HUMAN MUTATION 7:180-185 (1996)

MUTATION NOTES

A Novel null Mutation in the Rhodopsin Gene Causing Late Onset Autosomal Dominant Retinitis Pigmentosa; Beatriz Sanchez, Salud Borrego, Pedro Chaparro, Trinidad Rueda, Firancisca Lbpez, and Guillermo Antifiolo’, Unidud de Genitica Medica (B.S., S.B., G.A.), Serwicio de Neurofisiologia (P.C.), und Servicio de Oftalmologia (T.R., F.L.), Hospital Uniwersituno “Virgen del Rocio,” 41013 Sewilla, Spain; Fax: 34-5-424-81 I I Communicated by Michel Goossens Received November 16, 1994; accepted December 24, 1994. 0 1996 Wiley-Liss, Inc. ‘To whom reprint requestdcorrespondence should be addressed.

Retinitis pigmentosa (RP) is the most common inherited retinal degeneration. Mutations in the rhodopsin gene account for a subset of autosomal dominant (ad) RP. Three stop codon mutations have been identified in the rhodopsin gene, namely Q344X (Sung et al., 1991), Q64X (Macke et al., 1993), and E249X (Rosenfeld et al., 1992). Q344X and Q64X have been associated with adRP. E249X has been related to autosomal recessive RP. Here we report the fourth nonsense mutation located at codon 136 within exon 2 of the rhodopsin gene in a Spanish family with late onset mild autosomal dominant retinitis pigmentosa (adRP). Using the met’hod of single strand conformation polymorphism (SSCP) to detect mutations in rhodopsin coding sequences, we analyzed the DNA of the family members with adRP. After PCR amplification of exon 2 of rhodopsin gene using the primers sense 5’GCAGTGGGGTCTGTGCTGAC3’, antisense 5’AGAGC- CCCCGGAGCTTCTTC3’, an altered SSCP pattern was detected in affected individuals. Direct sequencing of exon 2 revealed a C-to-A transversion in codon 136 resulting in a nonsense mutation Y136X. This mutation was present in heterozygous condition. The C-to-A transversion in codon 136 abolishes a RsaI restriction site in exon 2. Digestion of normal DNA yields two fragments (165 and 86 bp). The loss of the RsaI restriction site in the mutant allele results in an additional 251-bp fragment in affected individuals. Using this assay none of the 150 normal unrelated control individuals tested showed the loss of the RsaI site.

Younger individuals carrying Y136X mutation (aged 34, 42, and 43) show characteristic pigmentary deposits in fundi with normal ERG, indicating a well-preserved photoreceptor function, while the ophthalmological examination of the older individual (aged 75) is consistent with RP in advanced stage.

It has been reported that the primary consequence of a premature termination codon (FTC) is a severe reduction in the level of mRNA of mutant allele (Beserga et al., 1988) more than the production of a truncated polypeptide. The degree to which the mRNA level was affected appears to depend on the mutation site in the coding sequence (Urlaub et al., 1989). It suggests that mutation Y136X may result in a reduction in the amount of transcript from the mutant allele leading to lower expression of aberrant protein and a milder phenotype. The different clinical expresion observed between individuals with nonsense mutations E249X (Rosenfeld et al., 1992) and Y136X in a heterozygous status suggests that there may be factors other than the reduction in the level of mRNA of mutant allele influencing the clinical expresion in these cases.

ACKNOWLEDGMENTS This work has been supported by the Fondo de Investigaciones Sanitarias (94/0758), the Federacih de Asociaciones de Retinitis

Pigmentaria del Estado Espadol, and the Fundaci6n ONCE.

REFERENCES Beserga SJ, Benz EJ (1988) Nonsense mutations in the human P-globin gene affect mRNA metabolism. Proc Natl Acad Sci USA 85:2056-2060. Macke JP, Davenport CM, Jacobson SG, Hennessey JC, Gonzalez-Fernandez F, Conway BP, Heckenlively J , Palmer R, Maumenee IH, Sieving P, Gouras P,

Good W, Nathans J (1993) Identification of novel rhodopsin mutations responsible for retinitis pigmentosa: implications for the structure and function of rhodopsin. Am J Hum Genet 53:80-89.

Rosenfeld PJ, Cowley GS, McGee TL, Sandberg MA, Berson EL, Dryja TP (1992) A null mutation in the rhodopsin gene causes rod photoreceptor dysfunction in autosomal recessive retinitis pigmentosa. Nature Genet 1:209-213.

Sung CH, Davenport CM, Hennessey JC, Maumenee IH, Jacobson SG, Heckenlively JR, Nowakowsky R, Fishrnan G, Gouras P, Nathans J (1991) Rhodoposin mutations in autosomal dominant retinitis pigmentosa. Proc Natl Acad Sci USA 88:6481-6485.

Urlaub G, Mitchell PJ, Ciudad CJ, Chasm LA (1989) Nonsense mutations in the dihydropholate reductase gene affect RNA processing. Mol Cell Biol 9:2868-2880.

Missense Mutation A346P in the Rhodopsin Gene in One Family With Autosomal Dominant Retinitis Pigmentosa; Salud Borrego, Beatriz Sanchez, Agustin Ruiz, and Guillermo Antifiolo’, Unidud de Gene‘tica Me‘dica, Hospital Uniwersituno 4 I01 3 Sewilh, Spain Communicated by Michel Goossens Received January 19, 1995, accepted March 28, 1995. 0 1996 Wdey-Liss, lnc. ‘To whom reprint requestsicorrespondence should be addressed.

Retinitis pigmentosa (RP) is the most common inherited retinal degeneration. A subset of patients with autosomal dominant (ad) RP carry a mutation in the rhodopsin gene. We have identified a new missense rhodopsin mutation. namely A346P, which cosegregates with the disease phenotype in one Spanish family with adRP. Affected individuals in this family show onset 3f the disease with night blindness