt that theRan–Importin system is localized to the cilia and centrosome.However, further work is required to understand their completerole. As previously described, the Ran–Importin system couldwork similarly to its role in nuclear trafficking by releasing cargoin a Ran-dependent fashion from Importin proteins at the base ofthe cilia. However the Ran–Importin system might have otherroles in the cilia that need to be considered. One is the finding thatImportin proteins have important roles in microtubule growth andmight have a role in building the cilia (Carazo-Salas et al., 2001).Our results upon knockdown of Importin 2 showed, however,that cilia formed normally. Another possible role is trafficking ofproteins from the cilia to the nucleus. There is an expandingdescription of signaling proteins that travel from the cilia to thenucleus, and Importin proteins in the cilia might have a role in thisprocess. Proteins travel from the cilia to the nucleus in severalsignaling pathways (Haycraft et al., 2005; Huangfu et al., 2003;Lal et al., 2008), suggesting that Importin proteins could alsofunction to traffic proteins out of the cilia. Regardless, it seemslikely that the role of the Ran–Importin system in cilia function isa rich area for future study.

Materials and MethodsAntibodiesRabbit anti-RP2 antibody was generated by immunization with recombinant humanRP2 (Cocalico Biologicals, Reamstown, PA). Antibody was affinity purified withimmobilized recombinant human HIS-RP2. Mouse anti-FLAG, anti-acetylatedtubulin, anti--tubulin, anti-polyglutamylated tubulin, anti-g-tubulin and rabbit anti-Importin-2 antibodies were purchased from Sigma. Rabbit anti-EGFP was purchasedfrom Invitrogen. Rabbit anti-Myc was purchased from Bethyl labs and mouse anti-Importin-1 was from Affinity Bioreagent. Rabbit anti-pericentrin was purchasedfrom Covance. Mouse anti-Importin-3 was purchased from Abnova. Mouse anti-Ran was purchased from BD Biosciences.

ConstructsAll constructs were generated by PCR from full-length ESTs (Mouse Importin 1,2 and 3; Open Biosystems, Huntsville, AL). RP2–EGFP and RP2–FLAGexpression constructs were generated by cloning the human RP2 open reading frameinto pEGFP-N1 and pQCXIP respectively. For GST fusions, open-reading frameswere cloned into unique restriction sites of pGEX-4T3 (GE Healthcare). Myc-taggedImportin proteins and Importin-2–EGFP were cloned into the multiple cloning sitesof pQCXIH or pEGFP-N1, respectively (Clontech). For recombinant proteinexpression, ORFs of Importin and Ran were cloned into pGEX4T3 (GE Healthcare).

Cell cultureMDCKII and HEK293 cells were grown in DMEM supplemented with 10% FBS,100 U/ml penicillin, 100 g/ml streptomycin sulfate and 2 mM L-glutamine. Forgeneration of stable MDCK cell lines, HEK293T cells were transiently transfectedwith pGAG/POL and pVSVG plus either pQCXIH for stable protein expression orpSIREN-RetroQ for shRNA expression (Clontech). Virus-containing medium wascollected, filtered though a 0.4 m filter and mixed with an equal volume of freshculture medium. Polybrene (Clontech) was added to 4 g/ml and virus was added toMDCKII cells. 12 hours later, medium was replaced. 48 hours after infection, stableexpressing pools were selected using medium containing 200 g/ml Hygromycin or

5 g/ml Puromycin, respectively (Invitrogen, Carlsbad, CA). All transient transfectionexperiments were performed using Fugene 6 reagent (Roche).

Immunofluorescence and confocal microscopyWe performed immunofluorescence as described previously (Fan et al., 2007). Ingeneral, cells were fixed with 4% paraformaldehyde for 15 minutes. After briefwashing, 0.25% Triton X-100 in PBS was used to permeabilize the cells in mostconditions. We used 0.1% Triton X-100 in PBS to permeabilize cells for ciliarystaining. For g-tubulin and pericentrin staining, we used cold acetone to fix the cellsfor 4 minutes. These procedures were followed by 3% goat serum in PBS blockingfor 30 minutes. Primary antibodies and secondary antibodies were diluted andincubated as previously described (Fan et al., 2007). All images were obtained usingeither inverted fluorescence microscope (Nikon Eclipse TE2000U) or a meta laser-scanning confocal microscope (LSM 510; Carl Zeiss MicroImaging).

Protein knockdownCanine Importin 2 sequences GCAGTGCCTTTGCTACCTTAG andGCATGTTAAGCCTTGTATAGC were selected as Importin 2 shRNA targetingsequences. These sequences were placed into the Clontech shRNA Sequence DesignerTool and the selected oligos were annealed and ligated in pSIREN-RetroQ (Clontech)to encode the shRNA. Retroviral shRNA infection was as above.

Centrosome purificationCentrosomes were isolated using a modified protocol (Zhou et al., 2006). In brief,MDCKII cells were grown for 6 days after confluence before incubation with 10g/ml nocodazole and 5 g/ml cytochalasin B at 37°C for 90 minutes. Cells werewashed with PBS, 8% sucrose in 0.1� PBS, and finally 8% sucrose. Cells werelysed (1 mM HEPES, pH 7.2, 0.5% NP-40, 0.5 mM MgCl2, 0.1% 2-mercaptoethanol,and protease inhibitors) with shaking at 4°C for 10 minutes. Lysates were cleared bycentrifugation at 2500 g for 10 minutes and supernatant was filtered through a 40m nylon mesh. HEPES (pH 7.2) was added to a final concentration of 10 mM andDNaseI added to 2 U/ml followed by incubation on ice for 30 minutes. Lysates wereunderlaid with 60% sucrose solution (60% wt/wt sucrose in 10 mM PIPES, pH 7.2,0.1% Triton X-100 and 0.1% 2-mercaptoethanol) and spun at 25,000 g for 45minutes to sediment centrosomes into the sucrose cushion. The sucrose cushion wascollected and diluted with lysis buffer to a final concentration of sucrose of 30%.The centrosome preparation was then loaded onto a discontinuous sucrose gradient(0.5 ml of 70%, 0.3 ml of 50% and 0.3 ml of 40% sucrose solution) and spun at120,000 g for 60 minutes. Fractions (0.15 ml each) were collected and diluted with1 ml of 10 mM PIPES, pH 7.2 and sedimented by centrifugation at 16,000 g for 15minutes. For centrosomal protein analysis, the supernatant was discarded and thepelleted protein resuspended in LDS sample buffer (Invitrogen).

Immunoprecipitation and western blottingHEK293 and MDCK cells were rinse twice in ice-cold PBS and lysed in Triton lysisbuffer [1% Triton X-100 (v/v), 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1.5 mMMgCl2, 10% (v/v) glycerol] followed by centrifugation. For anti-FLAGimmunoprecipitations, FLAG M2 beads (Sigma) were added to cleared lysates andincubated overnight at 4°C. For Myc and HA immunoprecipitations, cleared lysateswere incubated overnight at 4°C with 2 g of appropriate antibody plus 20 lProtein-A–Sepharose (Invitrogen). Immunoprecipitations were washed four timeswith lysis buffer and resuspended in LDS sample buffer (Invitrogen). Samples weresubsequently run on 4–12% Bis-Tris Novex gels (Invitrogen) and transferred toPVDF. Membranes were blocked with 5% BSA-TBS and primary antibodiesincubated for 1 hour in blocking buffer. Secondary antibodies were added in 5%non-fat milk in TBS with 0.05% Tween20 for 1 hour. For GST pull-down experiments,4 g glutathione Sepharose4B immobilized GST protein was incubated with clearedlysate overnight at 4°C. Beads were then washed four times with lysis bufferand resuspended in LDS sampled buffer. For MS/MS analysis FLAGimmunoprecipitations were performed as described above and run on Bis-Tris gels.Gels were subsequently washed and stained with Imperial Blue colloidal Coomassie(Pierce) and positive bands excised. MS/MS analysis was performed by the MichiganProteome Consortium.

We thank Anand Swaroop, Hemant Khanna, Kristen Verhey andJeff Martens for support and helpful discussions. The work wassupported by a grant from the PKD Foundation and by NIH DK84725.This work utilized the Microscopy Core of the Michigan DiabetesResearch and Training Center funded by DK020572 from the NationalInstitute of Diabetes and Digestive and Kidney Diseases. Deposited inPMC for release after 12 months.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/124/5/718/DC1

Jour

nal o

f Cel

l Sci

ence

726 Journal of Cell Science 124 (5)

ReferencesAndersen, J. S., Wilkinson, C. J., Mayor, T., Mortensen, P., Nigg, E. A. and Mann, M.

(2003). Proteomic characterization of the human centrosome by protein correlationprofiling. Nature 426, 570-574.

Bartolini, F., Bhamidipati, A., Thomas, S., Schwahn, U., Lewis, S. A. and Cowan, N.J. (2002). Functional overlap between retinitis pigmentosa 2 protein and the tubulin-specific chaperone cofactor C. J. Biol. Chem. 277, 14629-14634.

Berbari, N., O’Connor, A., Haycraft, C. and Yoder, B. (2009). The primary cilium as acomplex signaling center. Curr. Biol. 19, R526-R535.

Bogerd, H. P., Benson, R. E., Truant, R., Herold, A., Phingbodhipakkiya, M. andCullen, B. R. (1999). Definition of a consensus transportin-specific nucleocytoplasmictransport signal. J. Biol. Chem. 274, 9771-9777.

Bonifaci, N., Moroianu, J., Radu, A. and Blobel, G. (1997). Karyopherin 2 mediatesnuclear import of a mRNA binding protein. Proc. Natl. Acad. Sci. USA 94, 5055-5060.

Carazo-Salas, R. E., Gruss, O. J., Mattaj, I. W. and Karsenti, E. (2001). Ran-GTPcoordinates regulation of microtubule nucleation and dynamics during mitotic-spindleassembly. Nat. Cell Biol. 3, 228-234.

Chapple, J. P., Hardcastle, A. J., Grayson, C., Willison, K. R. and Cheetham, M. E.(2002). Delineation of the plasma membrane targeting domain of the X-linked retinitispigmentosa protein RP2. Invest. Ophthalmol. Vis. Sci. 43, 2015-2020.

Christensen, S. T., Pedersen, L. B., Schneider, L. and Satir, P. (2007). Sensory cilia andintegration of signal transduction in human health and disease. Traffic 8, 97-109.

Ciciarello, M., Mangiacasale, R. and Lavia, P. (2007). Spatial control of mitosis by theGTPase Ran. Cell. Mol. Life Sci. 64, 1891-1914.

Clarke, P. R. and Zhang, C. (2008). Spatial and temporal coordination of mitosis by RanGTPase. Nat. Rev. Mol. Cell Biol. 9, 464-477.

Cook, A., Bono, F., Jinek, M. and Conti, E. (2007). Structural biology ofnucleocytoplasmic transport. Annu. Rev. Biochem. 76, 647-671.

Dishinger, J. F., Kee, H. L., Jenkins, P. M., Fan, S., Hurd, T. W., Hammond, J. W.,Truong, Y. N., Margolis, B., Martens, J. R. and Verhey, K. J. (2010). Ciliary entryof the kinesin-2 motor KIF17 is regulated by importin-beta2 and RanGTP. Nat. CellBiol. 12, 703-710.

Emmer, B., Souther, C., Toriello, K., Olson, C., Epting, C. and Engman, D. (2009).Identification of a palmitoyl acyltransferase required for protein sorting to the flagellarmembrane. J. Cell Sci. 122, 867-874.

Evans, R. J., Hardcastle, A. J. and Cheetham, M. E. (2006). Focus on Molecules: Xlinked Retinitis Pigmentosa 2 protein, RP2. Exp. Eye Res. 82, 543-544.

Evans, R. J., Schwarz, N., Nagel-Wolfrum, K., Wolfrum, U., Hardcastle, A. J. andCheetham, M. E. (2010). The retinitis pigmentosa protein RP2 links pericentriolarvesicle transport between the Golgi and the primary cilium. Hum. Mol. Genet. 19, 1358-1367.

Fan, S., Fogg, V., Wang, Q., Chen, X. W., Liu, C. J. and Margolis, B. (2007). A novelCrumbs3 isoform regulates cell division and ciliogenesis via importin beta interactions.J. Cell Biol. 178, 387-398.

Follit, J., Li, L., Vucica, Y. and Pazour, G. (2010). The cytoplasmic tail of fibrocystincontains a ciliary targeting sequence. J. Cell Biol. 188, 21-28.

Geng, L., Okuhara, D., Yu, Z., Tian, X., Cai, Y., Shibazaki, S. and Somlo, S. (2006).Polycystin-2 traffics to cilia independently of polycystin-1 by using an N-terminalRVxP motif. J. Cell Sci. 119, 1383-1395.

Gruss, O. J., Carazo-Salas, R. E., Schatz, C. A., Guarguaglini, G., Kast, J., Wilm, M.,Le Bot, N., Vernos, I., Karsenti, E. and Mattaj, I. W. (2001). Ran induces spindleassembly by reversing the inhibitory effect of importin [alpha] on TPX2 activity. Cell104, 83-93.

Hachet, V., Kcher, T., Wilm, M. and Mattaj, I. (2004). Importin alpha associates withmembranes and participates in nuclear envelope assembly in vitro. EMBO J. 23, 1526-1535.

Hardcastle, A. J., Thiselton, D. L., Van Maldergem, L., Saha, B. K., Jay, M., Plant,C., Taylor, R., Bird, A. C. and Bhattacharya, S. (1999). Mutations in the RP2 genecause disease in 10% of families with familial X-linked retinitis pigmentosa assessedin this study. Am. J. Hum. Genet. 64, 1210-1215.

Haycraft, C. J., Banizs, B., Aydin-Son, Y., Zhang, Q., Michaud, E. J. and Yoder, B. K.(2005). Gli2 and Gli3 localize to cilia and require the intraflagellar transport proteinpolaris for processing and function. PLoS Genet. 1, e53.

Huangfu, D., Liu, A., Rakeman, A. S., Murcia, N. S., Niswander, L. and Anderson, K.V. (2003). Hedgehog signalling in the mouse requires intraflagellar transport proteins.Nature 426, 83-87.

Hurd, T. and Margolis, B. (2009). Cystin, cilia, and cysts: unraveling traffickingdeterminants. J. Am. Soc. Nephrol. 20, 2485-2486.

Hurd, T., Zhou, W., Jenkins, P., Liu, C.-J., Swaroop, A., Khanna, H., Martens, J.,Hildebrandt, F. and Margolis, B. (2010). The retinitis pigmentosa protein RP2 interactswith polycystin 2 and regulates cilia-mediated vertebrate development. Hum. Mol.Genet. 19, 4330-4440.

Jekely, G. and Arendt, D. (2006). Evolution of intraflagellar transport from coatedvesicles and autogenous origin of the eukaryotic cilium. BioEssays 28, 191-198.

Jenkins, P. M., Hurd, T. W., Zhang, L., McEwen, D. P., Brown, R. L., Margolis, B.,Verhey, K. J. and Martens, J. R. (2006). Ciliary targeting of olfactory CNG channelsrequires the CNGB1b subunit and the kinesin-2 motor protein, KIF17. Curr. Biol. 16,1211-1216.

Jkel, S. and Grlich, D. (1998). Importin beta, transportin, RanBP5 and RanBP7 mediatenuclear import of ribosomal proteins in mammalian cells. EMBO J. 17, 4491-4502.

Kalab, P. and Heald, R. (2008). The RanGTP gradient-a GPS for the mitotic spindle. J.Cell Sci. 121, 1577-1586.

Khnel, K., Veltel, S., Schlichting, I. and Wittinghofer, A. (2006). Crystal structure of thehuman retinitis pigmentosa 2 protein and its interaction with Arl3. Structure 14, 367-378.

Lal, M., Song, X., Pluznick, J. L., Di Giovanni, V., Merrick, D. M., Rosenblum, N. D.,Chauvet, V., Gottardi, C. J., Pei, Y. and Caplan, M. J. (2008). Polycystin-1 C-terminal tail associates with beta-catenin and inhibits canonical Wnt signaling. Hum.Mol. Genet. 17, 3105-3117.

Lau, C. K., Delmar, V. A., Chan, R. C., Phung, Q., Bernis, C., Fichtman, B., Rasala,B. A. and Forbes, D. J. (2009). Transportin regulates major mitotic assembly events:from spindle to nuclear pore assembly. Mol. Biol. Cell 20, 4043-4058.

Liu, Q., Tan, G., Levenkova, N., Li, T., Pugh, E. N., Jr., Rux, J. J., Speicher, D. W.and Pierce, E. A. (2007). The proteome of the mouse photoreceptor sensory ciliumcomplex. Mol. Cell. Proteomics 6, 1299-1317.

Mazelova, J., Astuto-Gribble, L., Inoue, H., Tam, B. M., Schonteich, E., Prekeris, R.,Moritz, O. L., Randazzo, P. A. and Deretic, D. (2009). Ciliary targeting motif VxPxdirects assembly of a trafficking module through Arf4. EMBO J. 28, 183-192.

Michael, W., Choi, M. and Dreyfuss, G. (1995). A nuclear export signal in HNRNP 1-a signal-mediated, temperature-dependent nuclear-protein export pathway. Cell 83, 415-422.

Nachury, M. V., Maresca, T. J., Salmon, W. C., Waterman-Storer, C. M., Heald, R.and Weis, K. (2001). Importin [beta] is a mitotic target of the small GTPase ran inspindle assembly. Cell 104, 95-106.

Pazour, G. J. and Bloodgood, R. A. (2008). Chapter 5: targeting proteins to the ciliarymembrane. In Current Topics in Developmental Biology, Vol. 85 (ed. B. K. Yoder), pp.115-149: Academic Press, San Diego, CA.

Pazour, G. J., Agrin, N., Leszyk, J. and Witman, G. B. (2005). Proteomic analysis of aeukaryotic cilium. J. Cell Biol. 170, 103-113.

Pedersen, L. B., Veland, I. R., Schroder, J. M. and Christensen, S. T. (2008). Assemblyof primary cilia. Dev. Dyn. 237, 1993-2006.

Pollard, V. W., Michael, W. M., Nakielny, S., Siomi, M. C., Wang, F. and Dreyfuss, G.(1996). A novel receptor-mediated nuclear protein import pathway. Cell 86, 985-994.

Rosenbaum, J. L. and Witman, G. B. (2002). Intraflagellar transport. Nat. Rev. Mol. CellBiol. 3, 813-825.

Saric, M., Vahrmann, A., Niebur, D., Kluempers, V., Hehl, A. and Scholze, H. (2009).Dual acylation accounts for the localization of {alpha}19-giardin in the ventral flagellumpair of Giardia lamblia. Eukaryot. Cell 8, 1567-1574.

Sharon, D., Bruns, G. A. P., McGee, T. L., Sandberg, M. A., Berson, E. L. and Dryja,T. P. (2000). X-Linked retinitis pigmentosa: mutation spectrum of the RPGR and RP2genes and correlation with visual function. Invest. Ophthalmol. Vis. Sci. 41, 2712-2721.

Silljé, H. H. W., Nagel, S., Körner, R. and Nigg, E. A. (2006). HURP is a ran-importin[beta]-regulated protein that stabilizes kinetochore microtubules in the vicinity ofchromosomes. Curr. Biol. 16, 731-742.

Silverman, M. and Leroux, M. (2009). Intraflagellar transport and the generation ofdynamic, structurally and functionally diverse cilia. Trends Cell Biol. 19, 306-316.

Siomi, M. C., Eder, P. S., Kataoka, N., Wan, L., Liu, Q. and Dreyfuss, G. (1997).Transportin-mediated nuclear import of heterogeneous nuclear RNP proteins. J. CellBiol. 138, 1181-1192.

Stewart, M. (2007). Molecular mechanism of the nuclear protein import cycle. Nat. Rev.Mol. Cell Biol. 8, 195-208.

Thiselton, D. L., Zito, I., Plant, C., Jay, M., Hodgson, S. V., Bird, A. C., Bhattacharya,S. S. and Hardcastle, A. J. (2000). Novel frameshift mutations in the RP2 gene andpolymorphic variants. Hum. Mutat. 15, 580.

Veltel, S., Gasper, R., Eisenacher, E. and Wittinghofer, A. (2008). The retinitispigmentosa 2 gene product is a GTPase-activating protein for Arf-like 3. Nat. Struct.Mol. Biol. 15, 373-380.

Weighardt, F., Biamonti, G. and Riva, S. (1995). Nucleo-cytoplasmic distribution ofhuman hnRNP proteins: a search for the targeting domains in hnRNP A1. J. Cell Sci.108, 545-555.

Wiese, C., Wilde, A., Moore, M. S., Adam, S. A., Merdes, A. and Zheng, Y. (2001).Role of importin-beta in coupling ran to downstream targets in microtubule assembly.Science 291, 653-656.

Yoon, J.-H., Qiu, J., Cai, S., Chen, Y., Cheetham, M., Shen, B. and Pfeifer, G. (2006).The retinitis pigmentosa-mutated RP2 protein exhibits exonuclease activity andtranslocates to the nucleus in response to DNA damage. Exp. Cell Res. 312, 1323-1334.

Zhou, C., Cunningham, L., Marcus, A. I., Li, Y. and Kahn, R. A. (2006). Arl2 and Arl3regulate different microtubule-dependent processes. Mol. Biol. Cell 17, 2476-2487.

Jour

nal o

f Cel

l Sci

ence